Letrozole and Crocin: Protecting Leydig Cells and Modulating Androgen Receptor and CYP19 Gene Expression in Busulfan-Induced Azoospermia
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Preparation
2.2. Crocin Preparation
2.3. Experimental Design
2.4. Hematoxylin–Eosin and Masson’s Trichrome Staining
2.5. Sperm Functional Parameter Assessment
2.6. Immunohistochemistry (IHC) Analysis
2.7. Measurement of Testosterone Levels
2.8. Gene Expression Assessment Using Real-Time Quantitative PCR (qPCR)
2.9. Statistical Analysis
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eisenberg, M.L.; Esteves, S.C.; Lamb, D.J.; Hotaling, J.M.; Giwercman, A.; Hwang, K.; Cheng, Y.S. Male infertility. Nat. Rev. Dis. Primers 2023, 9, 49. [Google Scholar] [CrossRef]
- Wu, X.; Lin, D.; Sun, F.; Cheng, C.Y. Male infertility in humans: An update on non-obstructive azoospermia (NOA) and obstructive azoospermia (OA). In Molecular Mechanisms in Spermatogenesis; Springer: Berlin/Heidelberg, Germany, 2021; pp. 161–173. [Google Scholar]
- Sharma, M.; Leslie, S.W. Azoospermia. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2025. [Google Scholar] [PubMed]
- Fontana, L.; Sirchia, S.M.; Pesenti, C.; Colpi, G.M.; Miozzo, M.R. Non-invasive biomarkers for sperm retrieval in non-obstructive patients: A comprehensive review. Front. Endocrinol. 2024, 15, 1349000. [Google Scholar] [CrossRef] [PubMed]
- Esteves, S.C. Clinical management of infertile men with nonobstructive azoospermia. Asian J. Androl. 2015, 17, 459–470. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Poorvu, P.D.; Frazier, A.L.; Feraco, A.M.; Manley, P.E.; Ginsburg, E.S.; Laufer, M.R.; LaCasce, A.S.; Diller, L.R.; Partridge, A.H. Cancer treatment-related infertility: A critical review of the evidence. JNCI Cancer Spectrum 2019, 3, pkz008. [Google Scholar] [CrossRef] [PubMed]
- Zohni, K.; Zhang, X.; Tan, S.L.; Chan, P.; Nagano, M.C. The efficiency of male fertility restoration is dependent on the recovery kinetics of spermatogonial stem cells after cytotoxic treatment with busulfan in mice. Hum. Reprod. 2012, 27, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Kerbauy, M.N.; Mariano, L.; Seber, A.; Rocha, V. The impact of low dose busulfan on gonadal function after allogeneic hematopoietic stem cell transplantation for aplastic anemia. Bone Marrow Transplant. 2020, 55, 1169–1171. [Google Scholar] [CrossRef] [PubMed]
- Mobarak, H.; Rahbarghazi, R.; Nouri, M.; Heidarpour, M.; Mahdipour, M. Intratesticular versus intraperitoneal injection of Busulfan for the induction of azoospermia in a rat model. BMC Pharmacol. Toxicol. 2022, 23, 50. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Ganjalikhan Hakemi, S.; Sharififar, F.; Haghpanah, T.; Babaee, A.; Eftekhar-Vaghefi, S.H. The Effects of Olive Leaf Extract on The Testis, Sperm Quality and Testicular Germ Cell Apoptosis in Male Rats Exposed to Busulfan. Int. J. Fertil. Steril. 2019, 13, 57–65. [Google Scholar] [CrossRef]
- Gauthier-Fisher, A.; Kauffman, A.; Librach, C.L. Potential use of stem cells for fertility preservation. Andrology 2020, 8, 862–878. [Google Scholar] [CrossRef] [PubMed]
- Kaymak, E.; Yıldırım, A.B. Aromatase, estrogen, and male reproduction: A review. Exp. Appl. Med. Sci. 2020, 1, 100–108. [Google Scholar] [CrossRef]
- Varimo, T.; Huopio, H.; Kariola, L.; Tenhola, S.; Voutilainen, R.; Toppari, J.; Toiviainen-Salo, S.; Hämäläinen, E.; Pulkkinen, M.A.; Lääperi, M.; et al. Letrozole versus testosterone for promotion of endogenous puberty in boys with constitutional delay of growth and puberty: A randomized controlled phase 3 trial. Lancet Child. Adolesc. Health 2019, 3, 109–120. [Google Scholar] [CrossRef] [PubMed]
- Ganjiani, V.; Ahmadi, N.; Divar, M.R.; Sharifiyazdi, H.; Meimandi-Parizi, A. Protective effects of crocin on testicular torsion/detorsion in rats. Theriogenology 2021, 173, 241–248. [Google Scholar] [CrossRef]
