Autophagy and Apoptosis of Porcine Ovarian Granulosa Cells During Follicular Development
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Granulosa Cell Isolation and Culture
2.3. Assessment of Cell Proliferation
2.4. RNA Extraction and qRT-PCR
2.5. Western Blotting
2.6. Assessment of Cell Apoptosis
2.7. Labeling of Autophagy and Apoptosis
2.8. Statistical Analysis
3. Results
3.1. Proliferation and Apoptosis of GCs in Follicles
3.2. Relative mRNA Level in GCs of Different Size Follicles
3.3. Protein Expression of Autophagy and Apoptosis in GCs
3.4. Labeling of Autophagosomes and the Nucleus in GCs
3.5. Activation of Autophagy and Apoptosis Signaling in GCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular Growth and Atresia in Mammalian Ovaries: Regulation by Survival and Death of Granulosa Cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef]
- Krysko, D.V.; Diez-Fraile, A.; Criel, G.; Svistunov, A.A.; Vandenabeele, P.; D’Herde, K. Life and death of female gametes during oogenesis and folliculogenesis. Apoptosis 2008, 13, 1065–1087. [Google Scholar] [CrossRef]
- Choi, J.; Jo, M.; Lee, E.; Choi, D. Induction of apoptotic cell death via accumulation of autophagosomes in rat granulosa cells. Fertil. Steril. 2011, 95, 1482–1486. [Google Scholar] [CrossRef]
- Hulas-Stasiak, M.; Gawron, A. Follicular atresia in the prepubertal spiny mouse (Acomys cahirinus) ovary. Apoptosis 2011, 16, 967–975. [Google Scholar] [CrossRef]
- Hale, B.J.; Hager, C.L.; Seibert, J.T.; Selsby, J.T.; Baumgard, L.H.; Keating, A.F.; Ross, J.W. Heat stress induces autophagy in pig ovaries during follicular development. Biol. Reprod. 2017, 97, 426–437. [Google Scholar] [CrossRef]
- Gao, H.; Lin, L.; Ul Haq, I.; Zeng, S.M. Inhibition of NF-κB promotes autophagy via JNK signaling pathway in porcine granulosa cells. Biochem. Bioph. Res. Commun. 2016, 473, 311–316. [Google Scholar] [CrossRef]
- Cuervo, A.M.; Bergamini, E.; Brunk, U.T.; Droge, W.; Ffrench, M.; Terman, A. Autophagy and aging—The importance of maintaining “clean” cells. Autophagy 2005, 1, 131–140. [Google Scholar] [CrossRef]
- Mizushima, N.; Komatsu, M. Autophagy: Renovation of Cells and Tissues. Cell 2011, 147, 728–741. [Google Scholar] [CrossRef]
- Schneider, J.L.; Cuervo, A.M. Autophagy and human disease: Emerging themes. Curr. Opin. Genet. Dev. 2014, 26, 16–23. [Google Scholar] [CrossRef]
- Choi, J.Y.; Jo, M.W.; Lee, E.Y.; Yoon, B.K.; Choi, D.S. The role of autophagy in follicular development and atresia in rat granulosa cells. Fertil. Steril. 2010, 93, 2532–2537. [Google Scholar] [CrossRef]
- Zhou, J.L.; Yao, W.; Li, C.Y.; Wu, W.J.; Li, Q.F.; Liu, H.L. Administration of follicle-stimulating hormone induces autophagy via upregulation of HIF-1 alpha in mouse granulosa cells. Cell Death Dis. 2017, 8, e3001. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.W.; Peng, X.W.; Mei, S.Q. Autophagy in Ovarian Follicular Development and Atresia. Int. J. Biol. Sci. 2019, 15, 726–737. [Google Scholar] [CrossRef] [PubMed]
