Impact of Supplemented Nutrition on Semen Quality, Epigenetic-Related Gene Expression, and Oxidative Status in Boars
Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Animals and Experimental Design
2.2. Computer Assisted Sperm Analysis
2.3. Oxidative Stress Parameters Assesment
2.4. Epigenetic-Related Genes Expression
2.4.1. RNA Extraction and cDNA Synthesis
2.4.2. Real-Time PCR (q-PCR)
2.5. Data Analysis
3. Results
3.1. Semen Quality Parameters
3.2. Oxidative Stress Parameters
3.3. Epigenetic-Related Gene Expression Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Waberski, D.; Riesenbeck, A.; Schulze, M.; Weitze, K.F.; Johnson, L. Application of preserved boar semen for artificial insemination: Past, present and future challenges. Theriogenology 2019, 137, 2–7. [Google Scholar] [CrossRef] [PubMed]
- Mellagi, A.P.; Will, K.J.; Quirino, M.; Bustamante-Filho, I.C.; Ulguim, R.D.R.; Bortolozzo, F.P. Update on artificial insemination: Semen, techniques, and sow fertility. Mol. Reprod. Dev. 2023, 90, 601–611. [Google Scholar] [CrossRef] [PubMed]
- Namuncura, C.; Sánchez, R.; Pezo, F.; Uribe, P.; Navarro, P.; Zambrano, F. Rest days and storage of boar semen at 17 °C: Effect on motility and sperm concentration. Andrologia 2020, 52, e13578. [Google Scholar] [CrossRef]
- Pascoal, G.D.F.L.; Geraldi, M.V.; Maróstica, M.R., Jr.; Ong, T.P. Effect of paternal diet on spermatogenesis and offspring health: Focus on epigenetics and interventions with food bioactive compounds. Nutrients 2022, 14, 2150. [Google Scholar] [CrossRef]
- Lee, S.H.; Kim, Y.J.; Kang, B.H.; Yun, Y.S.; Park, C.K. The relationship between acrosome reaction and polyunsaturated fatty acid composition in boar sperm. Reprod. Domest. Anim. 2020, 55, 624–631. [Google Scholar] [CrossRef]
- Galić, I.; Dragin, S.; Stančić, I.; Maletić, M.; Apić, J.; Kladar, N.; Spasojević, J.; Grba, J.; Kovačević, Z. Effect of an Antioxidant Supplement Combination on Boar Sperm. Animals 2022, 12, 1301. [Google Scholar] [CrossRef]
- Kaewma, S.; Suphappornchai, S.; Suwimonteerabutr, J.; Am-In, N.; Techakumphu, M. Zinc supplementation improves semen quality in boars. Thai J. Vet. Med. 2021, 51, 489–500. [Google Scholar] [CrossRef]
- Lugar, D.W.; Harlow, K.E.; Hundley, J.; Goncalves, M.; Bergstrom, J.; Stewart, K.R. Effects of increased levels of supplemental vitamins during the summer in a commercial artificial insemination boar stud. Animal 2019, 13, 2556–2568. [Google Scholar] [CrossRef]
- Bansal, A.K.; Bilaspuri, G.S. Effect of ferrous ascorbate on in vitro capacitation of crossbred cattle bull spermatozoa. Online J. Vet. Res. 2018, 22, 87–93. [Google Scholar]
- Betarelli, R.P.; Rocco, M.; Yeste, M.; Fernández-Novell, J.M.; Placci, A.; Azevedo Pereira, B.; Castillo-Martín, M.; Estrada, E.; Peña, A.; Zangeronimo, M.G.; et al. The achievement of boar sperm in vitro capacitation is related to an increase of disrupted disulphide bonds and intracellular reactive oxygen species levels. Andrology 2018, 6, 781–797. [Google Scholar] [CrossRef]
