Histomorphological Comparisons and Expression Patterns of BOLL Gene in Sheep Testes at Different Development Stages
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Design
2.2. H&E Staining
2.3. Total RNA Extraction and cDNA Synthesis
2.4. qPCR
2.5. Western Blot
2.6. Immunohistochemistry
2.7. Image Analysis and Data Statistics
3. Results
3.1. Comparison of Morphological Differences between Sheep Testes at Different Ages
3.2. Expression Patterns of the BOLL Gene at the Different Developmental Stages of Sheep Testes
3.3. Expression Patterns of BOLL in Various Tissues of 1-Year-Old Sheep Testes
3.4. Immunolocalization of BOLL Protein in Postnatal Developmental Sheep Testes
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chalmel, F.; Rolland, A.D. Linking transcriptomics and proteomics in spermatogenesis. Reproduction 2015, 150, R149–R157. [Google Scholar] [CrossRef] [Green Version]
- Kotaja, N. MicroRNAs and spermatogenesis. Fertil. Steril. 2014, 101, 1552–1562. [Google Scholar] [CrossRef] [PubMed]
- De Mateo, S.; Sassone-Corsi, P. Regulation of spermatogenesis by small non-coding RNAs: Role of the germ granule. Semin. Cell Dev. Biol. 2014, 29, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Smorag, L.; Xu, X.; Engel, W.; Pantakani, D. The roles of DAZL in RNA biology and development. Wiley Interdiscip. Rev. RNA 2014, 5, 527–535. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.F.; Cheng, S.F.; Wang, L.Q.; Yin, S.; Felici, M.D.; Shen, W. DAZ family proteins, key players for germ cell development. Int. J. Biol. Sci. 2015, 11, 1226–1235. [Google Scholar] [CrossRef] [PubMed]
- Idler, R.K.; Yan, W. Control of messenger RNA fate by RNA-binding proteins: An emphasis on mammalian spermatogenesis. J. Androl. 2012, 33, 309–337. [Google Scholar] [CrossRef]
- Suzuki, A.; Niimi, Y.; Shinmyozu, K.; Zhou, Z.; Kiso, M.; Saga, Y. Dead end1 is an essential partner of NANOS2 for selective binding of target RNAs in male germ cell development. EMBO Rep. 2016, 17, 37–46. [Google Scholar] [CrossRef]
- Rosario, R.; Adams, I.R.; Anderson, R.A. Is there a role for DAZL in human female fertility? Mol. Hum. Reprod. 2016, 22, 377–383. [Google Scholar] [CrossRef] [Green Version]
- Zhang, C.; Xue, P.; Gao, L.; Chen, X.; Lin, K.; Yang, X.; Dai, Y.; Xu, E.Y. Highly conserved epigenetic regulation of BOULE and DAZL is associated with human fertility. FASEB J. 2016, 30, 3424–3440. [Google Scholar] [CrossRef]
- Gonzalez, C.R.; Dorfman, V.B.; Vitullo, A.D. IGF1 regulation of BOULE and CDC25A transcripts via a testosterone-independent pathway in spermatogenesis of adult mice. Reprod. Biol. 2015, 15, 48–55. [Google Scholar] [CrossRef] [PubMed]
- González, C.R.; Moverer, L.; Calandra, R.S.; Gonzálezcalvar, S.I.; Vitullo, A.D. Age-related and photoperiodic variation of the DAZ gene family in the testis of the Syrian hamster (Mesocricetus auratus). Zygote 2018, 26, 127–134. [Google Scholar] [CrossRef]
- Xu, E.Y.; Moore, F.L.; Pera, R.A. A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc. Natl. Acad. Sci. USA 2001, 98, 7414–7419. [Google Scholar] [CrossRef] [Green Version]
- Ahmadivand, S.; Farahmand, H.; Teimoori-Toolabi, L.; Mirvaghefi, A.; Eagderi, S.; Geerinckx, T.; Shokrpoor, S.; Rahmati-Holasoo, H. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. 2016, 225, 235–241. [Google Scholar] [CrossRef]
