The Distribution Characteristics of a 19-bp Indel of the PLAG1 Gene in Chinese Cattle
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Data Collection
2.2. Primer Design and PCR Amplification
3. Results
3.1. PCR Amplification and Polyacrylamide Gel Electrophoresis
3.2. Regional Difference of Allele Frequency
3.3. Verification of Population Genetic Effects of PLAG1 Gene in Yunling Cattle
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Wood, R.W. On a remarkable case of uneven distribution of light in a diffraction grating spectrum. Lond. Edinb. Dublin Philos. Mag. J. Sci. 1902, 4, 396–402. [Google Scholar] [CrossRef] [Green Version]
- Hou, J.; Qu, K.; Jia, P.; Hanif, Q.; Zhang, J.; Chen, N.; Dang, R.; Chen, H.; Huang, B.; Lei, C. A SNP in PLAG1 is associated with body height trait in Chinese cattle. Anim. Genet. 2019. [Google Scholar] [CrossRef] [PubMed]
- Van Dyck, F.; Declercq, J.; Braem, C.V.; Van de Ven, W.J. PLAG1, the prototype of the PLAG gene family: Versatility in tumour development (review). Int. J. Oncol. 2007, 30, 765–774. [Google Scholar] [CrossRef] [Green Version]
- Smith, E.A.; Erickson, M.G.; Ulijasz, A.T.; Weisblum, B.; Corn, R.M. Surface plasmon resonance imaging of transcription factor proteins: Interactions of bacterial response regulators with DNA arrays on gold films. J. Langmuir. 2003, 19, 1486–1492. [Google Scholar] [CrossRef]
- Gudbjartsson, D.F.; Walters, G.B.; Thorleifsson, G.; Stefansson, H.; Halldorsson, B.V.; Zusmanovich, P.; Sulem, P.; Thorlacius, S.; Gylfason, A.; Steinberg, S.; et al. Many sequence variants affecting diversity of adult human height. Nat. Genet. 2008, 40, 609–615. [Google Scholar] [CrossRef]
- Fink, T.; Tiplady, K.; Lopdell, T.; Johnson, T.; Snell, R.G.; Spelman, R.J.; Davis, S.R.; Littlejohn, M.D. Functional confirmation of PLAG1 as the candidate causative gene underlying major pleiotropic effects on body weight and milk characteristics. Sci. Rep. 2017, 7, 44793. [Google Scholar] [CrossRef] [Green Version]
- Yanase, Y.; Hiragun, T.; Kaneko, S.; Gould, H.J.; Greaves, M.W.; Hide, M. Detection of refractive index changes in individual living cells by means of surface plasmon resonance imaging. Biosens. Bioelectron. 2010, 26, 674–681. [Google Scholar] [CrossRef]
- Guo, Y.; Hou, L.; Zhang, X.; Huang, M.; Mao, H.; Chen, H.; Ma, J.; Chen, C.; Ai, H.; Ren, J.; et al. A meta analysis of genome-wide association studies for limb bone lengths in four pig populations. BMC Genet. 2015, 16, 95. [Google Scholar] [CrossRef] [Green Version]
- Juma, A.R.; Damdimopoulou, P.E.; Grommen, S.V.; Van de Ven, W.J.; De Groef, B. Emerging role of PLAG1 as a regulator of growth and reproduction. J. Endocrinol. 2016, 228, R45–R56. [Google Scholar] [CrossRef]
- Xu, W.; He, H.; Zheng, L.; Xu, J.W.; Lei, C.Z.; Zhang, G.M.; Dang, R.H.; Niu, H.; Qi, X.L.; Chen, H.; et al. Detection of 19-bp deletion within PLAG1 gene and its effect on growth traits in cattle. Gene 2018, 675, 144–149. [Google Scholar] [CrossRef]
- Wang, J.Y.; Yu, Y.; Feng, L.X.; Wang, H.Z.; Zhang, Q. Genomic DNA extraction from hair sacs of pigs using modified phenol-chloroform method. Yi Chuan 2010, 32, 752–756. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Y.; Yu, Y.; Feng, L.X.; Wang, H.Z.; Zhang, Q. Linear body measurements of cattle before and after 20 years of selection for postweaning gain when fed two different diets. J. Anim. Sci. 1993, 71, 1712–1720. [Google Scholar]
- Weber, K.; Osborn, M. The reliability of molecular weight determinations by dodecyl sulfate-polyacrylamide gel electrophoresis. J. Biol. Chem. 1969, 244, 4406–4412. [Google Scholar] [PubMed]
- Robinson, J.D.; Coffman, A.J.; Hickerson, M.J.; Gutenkunst, R.N. Sampling strategies for frequency spectrum-based population genomic inference. BMC Evol. Biol. 2014, 14, 254. [Google Scholar]
- Zeng, Y.; Hu, R.; Wang, L.; Gu, D.; He, J.; Wu, S.-Y.; Ho, H.-P.; Li, X.; Qu, J.; Gao, B.Z. Recent advances in surface plasmon resonance imaging: Detection speed, sensitivity, and portability. Nanophotonics 2017, 6, 1017–1030. [Google Scholar] [CrossRef]