- Das, A.; Roychoudhury, S. Reactive oxygen species in the reproductive system: Sources and physiological roles. In Oxidative Stress and Toxicity in Reproductive Biology and Medicine; Advances in Experimental Medicine and, Biology; Kesari, K.K., Roychoudhury, S., Eds.; Springer International Publishing: Cham, Switzerland, 2022; Volume 1358, pp. 9–40. [Google Scholar] [CrossRef]
- Dutta, S.; Henkel, R.; Sengupta, P.; Agarwal, A. Physiological role of ROS in sperm function. In Male Infertility: Contemporary clinical Approaches, Andrology, ART and Antioxidants; Parekattil, S., Esteves, S., Agarwal, A., Eds.; Springer: Cham, Switzerland, 2020; pp. 337–345. [Google Scholar] [CrossRef]
- Huchzermeyer, B.; Menghani, E.; Khardia, P.; Shilu, A. Metabolic pathway of natural antioxidants, antioxidant enzymes and ROS providence. Antioxidants 2022, 11, 761. [Google Scholar] [CrossRef] [PubMed]
- Pezo, F.; Yeste, M.; Zambrano, F.; Uribe, P.; Risopatrón, J.; Sánchez, R. Antioxidants and their effect on the oxidative/nitrosative stress of frozen-thawed boar sperm. Cryobiology 2021, 98, 5–11. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.N.; Rauf, A.; Fahad, F.I.; Emran, T.B.; Mitra, S.; Olatunde, A.; Shariati, M.A.; Rebezov, M.; Rengasamy, K.R.; Mubarak, M.S. Superoxide dismutase: An updated review on its health benefits and industrial applications. Crit. Rev. Food Sci. Nutr. 2022, 62, 7282–7300. [Google Scholar] [CrossRef]
- Fang, Y.; Zhong, R. Effects of oxidative stress on spermatozoa and male infertility. In Free Radical Medicine and Biology; BoD: Norderstedt, Germany, 2020; Volume 10. [Google Scholar] [CrossRef]
- Schulze, M.; Schröter, F.; Jung, M.; Jakop, U. Evaluation of a panel of spermatological methods for assessing reprotoxic compounds in multilayer semen plastic bags. Sci. Rep. 2020, 10, 22258. [Google Scholar] [CrossRef]
- Rathke, C.; Baarends, W.M.; Awe, S.; Renkawitz-Pohl, R. Chromatin dynamics during spermiogenesis. Biochim. Biophys. Acta, Gene Regul. Mech. 2014, 1839, 155–168. [Google Scholar] [CrossRef]
- Teves, M.E.; Roldan, E.R. Sperm bauplan and function and underlying processes of sperm formation and selection. Physiol. Rev. 2022, 102, 7–60. [Google Scholar] [CrossRef]
- Patankar, A.; Parte, P. Sperm Chromatin Compaction and Male Infertility. In Male Infertility: Understanding, Causes and Treatment; Singh, R., Singh, K., Eds.; Springer: Singapore, 2017; pp. 295–315. [Google Scholar] [CrossRef]
- Menezo, Y.J.; Silvestris, E.; Dale, B.; Elder, K. Oxidative stress and alterations in DNA methylation: Two sides of the same coin in reproduction. Reprod. Biomed. Online 2016, 33, 668–683. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Swine, 11th ed.; National Research Council: Washington, DC, USA, 2012. [Google Scholar]
- Almeida, F.F.; Leal, M.C.; França, L.R. Testis morphometry, duration of spermatogenesis, and spermatogenic efficiency in the wild boar (Sus scrofa scrofa). Biol. Reprod. 2006, 75, 792–799. [Google Scholar] [CrossRef]
- Kuhlgatz, D.A.; Kuhlgatz, C.; Aepli, M.; Schumann, B.; Grossfeld, R.; Bortfeldt, R.; Jakop, U.; Jung, M.; Schulze, M. Development of predictive models for boar semen quality. Theriogenology 2019, 134, 129–140. [Google Scholar] [CrossRef]