- Tilly, J.L.; Kowalski, K.I.; Johnson, A.L.; Hsueh, A.J. Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinology 1991, 129, 2799–2801. [Google Scholar] [CrossRef] [PubMed]
- Knox, R.V. Recruitment and selection of ovarian follicles for determination of ovulation rate in the pig. Domest. Anim. Endocrin. 2005, 29, 385–397. [Google Scholar] [CrossRef]
- Lin, P.F.; Rui, R. Effects of Follicular Size and FSH on Granulosa Cell Apoptosis and Atresia in Porcine Antral Follicles. Mol. Reprod. Dev. 2010, 77, 670–678. [Google Scholar] [CrossRef]
- Jiang, Z.; Guerrero-Netro, H.M.; Juengel, J.L.; Price, C.A. Divergence of intracellular signaling pathways and early response genes of two closely related fibroblast growth factors, FGF8 and FGF18, in bovine ovarian granulosa cells. Mol. Cell Endocrinol. 2013, 375, 97–105. [Google Scholar] [CrossRef]
- Manabe, N.; Imai, Y.; Ohno, H.; Takahagi, Y.; Sugimoto, M.; Miyamoto, H. Apoptosis occurs in granulosa cells but not cumulus cells in the atretic antral follicles in pig ovaries. Experientia 1996, 52, 647–651. [Google Scholar] [CrossRef]
- Orimoto, A.M.; Dumaresq-Doiron, K.; Jiang, J.Y.; Tanphaichitr, N.; Tsang, B.K.; Carmona, E. Mammalian Hyaluronidase Induces Ovarian Granulosa Cell Apoptosis and Is Involved in Follicular Atresia. Endocrinology 2008, 149, 5835–5847. [Google Scholar] [CrossRef]
- Ma, L.; Zheng, Y.; Tang, X.; Gao, H.; Liu, N.; Gao, Y.; Hao, L.; Liu, S.; Jiang, Z. miR-21-3p inhibits autophagy of bovine granulosa cells by targeting VEGFA via PI3K/AKT signaling. Reproduction 2019, 158, 441–452. [Google Scholar] [CrossRef]
- Cao, H.; Bissinger, R.; Umbach, A.T.; Gawaz, M.; Lang, F. Temsirolimus Sensitive Stimulation of Platelet Activity, Apoptosis and Aggregation by Collagen Related Peptide. Cell Physiol. Biochem. 2017, 42, 1252–1263. [Google Scholar] [CrossRef]
- Cagnol, S.; Chambard, J.C. ERK and cell death: Mechanisms of ERK-induced cell death—Apoptosis, autophagy and senescence. FEBS. J. 2010, 277, 2–21. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.C.; Worman, H.J. Reactivation of autophagy ameliorates LMNA cardiomyopathy. Autophagy 2013, 9, 110–111. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, S.; John, S.; Sapra, L.; Sharma, S.C.; Das, S.N. Targeted disruption of PI3K/Akt/mTOR signaling pathway, via PI3K inhibitors, promotes growth inhibitory effects in oral cancer cells. Cancer Chemoth. Pharm. 2019, 83, 451–461. [Google Scholar] [CrossRef] [PubMed]
- Yan, B.; Sun, Y.L.; Zeng, J.; Chen, Y.Y.; Li, C.Y.; Song, P.; Zhang, L.; Yang, X.; Wu, Y.; Ma, P. Combined use of vitamin E and nimodipine ameliorates dibutyl phthalate-induced memory deficit and apoptosis in mice by inhibiting the ERK 1/2 pathway. Toxicol. Appl. Pharm. 2019, 368, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Qi, H.; Liu, D.P.; Xiao, D.W.; Tian, D.C.; Su, Y.W.; Jin, S.F. Exosomes derived from mesenchymal stem cells inhibit mitochondrial dysfunction-induced apoptosis of chondrocytes via p38, ERK, and Akt pathways. Vitr. Cell. Dev. Biol. Anim. 2019, 55, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.Y.; Zhang, X.H.; Peng, L.; Liu, Z.; Yang, Y.X.; He, Z.X.; Dang, H.W.; Zhou, S.F. Bardoxolone methyl (CDDO-Me or RTA402) induces cell cycle arrest, apoptosis and autophagy via PI3K/Akt/mTOR and p38 MAPK/Erk1/2 signaling pathways in K562 cells. Am. J. Transl. Res. 2017, 9, 4652. [Google Scholar]
