A Novel eDNA-Based Approach for the Monitoring and Management of the Endangered Beluga (Huso huso, Linnaeus, 1758) and Adriatic (Acipenser naccarii, Bonaparte, 1836) Sturgeon

Abstract

Beluga sturgeon (Huso huso Linnaeus, 1758, acipenseridae) and Adriatic sturgeon (Acipenser naccarii, Bonaparte, 1836, acipenseridae) within the Po River basin have been recently assessed for the IUCN Red List of Threatened Species and were found to be Extinct in the Wild and Critically Endangered, respectively. Significant declines in both species’ abundance have spurred major research efforts and management actions in recent decades. Recently, specific actions have been conducted to recover habitat connectivity through projects of river defragmentation and reintroduction plans have been implemented for both sturgeon species. To manage effective conservation efforts, knowledge of a species’ distribution and abundance is critical, especially for adult sturgeon that are able to move hundreds of kilometers away from release sites. Here, two new quantitative PCR (qPCR) assays to detect beluga sturgeon and Adriatic sturgeon environmental DNA (eDNA) in water samples have been developed with the goal of providing an alternative method to monitor their presence. Two Taqman-based assays targeting the mitochondrial cytochrome b region were developed and showed no amplification of other related and co-occurring fishes. A mesocosm within the Ticino Park on the Ticino River (a main tributary of the Po River), where both species are bred, was used to develop and validate the assays. The LOQ for H. huso assay corresponded to C_t = 41 (7.33 × 10⁷ DNA counts/µL of reaction) and for A. naccarrii it was Ct = 37 (2.23 × 10¹⁶ DNA counts/µL of reaction). Additionally, water samples were taken from the discard drainage, which flows directly into the Ticino River, testing positive detection of eDNA within a distance of up to 2 km. Overall, the results suggested that the two assays developed in this study could represent a promising new tool for monitoring both beluga and Adriatic sturgeon.

1. Introduction

Sturgeon (order Acipenseriformes, Berg 1940) represent one of the most important aquatic natural resources, both scientifically and commercially. With over 85% of species listed as endangered or threatened, sturgeon are considered the world’s most imperiled vertebrate group (IUCN 2022). All species are migratory, either anadromous or potamodromous. Typically, they are slow-growing animals, and they reach sexual maturity very late in life (aged up to 20 years), and some species do not spawn yearly [1]. Over the past century, sturgeon’ populations have been reduced by human-mediated alterations to riverine habitats, such as channelization, dam construction, and degradation of the water quality [2]. Specifically, to the North of Italy, Po River drainages into the Adriatic Sea have affected the beluga sturgeon (Huso huso Linnaeus, 1758) and the Adriatic sturgeon (Acipenser naccarii, Bonaparte, 1836), which have been recently assessed for the IUCN Red List of Threatened Species and were found to be Extinct in the Wild and Critically Endangered, respectively (IUCN 2022). Due to their long life cycle and anadromous behavior, they are very susceptible to overfishing, pollution, and habitat fragmentation [3]. A significant drop in catches began in the early 1920s, primarily as a result of overfishing and habitat fragmentation [4]. Recently, species reintroductions (i.e., the translocation of individuals to areas where a species has been extirpated with the aim of re-establishing a self-sustaining population) have become a widespread practice in sturgeon’ conservation biology [5], and this also contributes to the safeguarding of both beluga and Adriatic sturgeon [6].

A critical aspect for developing and managing effective conservation efforts is the knowledge of a species’ distribution and abundance through monitoring [7]. Assessing the occurrence and distribution of freshwater species using eDNA-based approaches is becoming established as a powerful conservation management tool [8,9], especially in the case of fish taxa [10,11,12,13] eDNA-based approaches have been proven to be reliable and non-invasive strategies suitable for monitoring rare, elusive, anadromous and imperiled fishes, including sturgeon [14,15,16,17,18]. Requiring only the collection of water samples, eDNA can exhibit considerable time and cost benefits over traditional sampling [19], thus allowing for greater spatial distribution of effort, which is critical for species like adult sturgeon that can move over hundreds of kilometers in the Po River basin. Unfortunately, no eDNA-based tools specific for the target detection of H. huso and A. naccarii have ever been developed, limiting the efficacy of monitoring efforts. Therefore, this study aimed (i) to develop and test two probes-based qPCR assays for detecting H. huso and A. naccarii eDNA in water samples from a mesocosm (Figure 1), targeting the variable mitochondrial region Cytochrome b (Cyt b), and (ii) to test the detection distance of the two assays by collecting the water from the drainage of the mesocosm, which directly flows into the Ticino River.