- Luetjens, C.M.; Xu, E.Y.; Rejo Pera, R.A.; Kamischke, A.; Nieschlag, E.; Gromoll, J. Association of meiotic arrest with lack of BOULE protein expression in infertile men. J. Clin. Endocrinol. Metab. 2004, 89, 1926–1933. [Google Scholar] [CrossRef] [PubMed]
- Kostova, E.; Yeung, C.H.; Luetjens, C.M.; Brune, M.; Nieschlag, E.; Gromoll, J. Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men. Mol. Hum. Reprod. 2007, 13, 85–93. [Google Scholar] [CrossRef]
- Kee, K.; Angeles, V.T.; Flores, M.; Nguyen, H.N.; Reijo Pera, R.A. Human DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete formation. Nature 2009, 462, 222–225. [Google Scholar] [CrossRef] [PubMed]
- Jung, D.; Xiong, J.; Ye, M.; Qin, X.; Li, L.; Cheng, S.; Luo, M.; Peng, J.; Dong, J.; Tang, F. In vitro differentiation of human embryonic stem cells into ovarian follicle-like cells. Nat. Commun. 2017, 8, 15680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, Y.M.; Kuo, P.L.; Lin, Y.H.; Teng, Y.N.; Nan Lin, J.S. Messenger RNA transcripts of the meiotic regulator BOULE in the testis of azoospermic men and their application in predicting the success of sperm retrieval. Hum. Reprod. 2005, 20, 782–788. [Google Scholar] [CrossRef] [Green Version]
- Yao, W.; Li, Y.; Li, B.; Luo, H.; Xu, H.; Pan, Z.; Xie, Z.; Li, Q. Epigenetic regulation of bovine spermatogenic cell-specific gene boule. PLoS ONE 2015, 10, e0128250. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yu, S.; Yang, Q.; Wang, K.; Zhang, S.; Pan, C.; Yan, H.; Dang, R.; Lei, C.; Chen, H. Goat Boule: Isoforms identification, mRNA expression in testis and functional study and promoter methylation profiles. Theriogenology 2018, 116, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, N.; Cooke, H.J. Role of the DAZ genes in male fertility. Reprod. Biomed. Online 2005, 10, 72–80. [Google Scholar] [CrossRef]
- Castrillon, D.H.; Gonczy, P.; Alexander, S.; Rawson, R.; Eberhart, C.G.; Viswanathan, S.; Dinardo, S.; Wasserman, S.A. Toward a molecular genetic analysis of spermatogenesis in Drosophila melanogaster: Characterization of male-sterile mutants generated by single P element mutagenesis. Genetics 1993, 135, 489–505. [Google Scholar] [CrossRef]
- Li, B.; Ngo, S.; Wu, W.; Xu, H.; Xie, Z.; Li, Q.; Pan, Z. Identification and characterization of yak (Bos grunniens) b-Boule gene and its alternative splice variants. Gene 2014, 550, 193–199. [Google Scholar] [CrossRef] [PubMed]
- Vangompel, M.J.; Xu, E.Y. A novel requirement in mammalian spermatid differentiation for the DAZ-family protein Boule. Hum. Mol. Genet. 2010, 19, 2360–2369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.; Liu, C.; Zhu, H.; Sun, J.; Yu, M.; Niu, Z.; Liu, W.; Peng, S.; Hua, J. Expression pattern of Boule in dairy goat testis and its function in promoting the meiosis in male germline stem cells (mGSCs). J. Cell Biochem. 2013, 114, 294–302. [Google Scholar] [CrossRef] [PubMed]
- Li, P.Z.; Yan, G.Y.; Han, L.; Pang, J.; Zhong, B.S.; Zhang, G.M.; Wang, F.; Zhang, Y.L. Overexpression of STRA8, BOULE, and DAZL genes promotes goat bone marrow-derived mesenchymal stem cells in vitro transdifferentiation toward putative male germ cells. Reprod. Sci. 2017, 24, 300–312. [Google Scholar] [CrossRef]