- Paschoal, A.F.L.; Mellagi, A.P.G.; Ferrari, C.V.; Takeuti, K.L.; Oliveira, G.D.S.; Bernardi, M.L.; Ulguim, R.D.R.; Bortolozzo, F.P. Adjusted method of penis fixation during boar semi-automatic semen collection aiming to reduce bacterial contamination. Reprod. Domest. Anim. 2021, 56, 897–904. [Google Scholar] [CrossRef]
- Nedić, S.; Đurić, M.; Vakanjac, S.; Arsić, S.; Nedić, S.; Samardžija, M.; Borozan, S. Relationship between biochemical parameters and paraoxonase 1 activity of boar seminal plasma and semen quality. Vet. Res. Commun. 2023, 47, 1243–1253. [Google Scholar] [CrossRef] [PubMed]
- Fridovich, I. Superoxide Radical and Superoxide Dismutases. In Oxygen and Living Processes; Gilbert, D.L., Ed.; Springer: New York, NY, USA, 1981; pp. 250–272. [Google Scholar] [CrossRef]
- Yelumalai, S.; Giribabu, N.; Karim, K.; Omar, S.Z.; Salleh, N.B. In vivo administration of quercetin ameliorates sperm oxidative stress, inflammation, preserves sperm morphology and functions in streptozotocin-nicotinamide induced adult male diabetic rats. Arch. Med. Sci. 2019, 15, 240–249. [Google Scholar] [CrossRef] [PubMed]
- Flohé, L.; Günzler, W.A. Assays of glutathione peroxidase. In Methods in Enzymology; Packer, L., Ed.; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 114–120. [Google Scholar]
- Ahmed, A.Y.; Aowda, S.A.; Hadwan, M.H. A validated method to assess glutathione peroxidase enzyme activity. Chem. Pap. 2021, 75, 6625–6637. [Google Scholar] [CrossRef]
- Girotti, M.J.; Khan, N.; McLellan, B.A. Early measurement of systemic lipid peroxidation products in the plasma of major blunt trauma patients. J. Trauma Acute Care Surg. 1991, 31, 32–35. [Google Scholar] [CrossRef]
- Fusco, R.; Salinaro, A.T.; Siracusa, R.; D’Amico, R.; Impellizzeri, D.; Scuto, M.; Ontario, M.L.; Crea, R.; Cordaro, M.; Cuzzocrea, S.; et al. Hidrox® counteracts cyclophosphamide-induced male infertility through NRF2 pathways in a mouse model. Antioxidants 2021, 10, 778. [Google Scholar] [CrossRef]
- Zeng, C.; He, L.; Peng, W.; Ding, L.; Tang, K.; Fang, D.; Zhang, Y. Selection of optimal reference genes for quantitative RT-PCR studies of boar spermatozoa cryopreservation. Cryobiology 2014, 68, 113–121. [Google Scholar] [CrossRef]
- Zeng, C.; Peng, W.; Ding, L.; He, L.; Zhang, Y.; Fang, D.; Tang, K. A preliminary study on epigenetic changes during boar spermatozoa cryopreservation. Cryobiology 2014, 69, 119–127. [Google Scholar] [CrossRef]
- Mao, S.; Goodrich, R.J.; Hauser, R.; Schrader, S.M.; Chen, Z.; Krawetz, S.A. Evaluation of the effectiveness of semen storage and sperm purification methods for spermatozoa transcript profiling. Syst. Biol. Reprod. Med. 2013, 59, 287–295. [Google Scholar] [CrossRef]
- Goodrich, R.; Johnson, G.; Krawetz, S.A. The preparation of human spermatozoal RNA for clinical analysis. Arch. Andr. 2007, 53, 161–167. [Google Scholar] [CrossRef]
- Miyoshi, N.; Barton, S.C.; Kaneda, M.; Hajkova, P.; Surani, M.A. The continuing quest to comprehend genomic imprinting. Cytogenet. Genome Res. 2006, 113, 6–11. [Google Scholar] [CrossRef]