2. Materials and Methods

2.1. Mesocosm Sampling Site

The mesocosm with sturgeon is located in Ticino Park along the Ticino River, a main Alpine tributary of Po River (Figure 2; [20]). The mesocosm consisted of two semi-natural communicating tanks. Each tank is bordered by grids, with natural bottoms and banks, each about 350 m long and 15 m wide. The tanks are mainly fed by a large natural spring channel and partly by small springs along the banks and on the bottom, and directly flowing into the Ticino River (around 2 km) (Figure 1). The depth of the tanks up to the river confluence does not exceed 1.6 m. In the upstream tank (tank 1), Huso huso is bred with a few juvenile individuals of Acipenser naccarii. In total, at the moment of sampling, there were around 30 H. huso individuals for an approximate total biomass of 700 kg. The A. naccarii juveniles were around 1000 individuals with an approximate biomass of 300 kg. Downstream (tank 2), divided by a grid, which impedes fish movements, about 400 adult individuals of A. naccarii (60–120 cm) are bred, with an approximate biomass of 1900 kg. In the system, a few trout and barbels were also present.

2.2. Water Sampling

Sampling took place in June 2023 and in September 2023; water samples were collected using a portable eDNA sampler (Smith-Root) [21] through an 0.45 um eDNA Sampler self-preserving filter (Smith-Root) [22] standing from the edge of the tanks and discarded drainage. At each sampling point, 1 L of benthic water and 1 L of water column were filtered, separately, and a total of 2 L of water was filtered from each tank. Starting from the outflow of tank 2 up to the confluence with the Ticino River (around 2 km), 12 sites were sampled at regular distances between sites. At each site, 2 L of water (1 L benthic and 1 L column water) was filtered to investigate the distance detection of eDNA in natural conditions (Figure 1). Upstream of tank 1, 2 L of water was filtered as a negative control. Filters were kept cool and dark during the transport to the laboratory and stored at −80 °C until the eDNA extraction process (within a week after collection). Total eDNA was extracted from the filters using DNeasy^® PowerSoil^® Kit (Qiagen, Milano, Italy) according to the manufacturer’s protocol. The eDNA was eluted in 75 μL of warmed elution buffer (40 °C) to increase the final eDNA concentration.

All laboratory procedures of the pre-amplification steps were carried out in separate rooms from the post-amplification steps, with dedicated personal protective equipment.

2.3. Assay Design

In order to identify possible genomic region sequences suitable for designing specific primers and probes for A. naccarii and H. huso, a multi-species sequence alignment was created from publicly available sequence data from the National Center for Biotechnology Information’s (NCBI) Genbank repository (http://www.ncbi.nih.gov/genbank, accessed on 26 May 2023). The alignment was created by considering Cyt b nucleotide sequences, since all the species of sturgeon present in the Po River basin, and the species involved in hatchery activity for caviar production, were largely abundant for this marker. The dataset included 123 Acipenseridae sequences belonging to Acipenser baerii (Brandt, 1869), A. gueldenstaedtii (Brandt & Ratzeburg, 1833), A. naccarii (Bonaparte, 1836), A. ruthenus (Linnaeus, 1758), A. stellatus (Pallas, 1771), A. sturio (Linnaeus, 1758) (extinct in Italy), A. trasmontanus (Richardson, 1836) and Huso huso (Linnaeus, 1758) (Supplemental Table S1). Primers and probes were designed using “Primer Quest™Toll” (https://www.idtdna.com/Primerquest/Home/Index, accessed on 27 May 2023) [23], while the presence of dimers and hairpin formations was checked with OligoCalc v. 3.27 (http://www.operon.com/tools/oligo-analysis-tool.aspx, accessed on 27 May 2023). A further validation step was performed to assess the specificity of the designed assays and the possible mismatches with other non-Acipenser species by using NCBI Primer-BLAST tool [24].

