Genetic and Serological Survey of Sarcoptic Mange (Sarcoptes scabiei) in Wild Boars (Sus scrofa) in South Korea
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Microscopic Examination and Genetic Analysis
2.3. Serological and Statistical Analysis
3. Results
3.1. Identification and Phylogenetic Analysis of Sarcoptes scabiei
3.2. Seroprevalence and Influencing Factors of Sarcoptes scabiei in Wild Boars
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hengge, U.R.; Currie, B.J.; Jäger, G.; Lupi, O.; Schwartz, R.A. Scabies: A ubiquitous neglected skin disease. Lancet Infect. Dis. 2006, 6, 769–779. [Google Scholar] [CrossRef] [PubMed]
- Astorga, F.; Carver, S.; Almberg, E.S.; Sousa, G.R.; Wingfield, K.; Niedringhaus, K.D.; Van Wick, P.; Rossi, L.; Xie, Y.; Cross, P. In Proceedings of the International Meeting on Sarcoptic Mange in Wildlife, June 2018, Blacksburg, VA, USA. Parasites Vectors 2018, 11, 449. [Google Scholar] [CrossRef]
- Escobar, L.E.; Carver, S.; Cross, P.C.; Rossi, L.; Almberg, E.S.; Yabsley, M.J.; Niedringhaus, K.D.; Van Wick, P.; Dominguez-Villegas, E.; Gakuya, F. Sarcoptic mange: An emerging panzootic in wildlife. Transbound. Emerg. Dis. 2022, 69, 927–942. [Google Scholar] [CrossRef] [PubMed]
- Bornstein, S.; Mörner, T.; Samuel, W.M. Sarcoptes scabiei and sarcoptic mange. In Parasitic Diseases of Wild Mammals; Iowa State University Press: Ames, IA, USA, 2001; pp. 107–119. [Google Scholar]
- Soulsbury, C.D.; Iossa, G.; Baker, P.J.; Cole, N.C.; Funk, S.M.; Harris, S. The impact of sarcoptic mange Sarcoptes scabiei on the British fox Vulpes vulpes population. Mammal Rev. 2007, 37, 278–296. [Google Scholar] [CrossRef]
- Martin, A.M.; Fraser, T.A.; Lesku, J.A.; Simpson, K.; Roberts, G.L.; Garvey, J.; Polkinghorne, A.; Burridge, C.P.; Carver, S. The cascading pathogenic consequences of Sarcoptes scabiei infection that manifest in host disease. R. Soc. Open Sci. 2018, 5, 180018. [Google Scholar] [CrossRef] [PubMed]
- Pérez, J.M.; Granados, J.E.; Espinosa, J.; Ráez-Bravo, A.; López-Olvera, J.R.; Rossi, L.; Meneguz, P.G.; Angelone, S.; Fandos, P.; Soriguer, R.C. Biology and management of sarcoptic mange in wild Caprinae populations. Mammal Rev. 2021, 51, 82–94. [Google Scholar] [CrossRef]
- Pence, D.; Ueckermann, E. Sarcoptic manage in wildlife. Rev. Sci. Et Tech. (Int. Off. Epizoot.) 2002, 21, 385–398. [Google Scholar] [CrossRef]
- Valldeperes, M.; Moroni, B.; Rossi, L.; López-Olvera, J.R.; Velarde, R.; Molinar Min, A.R.; Mentaberre, G.; Serrano, E.; Angelone, S.; Lavín, S. First report of interspecific transmission of sarcoptic mange from Iberian ibex to wild boar. Parasites Vectors 2021, 14, 1–13. [Google Scholar] [CrossRef]
- Gakuya, F.; Rossi, L.; Ombui, J.; Maingi, N.; Muchemi, G.; Ogara, W.; Soriguer, R.C.; Alasaad, S. The curse of the prey: Sarcoptes mite molecular analysis reveals potential prey-to-predator parasitic infestation in wild animals from Masai Mara, Kenya. Parasites Vectors 2011, 4, 193. [Google Scholar] [CrossRef]
- Arlian, L.G.; Runyan, R.A.; Estes, S.A. Cross infestivity of Sarcoptes scabiei. J. Am. Acad. Dermatol. 1984, 10, 979–986. [Google Scholar] [CrossRef]
- Samuel, W. Attempted experimental transfer of sarcoptic mange (Sarcoptes scabiei, Acarina: Sarcoptidae) among red fox, coyote, wolf and dog. J. Wildl. Dis. 1981, 17, 343–347. [Google Scholar] [CrossRef] [PubMed]