- Kim, B.; Rhee, K. BOULE, a deleted in azoospermia homolog, is recruited to stress granules in the mouse male germ cells. PLoS ONE 2016, 11, e0163015. [Google Scholar] [CrossRef] [PubMed]
- Protter, D.S.W.; Parker, R. Principles and properties of stress granules. Trends Cell Biol. 2016, 26, 668–679. [Google Scholar] [CrossRef]
- Buchan, J.R.; Parker, R. Eukaryotic stress granules: The ins and outs of translation. Mol. Cell 2009, 36, 932–941. [Google Scholar] [CrossRef]
- Hara, A.; Abe, T.; Hirao, A.; Sanbe, K.; Ayakawa, H.; Sarantonglaga, B.; Yamaguchi, M.; Sato, A.; Khurchabilig, A.; Ogata, K.; et al. Histochemical properties of bovine and ovine mammary glands during fetal development. J. Vet. Med. Sci. 2018, 80, 263–271. [Google Scholar] [CrossRef]
- Li, T.; Lu, Z.; Luo, R.; Gao, J.; Zhao, X.; Ma, Y. Expression and cellular localization of double sex and mab-3 related transcription factor 1 in testes of postnatal Small-Tail Han sheep at different developmental stages. Gene 2018, 642, 467–473. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Shah, C.; Vangompel, M.J.; Naeem, V.; Chen, Y.; Lee, T.; Angeloni, N.; Wang, Y.; Xu, E.Y. Widespread presence of human BOULE homologs among animals and conservation of their ancient reproductive function. PLoS Genet. 2010, 6, e1001022. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Li, J.; Li, Q.; Li, X.; Liu, Z.; Song, D.; Xie, Z. Cloning and characterization of the gene encoding the bovine BOULE protein. Mol. Genet. Genomics 2009, 281, 67–75. [Google Scholar] [CrossRef]
- Dwarakanath, M.; Lim, M.; Xu, H.; Hong, Y. Differential expression of boule and dazl in adult germ cells of the Asian seabass. Gene 2014, 549, 237–242. [Google Scholar] [CrossRef] [PubMed]
- Ye, H.; Li, C.J.; Yue, H.M.; Yang, X.G.; Wei, Q.W. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish. Cell Tissue Res. 2015, 360, 413–425. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Li, Z.; Li, M.; Wang, L.; Hong, Y. Boule is present in fish and bisexually expressed in adult and embryonic germ cells of medaka. PLoS ONE 2009, 4, e6097. [Google Scholar] [CrossRef] [PubMed]
- Tung, J.Y.; Luetjens, C.M.; Wistuba, J.; Xu, E.Y.; Reijo Pera, R.A.; Gromoll, J. Evolutionary comparison of the reproductive genes, DAZL and BOULE, in primates with and without DAZ. Dev. Genes Evol. 2006, 216, 158–168. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession No. | Primer Sequence (5′–3′) | Product Length |
---|---|---|---|
BOLL | XM_004004798.3 | F: AGCAGAGAGGAAGATGGAGACC | 122 bp |
R: GGGCACTCGTTGGGTTATTC | |||
β-actin | NM_001009784.1 | F: CTTCCAGCCTTCCTTCCTGG | 180 bp |
R: GCCAGGGCAGTGATCTCTTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, T.; Wang, X.; Zhang, H.; Chen, Z.; Zhao, X.; Ma, Y. Histomorphological Comparisons and Expression Patterns of BOLL Gene in Sheep Testes at Different Development Stages. Animals 2019, 9, 105. https://doi.org/10.3390/ani9030105
Li T, Wang X, Zhang H, Chen Z, Zhao X, Ma Y. Histomorphological Comparisons and Expression Patterns of BOLL Gene in Sheep Testes at Different Development Stages. Animals. 2019; 9(3):105. https://doi.org/10.3390/ani9030105
Chicago/Turabian StyleLi, Taotao, Xia Wang, Hongyu Zhang, Zhili Chen, Xingxu Zhao, and Youji Ma. 2019. "Histomorphological Comparisons and Expression Patterns of BOLL Gene in Sheep Testes at Different Development Stages" Animals 9, no. 3: 105. https://doi.org/10.3390/ani9030105