2.4. Primer and Probes Validation on Positive Tissue Samples

Genomic DNA was extracted from a fin clip sample collected from A. naccarii and H. huso, using the DNeasy Blood&Tissue^® Kit (Qiagen, Milano, Italy) following manufacturer’s instructions. The concentration and quality of the genomic DNA were checked with a NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The two assays were tested on DNA from both sturgeon species. To select the optimal annealing temperature of each primer pairs, gradient PCR trials were conducted in 20 µL total volume reactions containing 4 µL of 10× Buffer solution (5× WonderTaq reaction Buffer EuroClone^®, Pero (MI), Italy), 1 µL of each primer (10 µM), 0.25 µL Taq polymerase (WonderTaq EuroClone^®), and 2 µL of DNA template, under the following conditions: an initial step at 94 °C for 5 min, followed by 35 cycles of 94 °C for 60 s, with annealing temperature ranging from 50 to 60 °C for 45 s, elongation at 72 °C for 60 s, and a final extension at 72 °C for 7 min. Gel electrophoresis runs of the resulting PCR products were performed on a 2% agarose gel and visualized under UV light. A subset of amplicons of the expected length were excised and sequenced bidirectionally at Eurofins GenomicsDNA. After primer trimming, the presence of an open reading frame was verified for the obtained consensus sequences by using the online tool EMBOSS Transeq (http://www.ebi.ac.uk/Tools/st/emboss_transeq/, accessed on 27 May 2023). Species identification was validated by querying the obtained nucleotide sequences with BLASTn tool [25].

2.5. qPCR Assay Set Up

Quantitative Real Time PCR (qPCR) on a Real-Time PCR StepOne^® (Applied Biosystems^®, Waltham, MA, USA) instrument to test the primer pairs assays. First, each primer pair was used on tissue samples to determine the amplification efficiency (E), limit of detection (LOD), and limit of quantification (LOQ), according to [26,27]. To generate the standard curve, tenfold serial dilutions of quantified positive tissue controls were used at a starting concentration of 340 ng/μL in both cases (Supplemental Table S3). The samples were run in duplicate, together with negative controls (NTC: no template control samples). The qPCR analysis was performed in 10 µL reaction mix containing 5 µL of buffer, 0.25 µL of each primer (10 µM), 0.15 µL of dual-labeled (5′-FAM, 3′-MGBEQ) Taqman Probe (10 µM) and 2 µL of eDNA template with the same thermal conditions used for eDNA samples analysis. Amplification efficiency (E) for both primer sets was calculated according to the following formula:

$$E={10}^{(-{\displaystyle \frac{1}{-\mathit{slope}}})}$$

2.6. eDNA-Based Detection in Environmental Samples

Each eDNA sample was analyzed in six technical replicates (Supplemental Table S2) together with positive (PTC) and negative controls (NTC), respectively. PTC consisted of 2 µL of gDNA extracted from tissue samples, while NTC included ultrapure water. The qPCR was performed following standard thermal conditions, with the annealing step varying depending on the target: A. naccarii: 60 °C annealing temperature for 45 s, 45 cycles; H. huso: 58 °C annealing temperature for 60 s and 45 cycles. eDNA samples were considered positive when a sigmoidal signal was observed in at least two qPCR technical replicates for each run and above the LOD, whereas their status was uncertain when it was observed only in a single technical replicate, even if it was above the LOD. When the qPCR copy number output was below the LOQ but above the theoretical qPCR limit (three copies per reaction according to [26], they were considered as ‘detectable but not quantifiable’ (DBNQ). The C_t (Cycle threshold) values were converted into DNA counts (DNA copies) as follows:

$$\mathit{DNA}\mathit{counts}=E^(C_T\mathit{max}-C^T)$$

$${\displaystyle \frac{\left[\mathit{DNA}\right]ng}{\mu l}}=10^(C_{T-y})/-\mathit{slope}$$

Randomly, some amplicons from eDNA samples were sent for sequencing (Eurofins, Hamburg, Germany) to confirm the detection. Moreover, to further confirm the specificity of our assays, both were tested on eDNA extracts from three water bodies where the absence of Acipenseridae is certain, all of which were located within the Po River basin (i.e., Parco Nord Milano, 45.5314° N, 9.2123° E; San Genuario, 45.1982° N, 8.1889° E). These sites are representative of the fish community inhabiting the Po River basin [28,29]).