- Wei, P.; Yang, X.J.; Fu, Q.; Han, B.; Ling, L.; Bai, J.; Zong, B.; Jiang, C.Y. Intermedin attenuates myocardial infarction through activation of autophagy in a rat model of ischemic heart failure via both cAMP and MAPK/ERK1/2 pathways. Int. J. Clin. Exp. Pathol. 2015, 8, 9836–9844. [Google Scholar]
- Ito, N.; Ruegg, U.T.; Takeda, S. ATP-Induced Increase in Intracellular Calcium Levels and Subsequent Activation of mTOR as Regulators of Skeletal Muscle Hypertrophy. Int. J. Mol. Sci. 2018, 19, 2804. [Google Scholar] [CrossRef]
- Jimenez, C.M.; Calderon, M.A.; Hernandez, N.; Jaimovich, E.; Radic, S.B. Extracellular ATP promotes protein synthesis in skeletal muscle through activation of the Akt-mTOR signaling pathway. FASEB J. 2018, 32, 856.29. [Google Scholar]
- Gao, H.; Wang, H.; Peng, J.J. Hispidulin Induces Apoptosis Through Mitochondrial Dysfunction and Inhibition of P13k/Akt Signalling Pathway in HepG2 Cancer Cells. Cell Biochem. Biophys. 2014, 69, 27–34. [Google Scholar] [CrossRef]
- Zhang, S.; Lv, Q. High expression of CENPA synergized with up-regulation of PI3K-AKT-mTOR signaling pathway affects chemotherapy response and prognosis in breast cancer patients. Breast 2019, 44, S75. [Google Scholar] [CrossRef]
Gene | (5′–3′) Forward Primer | (5′–3′) Reverse Primer | Amplicon Size (bp) |
---|---|---|---|
Gapdh | GGACTCATGACCACGGTCCAT | TCAGATCCACAACCGACACGT | 220 |
Bcl2 | AGAGCCGTTTCGTCCCTTTC | GCACGTTTCCTAGCGAGCAT | 231 |
Bax | ATGATCGCAGCCGTGGACACG | ACGAAGATGGTCACCGTCTGC | 296 |
Caspase3 | TTGGACTGTGGGATTGAGACG | CGCTGCACAAAGTGACTGGA | 165 |
Atg3 | CACGACTATGGTTGTTTGGCTATG | GGTGGAAGGTGAGGGTGATTT | 127 |
Atg7 | AGATTGCCTGGTGGGTGGT | GGGTGATGCTGGAGGAGTTG | 1021 |
LC3 | AGGTATTCAGTCACCTTTGTTTCA | GAAACGGGCTCTGCAGTCTA | 192 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Y.; Ma, L.; Liu, N.; Tang, X.; Guo, S.; Zhang, B.; Jiang, Z. Autophagy and Apoptosis of Porcine Ovarian Granulosa Cells During Follicular Development. Animals 2019, 9, 1111. https://doi.org/10.3390/ani9121111
Zheng Y, Ma L, Liu N, Tang X, Guo S, Zhang B, Jiang Z. Autophagy and Apoptosis of Porcine Ovarian Granulosa Cells During Follicular Development. Animals. 2019; 9(12):1111. https://doi.org/10.3390/ani9121111
Chicago/Turabian StyleZheng, Yuxin, Lizhu Ma, Ning Liu, Xiaorong Tang, Shun Guo, Bin Zhang, and Zhongliang Jiang. 2019. "Autophagy and Apoptosis of Porcine Ovarian Granulosa Cells During Follicular Development" Animals 9, no. 12: 1111. https://doi.org/10.3390/ani9121111
APA StyleZheng, Y., Ma, L., Liu, N., Tang, X., Guo, S., Zhang, B., & Jiang, Z. (2019). Autophagy and Apoptosis of Porcine Ovarian Granulosa Cells During Follicular Development. Animals, 9(12), 1111. https://doi.org/10.3390/ani9121111