- Haas, C.; Rossi, S.; Meier, R.; Ryser-Degiorgis, M.-P. Evaluation of a commercial ELISA for the detection of antibodies to Sarcoptes scabiei in wild boar (Sus scrofa). J. Wildl. Dis. 2015, 51, 729–733. [Google Scholar] [CrossRef]
- Viani, A.; Orusa, T.; Borgogno-Mondino, E.; Orusa, R. Snow metrics as proxy to assess sarcoptic mange in wild boar: Preliminary results in Aosta Valley (Italy). Life 2023, 13, 987. [Google Scholar] [CrossRef] [PubMed]
- Eo, K.-Y.; Kwon, O.-D.; Shin, N.-S.; Shin, T.; Kwak, D. Sarcoptic mange in wild raccoon dogs (Nyctereutes procyonoides) in Korea. J. Zoo Wildl. Med. 2008, 39, 671–673. [Google Scholar] [CrossRef]
- Park, D.S.; Choi, J.; Kim, H.-J.; Kim, J.-Y.; Kim, M.-H.; Lee, J.-Y.; Moon, J.C.; Park, H.-B.; Park, K.; Yun, J.H.; et al. Two Cases of Mange Mite (Sarcoptes scabiei) Infestation in Long-Tailed Goral (Naemorhedus caudatus) in Republic of Korea. Korean J. Parasitol. 2022, 60, 423–427. [Google Scholar] [CrossRef]
- Lee, A.; Lee, S.-J.; Chae, S.-h.; Bae, S.; Kim, H.-C.; Son, J.-i.; Yang, J.-J.; Lee, S.-H.; Kim, H.-J.; Jung, Y.-C.; et al. Distribution Patterns of the Haplotypes of Sarcoptes scabiei Related to Sarcoptic Mange in Wild Animals in South Korea. J. Anim. Breed. Genom. 2024, 8, 43–51. [Google Scholar] [CrossRef]
- Yoon, S.-S.; Byun, J.-W.; Yang, D.-K.; Shin, Y.-K.; Wee, S.-H.; Kim, B. Prevalence of canine scabies in the Korean stray dogs. Korean J. Vet. Res. 2010, 50, 165–169. [Google Scholar]
- Choe, S.; Kim, S.; Na, K.-J.; Nath, T.C.; Ndosi, B.A.; Kang, Y.; Bia, M.M.; Lee, D.; Park, H.; Eamudomkarn, C. First infestation case of sarcoptic mange from a pet rabbit Oryctolagus cuniculus in Republic of Korea. Korean J. Parasitol. 2020, 58, 315. [Google Scholar] [CrossRef]
- Jee, C.-H.; Lee, S.-s.; Chang, L.-h. Diagnosis of swine sarcoptic mange (Sarcoptes scabiei var. suis) by ELISA. Korean J. Vet. Res. 2001, 41, 565–570. [Google Scholar]
- Haas, C.; Origgi, F.; Akdesir, E.; Batista Linhares, M.; Giovannini, S.; Mavrot, F.; Casaubon, J.; Ryser-Degiorgis, M. First detection of sarcoptic mange in free-ranging wild boar (Sus scrofa) in Switzerland. Schweiz Arch Tierheilkd 2015, 157, 269–275. [Google Scholar] [CrossRef]
- Makouloutou, P.; Suzuki, K.; Yokoyama, M.; Takeuchi, M.; Yanagida, T.; Sato, H. Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild mammals in Japan. J. Wildl. Dis. 2015, 51, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Sannö, A.; Ander, M.; Ågren, E.; Troell, K. Sarcoptic mange in the wild boar, Sus scrofa, in Sweden. Curr. Res. Parasitol. Vector-Borne Dis. 2021, 1, 100060. [Google Scholar] [CrossRef] [PubMed]
- Massei, G.; Genov, P.V. The environmental impact of wild boar. Galemys 2004, 16, 135–145. [Google Scholar] [CrossRef]
- Lee, S.-M.; Lee, E.-J. Diet of the wild boar (Sus scrofa): Implications for management in forest-agricultural and urban environments in South Korea. PeerJ 2019, 7, e7835. [Google Scholar] [CrossRef]
- Jo, Y.S.; Baccus, J.T.; Koprowski, J.L. Mammals of Korea; National Institute of Biological Resources: Incheon, Republic of Korea, 2018. [Google Scholar]
- Lee, S.-M. Reproductive performance and sex ratio adjustment of the wild boar (Sus scrofa) in South Korea. Sci. Rep. 2022, 12, 21774. [Google Scholar] [CrossRef]