3. Results

3.1. Initial qPCR Assays Testing

Preliminary tests of the Cyt b qPCR assays on both A. naccarii and H. huso on DNA from tissue samples demonstrated that the method was specific to the selected mitochondrial region of the target species. The species-specificity test was checked through sequence match analysis from tissue-based amplicons and did not return any high similarity value with the teleost fish or other taxa present in Italian rivers (

Table 1. Primer, probe, and qPCR information for the Cyt b assays developed.

Primer Name	Sequence (5′-3′)	Amplicon	qPCR Conditions
NacFw	GTCACACAAATCCTAACAGGACT
NacProbe	[FAM]TTCAACAGCCTTCTCCTCTGTTGC[MGBEQ]	156 bp	60 °C 45 s. 45 cycles
NacRev	TATATACTATGGTTCATACCTCC
HusFw	AGTAACATTCCACCCATAC
HusProbe	[FAM]ATTCATCCTAATGTTAGTTGGGC[MGBEQ]	120 bp	58 °C 60 s. 45 cycles
HusRev	CCAGACAACTTCACACC

).

The amplification efficiency of the A. naccarii primers was 84.5%. For the 10-fold serial dilution of A. naccarii DNA, the LOD was 340 × 10⁻⁶ ng/µL, with a mean cycle threshold value (C_t) of 43 (SD ± 0.17). The LOQ corresponded to a C_t = 37 (2.23 × 10¹⁶ DNA counts/µL of reaction) (Figure 3). The H. huso amplification efficiency was 91.5%. The measured LOD corresponded to 340 × 10⁻⁶ ng/µL, with a mean cycle threshold value (C_t) of 39 (SD ± 0.13) (Figure 3). The LOQ corresponded to C_t = 41 (7.33 × 10⁷ DNA counts/µL of reaction) (Figure 3). R² values were ≥99.8% for A. naccarii and ≥99.9% for H. huso (Supplemental Table S4).

3.2. eDNA Detection in Environmental Samples

The Cyt b qPCR assays were then tested on the environmental DNA, showing species-specific detection. No amplification was detected in the field negative controls (including the two eDNA extracts from water bodies where no Acipenseridae species occur) for both assays. In tank 1, H. huso’s Cyt b qPCR assay amplified both benthic and column water samples (sample S1) at 30 cycles, whilst A. naccarii’s Cyt b qPCR was amplified during later cycles (31–32 cycles) according to the lower abundance of this species (Figure 1;

Table 2. Samples’ details and results based on the two Cyt b assays. Sample ID, type of sample (column water, benthic water), distance from the outflow of tank 2 (distnacc), distance from the outflow of tank 1 (disthuso), average C_t values based on six replicates (successful replicates indicated), average eDNA concentration in (ng/µL) ([eDNA]), and DNA counts/L (DNA copies) are indicated.