- Oliva, R. Protamines and male infertility. Hum. Reprod. Upd. 2006, 12, 417–435. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhao, J.; Xu, C.; Ma, N.; He, T.; Zhao, J.; Ma, X.; Thacker, P.A. Progress towards pig nutrition in the last 27 years. J. Sci. Food Agric. 2020, 100, 5102–5110. [Google Scholar] [CrossRef]
- Dong, H.J.; Wu, D.; Xu, S.Y.; Li, Q.; Fang, Z.F.; Che, L.Q.; Wu, C.M.; Xu, X.Y.; Lin, Y. Effect of dietary supplementation with amino acids on boar sperm quality and fertility. Anim. Reprod. Sci. 2016, 172, 182–189. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Li, J.; Wang, K.; Fang, Z.; Che, L.; Xu, S.; Feng, B.; Zhuo, Y.; Li, J.; Wu, D. Effects of dietary L-leucine supplementation on testicular development and semen quality in boars. Front. Vet. Sci. 2022, 9, 904653. [Google Scholar] [CrossRef] [PubMed]
- Parsley, M.A.; Wilson, M.E.; Gall, T.J.; Ballard, M.R.M. Effect of Stabilized Fish Oil Source on Sperm Quality and Production of Boars. Open J. Anim. Sci. 2021, 11, 197–207. [Google Scholar] [CrossRef]
- Li, J.; Barranco, I.; Tvarijonaviciute, A.; Molina, M.F.; Martinez, E.A.; Rodriguez-Martinez, H.; Parrilla, I.; Roca, J. Seminal plasma antioxidants are directly involved in boar sperm cryotolerance. Theriogenology 2018, 107, 27–35. [Google Scholar] [CrossRef]
- Vickram, S.; Rohini, K.; Srinivasan, S.; Veenakumari, D.N.; Archana, K.; Anbarasu, K.; Jeyanthi, P.; Thanigaivel, S.; Gulothungan, G.; Rajendiran, N.; et al. Role of zinc (Zn) in human reproduction: A journey from initial spermatogenesis to childbirth. Int. J. Mol. Sci. 2021, 22, 2188. [Google Scholar] [CrossRef]
- Andriola, Y.T.; Moreira, F.; Anastácio, E.; Camelo, F.A., Jr.; Silva, A.C.; Varela, A.S., Jr.; Gheller, S.M.M.; Goularte, K.L.; Corcini, C.D.; Lucia, T., Jr. Boar sperm quality after supplementation of diets with omega-3 polyunsaturated fatty acids extracted from microalgae. Andrologia 2018, 50, e12825. [Google Scholar] [CrossRef]
- Zamora-Zamora, V.; Figueroa-Velasco, J.L.; Cordero-Mora, J.L.; Nieto-Aquino, R.; García-Contreras, A.D.C.; Sánchez-Torres, M.T.; Carrillo-Domínguez, S.; Martínez-Aispuro, J.A. Conjugated linoleic acid supplementation does not improve boar semen quality and does not change its fatty acid profile. Vet. Mex. 2017, 4, 26–40. [Google Scholar] [CrossRef]
- Barranco, I.; Padilla, L.; Tvarijonaviciute, A.; Parrilla, I.; Martinez, E.A.; Rodriguez-Martinez, H.; Yeste, M.; Roca, J. Levels of activity of superoxide dismutase in seminal plasma do not predict fertility of pig AI-semen doses. Theriogenology 2019, 140, 18–24. [Google Scholar] [CrossRef]
- Ribas-Maynou, J.; Yeste, M. Oxidative stress in male infertility: Causes, effects in assisted reproductive techniques, and protective support of antioxidants. Biology 2020, 9, 77. [Google Scholar] [CrossRef] [PubMed]
- O’Flaherty, C.; Scarlata, E. Oxidative stress and reproductive function: The protection of mammalian spermatozoa against oxidative stress. Reproduction 2022, 164, F67–F78. [Google Scholar] [CrossRef] [PubMed]