- Haas, C.; Origgi, F.C.; Rossi, S.; López-Olvera, J.R.; Rossi, L.; Castillo-Contreras, R.; Malmsten, A.; Dalin, A.-M.; Orusa, R.; Robetto, S. Serological survey in wild boar (Sus scrofa) in Switzerland and other European countries: Sarcoptes scabiei may be more widely distributed than previously thought. BMC Vet. Res. 2018, 14, 117. [Google Scholar] [CrossRef]
- Sievers, F.; Higgins, D.G. Clustal Omega, accurate alignment of very large numbers of sequences. Mult. Seq. Alignment Methods 2014, 1079, 105–116. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Clopper, C.J.; Pearson, E.S. The use of confidence or fiducial limits illustrated in the case of the binomial. Biometrika 1934, 26, 404–413. [Google Scholar] [CrossRef]
- Amer, S.; Wahab, T.A.E.; Metwaly, A.E.N.; Ye, J.; Roellig, D.; Feng, Y.; Xiao, L. Preliminary molecular characterizations of Sarcoptes scaibiei (Acari: Sarcoptidae) from farm animals in Egypt. PLoS ONE 2014, 9, e94705. [Google Scholar] [CrossRef]
- Walton, S.F.; Dougall, A.; Pizzutto, S.; Holt, D.; Taplin, D.; Arlian, L.; Morgan, M.; Currie, B.J.; Kemp, D.J. Genetic epidemiology of Sarcoptes scabiei (Acari: Sarcoptidae) in northern Australia. Int. J. Parasitol. 2004, 34, 839–849. [Google Scholar] [CrossRef]
- Fraser, T.A.; Holme, R.; Martin, A.; Whiteley, P.; Montarello, M.; Raw, C.; Carver, S.; Polkinghorne, A. Expanded molecular typing of Sarcoptes scabiei provides further evidence of disease spillover events in the epidemiology of sarcoptic mange in Australian marsupials. J. Wildl. Dis. 2019, 55, 231–237. [Google Scholar] [CrossRef] [PubMed]
- Villa, L.; Allievi, C.; Gazzonis, A.L.; Ventura, G.; Gradassi, M.; Zanzani, S.A.; Manfredi, M.T. Serological Prevalence of Toxoplasma gondii, Neospora caninum, and Sarcoptes scabiei var. suis in Wild Boars (Sus scrofa) Hunted in a Highly Anthropized Area in Italy. Animals 2023, 13, 1730. [Google Scholar] [CrossRef]
- Arlian, L.G.; Morgan, M.S. A review of Sarcoptes scabiei: Past, present and future. Parasites Vectors 2017, 10, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Pérez, J.M.; Ruiz-Martínez, I.; Granados, J.E.; Soriguer, R.C.; Fandos, P. The dynamics of sarcoptic mange in the ibex population of Sierra Nevada in Spain–influence of climatic factors. J. Wildl. Res. 1997, 2, 86–89. [Google Scholar]
- Kotb, S.; Abdel-Rady, A. Sarcoptic mange of camel in upper Egypt: Prevalence, risk assessment, and control measures. J. Adv. Vet. Anim. Res. 2015, 2, 410–417. [Google Scholar] [CrossRef]
- Carricondo-Sanchez, D.; Odden, M.; Linnell, J.D.; Odden, J. The range of the mange: Spatiotemporal patterns of sarcoptic mange in red foxes (Vulpes vulpes) as revealed by camera trapping. PLoS ONE 2017, 12, e0176200. [Google Scholar] [CrossRef]
- Kraabøl, M.; Gundersen, V.; Fangel, K.; Olstad, K. The taxonomy, life cycle and pathology of Sarcoptes scabiei and Notoedres cati (Acarina, Sarcoptidae): A review in a Fennoscandian wildlife perspective. Fauna Nor. 2015, 35, 21–33. [Google Scholar] [CrossRef]
- Hwang, J.; Lee, K.; Kim, Y.-J.; Sleeman, J.M.; Lee, H. Retrospective analysis of the epidemiologic literature, 1990–2015, on wildlife-associated diseases from the Republic of Korea. J. Wildl. Dis. 2017, 53, 5–18. [Google Scholar] [CrossRef] [PubMed]
- Jeong, D.H.; Yang, D.H.; Lee, B.K.; Gurye, H.R.M.M. Re-introduction of the Asiatic black bear into Jirisan National Park, South Korea. In Global Re-Introduction Perspectives: Additional Case-Studies from Around the Globe; IUCN: Gland, Switzerland, 2010; pp. 254–258. [Google Scholar]