		Acipenser naccarii				Huso huso
ID	Type	Distnacc (m)	Ct	[eDNA]	DNA Copies	Disthuso (m)	Ct	[eDNA]	DNA Copies
S1	Column	-	32 (3/6)	0.1027	3.79 × 1031	-	30 (3/6)	0.0809	9.28 × 1034
	Benthic		31 (6/6)	0.1787	4.12 × 1033		30 (6/6)	0.0885	1.82 × 1035
S2	Column	-	31 (4/6)	0.1267	2.25 × 1032	0	32 (4/6)	0.0214	4.43 × 1030
	Benthic		30 (6/6)	0.2623	1.06 × 1035		31 (6/6)	0.0384	5.80 × 1032
15c	Column	0	31 (6/6)	0.1298	2.76 × 1032	450	31 (6/6)	0.0427	7.81 × 1032
15b	Benthic		31 (6/6)	0.1740	3.29 × 1033		32 (6/6)	0.0267	2.32 × 1031
16c	Column	50	44 (0/6)	-	-	500	33 (6/6)	0.0182	1.33 × 1030
16b	Benthic		44 (0/6)	-	-		40 (0/6)	-	-
17c	Column	100	35 (6/6)	0.0192	2.55 × 1025	550	33 (6/6)	0.0193	2.08 × 1030
17b	Benthic		36 (6/6)	0.0114	3.19 × 1023		34 (6/6)	0.0064	5.27 × 1026
1c	Column	150	35 (6/6)	0.0211	5.74 × 1025	600	39 (5/6)	0.0004	2.29 × 1017
1b	Benthic		35 (6/6)	0.0158	4.99 × 1024		40 (0/6)	-	-
2c	Column	250	36 (4/6)	0.0107	1.84 × 1023	700	35 (6/6)	0.0044	3.30 × 1025
2b	Benthic		36 (6/6)	0.0091	4.67 × 1022		35 (6/6)	0.0037	8.25 × 1024
3c	Column	400	36 (6/6)	0.0112	2.77 × 1023	850	38 (3/6)	0.0007	2.08 × 1019
3b	Benthic		36 (3/6)	0.0099	9.87 × 1022		40 (0/6)	-	-
4c	Column	600	34 (6/6)	0.0260	3.44 × 1026	1050	36 (5/6)	0.0025	4.90 × 1023
4b	Benthic		34 (6/6)	0.0318	1.85 × 1027		35 (6/6)	0.0038	1.11 × 1025
5c	Column	800	37 (6/6)	0.0083	2.23 × 1022	1250	36 (6/6)	0.0028	1.03 × 1024
5b	Benthic		34 (6/6)	0.0314	1.67 × 1027		35 (6/6)	0.0047	5.61 × 1025
6c	Column	1000	35 (6/6)	0.0212	6.06 × 1025	1450	35 (5/6)	0.0044	3.05 × 1025
6b	Benthic		34 (6/6)	0.0365	5.94 × 1027		35 (6/6)	0.0047	5.62 × 1023
7c	Column	1250	36 (6/6)	0.0115	3.50 × 1023	1650	36 (5/6)	0.0026	6.41 × 1023
7b	Benthic		34 (6/6)	0.0266	4.06 × 1026		39 (4/6)	0.0005	4.48 × 1018
8c	Column	1500	32 (6/6)	0.1061	5.00 × 1031	1950	34 (1/6)	0.0067	7.78 × 1026
8b	Benthic		36 (6/6)	0.0134	1.27 × 1024		36 (2/6)	0.0019	5.41 × 1022
9c	Column	2000	33 (6/6)	0.0453	3.73 × 1028	2450	40 (0/6)	-	-
9b	Benthic		34 (6/6)	0.0347	3.87 × 1027		40 (0/6)	-	-

). In tank 2, A. naccarii’s Cyt b qPCR was amplified at lower cycles (sample S2, C_t = 30–31), according to the higher biomass in tank 2 (Figure 2; Table 2).

The detection of eDNA for both assays covered the 2 km range investigated in the mesocosm for both column and benthic water (sampling point 9 for A. naccarii’s Cyt b qPCR assay and sampling point 8 for H. huso’s Cyt b qPCR assay) (Table 2; Figure 4). Out of 24 samples, only 2 samples (16c and 16b), for the detection of A. naccarii eDNA provided positive signals in all replicates at higher C_t values than the dilutions, and thus their detection is considered unreliable, whilst 5 samples were unreliable for the detection of H. huso eDNA (Table 2). Specifically, for H. huso eDNA detection, sampling point 9 provided a positive but unreliable signal due to the detection at a high C_t value, probably due to the outreach of the distance range detection of the assay (approximately 2.5 km) (Table 2). Detection of A. naccarii’s eDNA was successful in all six qPCR replicates in all samples except samples 2c and 3b, where successful replicates were four and three, respectively. In comparison, the detection of H. huso’s eDNA provided less successful replicates for a higher number of samples (eight in total) (Table 2). However, only at sampling point 8 was the number of successful qPCR replicates low (less than 50%), probably approaching the range of the detection limit (Table 2). For both assays, the eDNA detection did not show a linear trend from the outflow of the tanks to the confluence of the Ticino River (Figure 4). A higher eDNA concentration was retrieved in benthic water in five out of eleven sampling points for A. naccarii’s Cyt b qPCR assay; specifically, four benthic samples collected between 600 m and 1250 m from the outflow of tank 2 (Figure 4; Table 2). For H. huso’s Cyt b qPCR assay, a higher eDNA concentration was retrieved in benthic water in only three samples (17b, 5b and 6b) (Figure 4; Table 2).