- Lazzarino, G.; Listorti, I.; Bilotta, G.; Capozzolo, T.; Amorini, A.M.; Longo, S.; Caruso, G.; Lazzarino, G.; Tavazzi, B.; Bilotta, P. Water-and fat-soluble antioxidants in human seminal plasma and serum of fertile males. Antioxidants 2019, 8, 96. [Google Scholar] [CrossRef] [PubMed]
- Walke, G.; Gaurkar, S.S.; Prasad, R.; Lohakare, T.; Wanjari, M. The impact of oxidative stress on male reproductive function: Exploring the role of antioxidant supplementation. Cureus 2023, 15, e42583. [Google Scholar] [CrossRef]
- Donkin, I.; Barrès, R. Sperm epigenetics and influence of environmental factors. Mol. Metab. 2018, 14, 1–11. [Google Scholar] [CrossRef]
- Okada, Y.; Scott, G.; Ray, M.K.; Mishina, Y.; Zhang, Y. Histone demethylase JHDM2A is critical for Tnp1 and Prm1 transcription and spermatogenesis. Nature 2007, 450, 119–123. [Google Scholar] [CrossRef]
- McSwiggin, H.M.; O’doherty, A.M. Epigenetic reprogramming during spermatogenesis and male factor infertility. Reproduction 2018, 156, R9–R21. [Google Scholar] [CrossRef]
Primer | Sequence 5′–3′ | Reference |
---|---|---|
Prm1 | F: AGGAGGCGATGTTGTCCGAG R: ATTTCAGGCAGGAGTGCGGT | [37] |
Prm2 | F: AGTCCGAGTGAAAGTCCGCAG R: TGTGGCTCCTGTGTCTGTAGTGG | [34] |
Dnmt3a | F: GCTTGTGTGTAAGGGACGTGA R: GGAATTTCCGCCTGCGTTTTG | [34] |
Dnmt3b | F: AGGTCTCCAGCCTCCTAAGTT R: GTGTCTGAGCCATCTCCATCC | [34] |
Jhdm2a | F: GCTCACTGCTGTCGGGTCT R: AAGGTGACGTTGGCGATGC | [38] |
Kat8 | F: CCATCCTCCACTTTGTCCCC R: CCAATGGTTGCAGCTTTCCC | [34] |
IGF2 | F: GTGGCATCGTGGAAGAGTG R: CCAGGTGTCATAGCGGAAGAA | [34] |
GAPDH | F: ACTCACTCTTCTACCTTTGATGCT R: TGTTGCTGTAGCCAAATTCA | [33] |
CD45 | F: AGAATACTGGCCGTCGATGG R: GCTGAACGCATTCACTCTCCT | [33] |
c-Kit | F: GTTGATGACCTCGTGGAATGC R: CTGCTACTGCTGTCATTCCTAAGG | [33] |
E-cadherin | F: GAAGCACAGAATCCCCAAGTG R: GGCGTGTTTGTCTTCCATTTC | [33] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blagojević, J.; Stanimirović, Z.; Glavinić, U.; Vakanjac, S.; Radukić, Ž.; Mirilović, M.; Maletić, M. Impact of Supplemented Nutrition on Semen Quality, Epigenetic-Related Gene Expression, and Oxidative Status in Boars. Animals 2024, 14, 3297. https://doi.org/10.3390/ani14223297
Blagojević J, Stanimirović Z, Glavinić U, Vakanjac S, Radukić Ž, Mirilović M, Maletić M. Impact of Supplemented Nutrition on Semen Quality, Epigenetic-Related Gene Expression, and Oxidative Status in Boars. Animals. 2024; 14(22):3297. https://doi.org/10.3390/ani14223297
Chicago/Turabian StyleBlagojević, Jovan, Zoran Stanimirović, Uroš Glavinić, Slobodanka Vakanjac, Željko Radukić, Milorad Mirilović, and Milan Maletić. 2024. "Impact of Supplemented Nutrition on Semen Quality, Epigenetic-Related Gene Expression, and Oxidative Status in Boars" Animals 14, no. 22: 3297. https://doi.org/10.3390/ani14223297
APA StyleBlagojević, J., Stanimirović, Z., Glavinić, U., Vakanjac, S., Radukić, Ž., Mirilović, M., & Maletić, M. (2024). Impact of Supplemented Nutrition on Semen Quality, Epigenetic-Related Gene Expression, and Oxidative Status in Boars. Animals, 14(22), 3297. https://doi.org/10.3390/ani14223297