- Yeh, F.C.; Yang, R.; Boyle, T. POPGENE VERSION 1.31—Microsoft Window-Based Freeware for Population Genetic Analysis Quick User Guide; Centre for International Forestry Research: Bogor, Indonesia, 1999; pp. 12–25. [Google Scholar]
- China National Commission of Animal Genetic Resources. Animal genetic resources in China-Bovines; China National Commission of Animal Genetic Resources: Beijing, China, 2011; pp. 17–227. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Pennacchio, L.A.; Bickmore, W.; Dean, A.; Nobrega, M.A.; Bejerano, G. Enhancers: Five essential questions. Nat. Rev. Genet. 2013, 14, 288–295. [Google Scholar] [CrossRef]
- Barrett, L.W.; Fletcher, S.; Wilton, S.D. Regulation of eukaryotic gene expression by the untranslated gene regions and other non-coding elements. Cell. Mol. Life Sci. 2012, 69, 3613–3634. [Google Scholar] [CrossRef] [Green Version]
- Cheong, H.S.; Park, C.S.; Kim, L.H.; Park, B.L.; Uh, S.T.; Kim, Y.H.; Lym, G.I.; Lee, J.Y.; Lee, J.K.; Kim, H.T.; et al. CXCR3 polymorphisms associated with risk of asthma. Biochem. Biophys. Res. Commun. 2005, 334, 1219–1225. [Google Scholar] [CrossRef]
- Zhou, C.; Jin, W.; Zhang, Y.; Yang, M.; Xiang, L.; Wu, Z.; Jin, Q.; Mu, Y. An angle-scanning surface plasmon resonance imaging device for detection of mismatched bases in caspase-3 DNA. Anal. Methods 2013, 5, 2369–2373. [Google Scholar] [CrossRef]
- Jordan, C.E.; Frutos, A.G.; Thiel, A.J.; Corn, R.M. Surface plasmon resonance imaging measurements of DNA hybridization adsorption and streptavidin/DNA multilayer formation at chemically modified gold surfaces. Anal. Chem. 1997, 69, 4939–4947. [Google Scholar] [CrossRef]
- Wang, Y.F.; Lang, Y.M.; Huang, B.Z.; Feng, Y.H.; Li, H.P.; Zhang, S.S.; Xie, P.; Sun, B.Z. The Quality Evaluation of Different Anatomical Locations of Yunling Cattle. China Anim. Husb. Vet. Med. 2017, 44, 708–716. [Google Scholar]
Primer Sequences (5′–3′) | Primer Size (bp) | Product Length (bp) | Tm (°C) |
---|---|---|---|
F: AAAAGAGTCCGCGTTTACTGC | 21 | 366/347 | 57 |
R: CGATGAACTCTCCACCTGCG | 20 |
Breed | Genotype | Samples | Genotype Frequencies | Allelic Frequencies | HWE | |||||
---|---|---|---|---|---|---|---|---|---|---|
WW | WD | DD | N | p-WW | p-WD | p-DD | p-W | p-D | p-Value | |
YL | 154 | 223 | 74 | 451 | 0.34 | 0.5 | 0.16 | 0.59 | 0.41 | 0.65 |
Breed | Ne | PIC | He |
---|---|---|---|
YL | 1.94 | 0.37 | 0.48 |
Growth Traits | Genotype (Mean ± SE) | p-Value | ||
---|---|---|---|---|
WW | WD | DD | ||
Body height (cm) | 129.17 ± 5.86 b | 130.41 ± 5.49 a | 128.95 ± 4.91 b | 0.041 * |
Hip cross height (cm) | 131.65 ± 15.06 b | 134.26 ± 5.65 a | 132.61 ± 5.31 ab | 0.039 * |
Body length (cm) | 155.92 ± 15.70 | 154.39 ± 13.78 | 153.96 ± 8.93 | 0.482 |
Heart girth (cm) | 196.58 ± 12.65 ab | 197.91 ± 10.99 a | 193.95 ± 11.42 b | 0.039 * |
Chest width (cm) | 49.24 ± 5.48 | 49.27 ± 4.95 | 48.89 ± 5.00 | 0.855 |
Rump length (cm) | 50.51 ± 3.24 | 50.36 ± 3.79 | 49.65 ± 3.66 | 0.224 |
Chest depth (cm) | 68.95 ± 6.06 | 68.73 ± 5.94 | 67.85 ± 5.24 | 0.408 |
Hip width (cm) | 57.80 ± 5.79 | 57.96 ± 5.78 | 56.73 ± 6.33 | 0.288 |
Hucklebone width (cm) | 22.47 ± 2.30 | 22.29 ± 2.49 | 22.19 ± 1.95 | 0.631 |
Hip circumference (cm) | 113.37 ± 12.25 | 112.66 ± 8.83 | 112.73 ± 8.34 | 0.787 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Z.; Huang, B.; Lai, Z.; Li, S.; Wu, F.; Qu, K.; Jia, Y.; Hou, J.; Liu, J.; Lei, C.; et al. The Distribution Characteristics of a 19-bp Indel of the PLAG1 Gene in Chinese Cattle. Animals 2019, 9, 1082. https://doi.org/10.3390/ani9121082
Zhou Z, Huang B, Lai Z, Li S, Wu F, Qu K, Jia Y, Hou J, Liu J, Lei C, et al. The Distribution Characteristics of a 19-bp Indel of the PLAG1 Gene in Chinese Cattle. Animals. 2019; 9(12):1082. https://doi.org/10.3390/ani9121082
Chicago/Turabian StyleZhou, Zihui, Bizhi Huang, Zhenyu Lai, Shipeng Li, Fei Wu, Kaixing Qu, Yutang Jia, Jiawen Hou, Jianyong Liu, Chuzhao Lei, and et al. 2019. "The Distribution Characteristics of a 19-bp Indel of the PLAG1 Gene in Chinese Cattle" Animals 9, no. 12: 1082. https://doi.org/10.3390/ani9121082