4. Discussion

This study was the first one devoted to the tracking of eDNA from the rare and endangered sturgeon H. huso and A. naccarii, in freshwater ecosystems, based on qPCR Cyt b assays. The two qPCR assays for detecting H. huso and A. naccarii eDNA in field sampling were robust, highly efficient, and species-specific. The trials conditions from the mesocosm allowed us to simulate the sympatry conditions found in the Po River basin of the two sturgeon species, where the abundance of the rare H. huso in the tanks was 1:3 compared to the presence of A. naccarii.

The results showed promise for applying the assays for monitoring H. huso and A. naccarii in their natural freshwater habitat. The maximum detection distance of H. huso in this study was at around 2 km, with a signal that dropped at around 2.5 km, whilst the maximum detection distance for A. naccarii could be greater than 2 km, but a further sampling site was not accessible during this study. A greater detection distance of A. naccarii might be related to the higher abundance in the tanks; indeed, quantitative comparison of eDNA detection versus acoustic detections revealed significant relationships between eDNA and Atlantic sturgeon in two river systems [30]. However, when Atlantic sturgeon were in lower abundances, in deeper areas, and were not actively migrating, eDNA detection in surface water failed [31]. Whilst also other studies have found the quantity of eDNA to be correlated with species density (i.e., [31,32,33], there is still limited knowledge of how conditions such as DNA shedding rates (fish behavior), water chemistry, flow, and temperature affect eDNA concentrations. River flow could influence the detectability by moving eDNA downstream up to 100 km from where the fish are located [34,35,36]; however, there is some evidence that eDNA does not necessarily accumulate in downstream sampling sites [7,31] and the transport of eDNA is highly variable and complicated to trace [37]. Further work in natural habitats should include measuring the river flow at each sampling site, and deeper investigations are needed to examine the factors influencing variability in eDNA detection rates. Indeed, to design a satisfactory survey method, an understanding of the sensitivity of eDNA detection rates downstream in running water is critical [38]. In addition to abiotic factors, the distribution and movement of fish can also be affected by the flow [39,40]. Further complicating the interpretation of eDNA results is the historical eDNA transport between river sediments and water column [41]. Sediment eDNA may be present at a higher concentration than that in the water column [41], but it could also not be correlated with the actual aquatic eDNA [42]. However, given that sturgeon tend to live at the bottom of the river over sand and mud, and feed on bottom-living invertebrates and small fishes, eDNA-based detection is not likely to detect traces that have been retained in the environment in the long term. Although, in this study, the depth of the tanks where sturgeon were bred did not allow testing difference between surface/column water and benthic water, a previous study on sturgeon suggested that there may be a higher eDNA concentration in benthic water [16], which must be taken in account during further investigations. Moreover, increased eDNA detection was observed in Alabama sturgeon during the spawning seasons, when fish were likely migrating and producing gametes [16], which is likely to be the same for both H. huso and A. naccarii during their migration up to the Po River basin.

Overall, these results indicate that qPCR eDNA-based detection of H. huso and A. naccarii has broad potential applications. eDNA is a viable approach for monitoring this important endangered species and can inform DNA-based trophic dynamics studies [43]. Given the relatively low eDNA abundances in river samples, increasing the water volume sampled, the sampling frequency, and varying the depths sampled may improve the detection probability, especially for the rarest H. huso.

Many efforts have been put in place to promote the ecological requirements of the Po River catchment, restoring its connectivity and opening migratory routes for anadromous species like sturgeon, with evidence that the Po River remains suitable for the reproduction of the Adriatic sturgeon [44]. The removal of the main impoundment in the lower Po River, Isola Serafini Dam (EU-LIFE project ConFluPo, 2012–2017), is critical for the current reintroduction program for both sturgeon species [6], allowing them to reach the upstream-located suitable spawning sites. Furthermore, the engineered fish pass, built in Isola Serafini, is equipped with a station for observing fishes’ movements in both directions [45], which can effectively support eDNA monitoring. Indeed, eDNA sampling seems to be especially suited to monitoring the reproduction and spawning of migratory anadromous fish in particular when it is paired with other methods to confirm that reproduction is taking place, such as upstream spawning migration [13,46,47]. For migratory species, repeated sampling can determine the timing and spatial extent of spawning [48,49] recovery dynamics following dam removal [50]. Moreover, high-frequency temporal sampling of water could effectively provide a more accurate representation of spawning abundances [13,51,52] that is a critical issue for optimizing conservation and management actions.