- Sarfarazi, M.; Rajabzadeh, Q.; Tavakoli, R.; Ibrahim, S.A.; Jafari, S.M. Ultrasound-assisted extraction of saffron bioactive compounds; separation of crocins, picrocrocin, and safranal optimized by artificial bee colony. Ultrason. Sonochem. 2022, 86, 105971. [Google Scholar] [CrossRef] [PubMed]
- Li, H.T.; Zhong, K.; Xia, Y.F.; Song, J.; Chen, X.Q.; Zhao, W.; Zeng, X.H.; Chen, T.X. Puerarin improves busulfan-induced disruption of spermatogenesis by inhibiting MAPK pathways. Biomed. Pharmacother. 2023, 165, 115231. [Google Scholar] [CrossRef] [PubMed]
- Babakhanzadeh, E.; Nazari, M.; Ghasemifar, S.; Khodadadian, A. Some of the factors involved in male infertility: A prospective review. Int. J. Gen. Med. 2020, 13, 29–41. [Google Scholar] [CrossRef]
- Kooshesh, L.; Bahmanpour, S.; Zeighami, S.; Nasr-Esfahani, M.H. Effect of Letrozole on sperm parameters, chromatin status, and ROS level in idiopathic oligo/astheno/teratozoospermia. Reprod. Biol. Endocrinol. 2020, 18, 47. [Google Scholar] [CrossRef]
- Cerdá-Bernad, D.; Valero-Cases, E.; Pastor, J.J.; Frutos, M.J. Saffron bioactives crocin, crocetin, and safranal: Effect on oxidative stress and mechanisms of action. Crit. Rev. Food Sci. Nutr. 2022, 62, 3232–3249. [Google Scholar] [CrossRef] [PubMed]
- Fejér, J.; Gruľová, D.; Eliašová, A.; Kron, I. Seasonal variability of Juniperus communis L. berry ethanol extracts: 2. In vitro ferric reducing ability of plasma (FRAP) assay. Molecules 2022, 27, 9027. [Google Scholar] [CrossRef]
- Margaritis, I.; Angelopoulou, K.; Lavrentiadou, S.; Mavrovouniotis, I.C.; Tsantarliotou, M.; Taitzoglou, I.; Theodoridis, A.; Veskoukis, A.; Kerasioti, E.; Kouretas, D.; et al. Effect of crocin on antioxidant gene expression, fibrinolytic parameters, redox status, and blood biochemistry in nicotinamide-streptozotocin-induced diabetic rats. J. Biol. Res. 2020, 27, 4. [Google Scholar] [CrossRef] [PubMed]
- Movahedin, M.; Mowla, S.J.; Beiranvand, S.P. Assessment of morphological and functional changes in the mouse testis and epididymal sperms. Iranian Biomed. J. 2007, 11, 15–22. [Google Scholar]
- Kim, Y.M.; Park, K.J.; Park, J.S.; Jung, K.M.; Han, J.Y. In vivo enrichment of busulfan-resistant germ cells for efficient production of transgenic avian models. Sci. Rep. 2021, 11, 9127. [Google Scholar] [CrossRef]
- Bakalska, M.; Atanassova, N.; Koeva, Y.; Nikolov, B.; Davidoff, M. Induction of male germ cell apoptosis by testosterone withdrawal after ethane dimethanesulfonate treatment in adult rats. Endocr. Regul. 2004, 38, 103–110. [Google Scholar] [PubMed]
- Peivandi, S.; Jafarpour, H.; Abbaspour, M.; Ebadi, A. Effect of letrozole on spermogram parameters and hormonal profile in infertile men: A clinical trial study. Endocr. Regul. 2019, 53, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Kaltsas, A.; Dimitriadis, F.; Chrisofos, M.; Sofikitis, N.; Zachariou, A. Predictive value of varicocele grade and histopathology in simultaneous varicocelectomy and sperm retrieval in non-obstructive azoospermia: A retrospective cohort study. Medicina 2024, 60, 2056. [Google Scholar] [CrossRef]
- Gregoriou, O.; Bakas, P.; Grigoriadis, C.; Creatsa, M.; Hassiakos, D.; Creatsas, G. Changes in hormonal profile and seminal parameters with the use of aromatase inhibitors in management of infertile men with low testosterone to estradiol ratios. Fertil. Steril. 2012, 98, 48–51. [Google Scholar] [CrossRef]
- Shokri, A.; Baharara, J.; Amini, E. Evaluation of the antioxidant effect of crocin on neonate Balb/c mouse spermatogonial stem cells. Cell Tissue J. 2016, 7, 219–229. [Google Scholar]
- Salahshoor, M.R.; Khazaei, M.; Jalili, C.; Keivan, M. Crocin improves damage induced by nicotine on a number of reproductive parameters in male mice. Int. J. Fertil. Steril. 2016, 10, 71–78. [Google Scholar] [CrossRef]