- Tomoko, A.; Hiroyuki, S.; Hiroyuki, N.; Yukiko, A.; Katsuyuki, T.; Akihiro, H. Mixed infestation of Sarcoptic mange and Demodex sp. on an Asian black bear (Ursus thibetanus) in Gunma Prefecture. Bull. Gunma Mus. Nat. Hist. 2011, 15, 171–173. [Google Scholar]
ID No. | Type | Species | Region |
---|---|---|---|
GS01RD | Carcass | Raccoon dog | Goesan, CB |
CS01WB | Captured | Wild boar | Cheongsong, GB |
CS02WB | Captured | Wild boar | Cheongsong, GB |
CS03WB | Captured | Wild boar | Cheongsong, GB |
CS04WB | Captured | Wild boar | Cheongsong, GB |
CS05WB | Captured | Wild boar | Cheongsong, GB |
CS06WB | Captured | Wild boar | Cheongsong, GB |
CS07WB | Captured | Wild boar | Cheongsong, GB |
MG01WB | Carcass | Wild boar | Mungyeong, GB |
YW01WB | Carcass | Wild boar | Yeongwol, GW |
Region | GG | GW | CN | CB | JB | JN | GB | GN | Total |
---|---|---|---|---|---|---|---|---|---|
N. of Samples | 72 | 44 | 99 | 84 | 48 | 69 | 79 | 163 | 658 |
Target Gene | Sequence (5′ → 3′) | PCR Condition | |
---|---|---|---|
cox-1 (518 bp) | F | TGATTTTTTGGACACCCGGAAGT | 95 °C for 15 min; 35 cycles of 95 °C for 20 s, 55 °C for 30 s, 72 °C for 30 s; 72 °C for 5 min |
R | GAAGGTTTTAAAAAATAACCTGTAAACATTATGTATCAAAAAGAAAAACC |
Region | Pos/N | Prev in % | 95% CI |
---|---|---|---|
GG | 1/72 | 1.39 | 0.04–7.5 |
GW | 3/44 | 6.82 | 1.43–18.66 |
CN | 3/99 | 3.03 | 0.63–8.60 |
CB | 3/84 | 3.57 | 0.74–10.08 |
JB | 2/48 | 4.17 | 0.51–14.25 |
JN | 3/69 | 4.35 | 0.91–12.18 |
GB | 5/79 | 6.33 | 2.09–14.16 |
GN | 16/163 | 9.82 | 5.72–15.45 |
Total | 36/658 | 5.47 | 3.86–7.49 |
Variable | Group | Pos/N | Prev in % | 95% CI |
---|---|---|---|---|
Sex | Male | 19/356 | 5.34 | 3.24–8.21 |
Female | 17/302 | 5.63 | 3.31–8.86 | |
Age | Juvenile | 6/143 | 4.20 | 1.56–8.91 |
Subadult | 7/157 | 4.46 | 1.81–8.97 | |
Adult | 23/358 | 6.42 | 4.12–9.48 | |
Hunting Season | Spring | 16/95 | 16.84 | 9.94–25.9 |
Summer | 4/121 | 3.31 | 0.91–8.25 | |
Fall | 10/253 | 3.95 | 1.91–7.15 | |
Winter | 6/189 | 3.17 | 1.17–6.78 | |
Total | 36/658 | 5.47 | 3.86–7.49 |
Variable | Estimate | p-Value | Odds Ratio (95% Confidence Interval) |
---|---|---|---|
Intercept | −3.42 | <0.001 | - |
Season (Spring) | 1.82 | <0.001 | 6.18 (2.44–17.75) |
Season (Summer) | 0.04 | 0.949 | 1.04 (0.26–3.73) |
Season (Fall) | 0.23 | 0.665 | 1.26 (0.46–3.75) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.; Kim, G.; Kim, S.-J.; Jheong, W.-H.; Jeong, D.-H. Genetic and Serological Survey of Sarcoptic Mange (Sarcoptes scabiei) in Wild Boars (Sus scrofa) in South Korea. Animals 2024, 14, 3490. https://doi.org/10.3390/ani14233490
Lee S, Kim G, Kim S-J, Jheong W-H, Jeong D-H. Genetic and Serological Survey of Sarcoptic Mange (Sarcoptes scabiei) in Wild Boars (Sus scrofa) in South Korea. Animals. 2024; 14(23):3490. https://doi.org/10.3390/ani14233490
Chicago/Turabian StyleLee, Sanghyun, Garam Kim, So-Jeong Kim, Weon-Hwa Jheong, and Dong-Hyuk Jeong. 2024. "Genetic and Serological Survey of Sarcoptic Mange (Sarcoptes scabiei) in Wild Boars (Sus scrofa) in South Korea" Animals 14, no. 23: 3490. https://doi.org/10.3390/ani14233490
APA StyleLee, S., Kim, G., Kim, S.-J., Jheong, W.-H., & Jeong, D.-H. (2024). Genetic and Serological Survey of Sarcoptic Mange (Sarcoptes scabiei) in Wild Boars (Sus scrofa) in South Korea. Animals, 14(23), 3490. https://doi.org/10.3390/ani14233490