- Mehdipour, M.; Daghigh Kia, H.; Najafi, A.; Mohammadi, H.; Álvarez-Rodriguez, M. Effect of crocin and naringenin supplementation in cryopreservation medium on post-thaw rooster sperm quality and expression of apoptosis-associated genes. PLoS ONE 2020, 15, e0241105. [Google Scholar] [CrossRef] [PubMed]
- Ávila, C.; Vinay, J.I.; Arese, M.; Saso, L.; Rodrigo, R. Antioxidant intervention against male infertility: Time to design novel strategies. Biomedicines 2022, 10, 3058. [Google Scholar] [CrossRef]
- Kohn, T.P.; Louis, M.R.; Pickett, S.M.; Lindgren, M.C.; Kohn, J.R.; Pastuszak, A.W.; Lipshultz, L.I. Age and duration of testosterone therapy predict time to return of sperm count after human chorionic gonadotropin therapy. Fertil. Steril. 2017, 107, 351–357.e1. [Google Scholar] [CrossRef] [PubMed]
- Jin, W.; Zhang, Y.; Xue, Y.; Han, X.; Zhang, X.; Ma, Z.; Sun, S.; Chu, X.; Cheng, J.; Guan, S.; et al. Crocin attenuates isoprenaline-induced myocardial fibrosis by targeting TLR4/NF-κB signaling: Connecting oxidative stress, inflammation, and apoptosis. Naunyn Schmiedebergs Arch. Pharmacol. 2020, 393, 13–23. [Google Scholar] [CrossRef] [PubMed]
- Peng, Q.; Yan, Y.; Yan, H.; Xie, G.; Shi, L.; Wen, Y.; Chang, Q. Association between CYP19A1 rs6493497 and rs936306 polymorphisms and depression susceptibility in the Chinese population. Biomarkers Med. 2022, 16, 1171–1179. [Google Scholar] [CrossRef] [PubMed]
- Crespo, D.; Assis, L.H.; Furmanek, T.; Bogerd, J.; Schulz, R.W. Expression profiling identifies Sertoli and Leydig cell genes as FSH targets in adult zebrafish testis. Mol. Cell Endocrinol. 2016, 437, 237–251. [Google Scholar] [CrossRef] [PubMed]
- Akingbemi, B.T. Estrogen regulation of testicular function. Reprod. Biol. Endocrinol. 2005, 3, 51. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Grande, G.; Barrachina, F.; Soler-Ventura, A.; Jodar, M.; Mancini, F.; Marana, R.; Chiloiro, S.; Pontecorvi, A.; Oliva, R.; Milardi, D. The role of testosterone in spermatogenesis: Lessons from proteome profiling of human spermatozoa in testosterone deficiency. Front. Endocrinol. 2022, 13, 852661. [Google Scholar] [CrossRef] [PubMed]
- Corradi, P.F.; Corradi, R.B.; Greene, L.W. Physiology of the hypothalamic pituitary gonadal axis in the male. Urol. Clin. N. Am. 2016, 43, 151–162. [Google Scholar] [CrossRef] [PubMed]
- Ye, R.J.; Yang, J.M.; Hai, D.M.; Liu, N.; Ma, L.; Lan, X.B.; Niu, J.G.; Zheng, P.; Yu, J.Q. Interplay between male reproductive system dysfunction and the therapeutic effect of flavonoids. Fitoterapia 2020, 147, 104756. [Google Scholar] [CrossRef] [PubMed]
Genes | Sequence | 3′-5′ |
---|---|---|
r-GAPDH | F | AGGTCGGTGTGAACGGATTTG |
R | TGTAGACCATGTAGTTGAGGTCA | |
r-Androgen receptor | F | GAGGGCATCAGAGGGGAAAAG |
R | TCACCGAAGAGGAAAGGGC | |
r-CYP19A | F | GTCCATTCCAGCACCCTTACA |
R | CATGGGGTTCAGCATTTCCAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nokhbeh Zaeem, S.; Heydari Nasrabadi, M.; Salehipour, M.; Ehtesham, S. Letrozole and Crocin: Protecting Leydig Cells and Modulating Androgen Receptor and CYP19 Gene Expression in Busulfan-Induced Azoospermia. Animals 2025, 15, 697. https://doi.org/10.3390/ani15050697
Nokhbeh Zaeem S, Heydari Nasrabadi M, Salehipour M, Ehtesham S. Letrozole and Crocin: Protecting Leydig Cells and Modulating Androgen Receptor and CYP19 Gene Expression in Busulfan-Induced Azoospermia. Animals. 2025; 15(5):697. https://doi.org/10.3390/ani15050697
Chicago/Turabian StyleNokhbeh Zaeem, Shahrzad, Mitra Heydari Nasrabadi, Masoud Salehipour, and Somayeh Ehtesham. 2025. "Letrozole and Crocin: Protecting Leydig Cells and Modulating Androgen Receptor and CYP19 Gene Expression in Busulfan-Induced Azoospermia" Animals 15, no. 5: 697. https://doi.org/10.3390/ani15050697
APA StyleNokhbeh Zaeem, S., Heydari Nasrabadi, M., Salehipour, M., & Ehtesham, S. (2025). Letrozole and Crocin: Protecting Leydig Cells and Modulating Androgen Receptor and CYP19 Gene Expression in Busulfan-Induced Azoospermia. Animals, 15(5), 697. https://doi.org/10.3390/ani15050697