Transcriptome Analysis of Egg Yolk Sialoglycoprotein on Osteogenic Activity in MC3T3-E1 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Regents
2.2. Preparation of EYG
2.3. Cell Culture
2.4. Determination of Proliferative Activity
2.5. ALP Activity Assay
2.6. Determination of COL-I and OCN Content
2.7. Alizarin Red Staining Assay
2.8. RNA-seq
2.9. qRT-PCR
2.10. Statistical Analysis
3. Results
3.1. Effect of EYG on Proliferation of MC3T3-E1 Cells
3.2. Effect of EYG on ALP Activity
3.3. Effect of EYG on COL-I and OCN Content
3.4. Effect of EYG on Mineralization of MC3T3-E1 Cells
3.5. Screening of DEGs
3.6. GO Analysis
3.7. KEGG Analysis
3.8. PPI (Protein–Protein Interaction) Network
3.9. qRT-PCR Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cummings, S.R.; Black, D. Bone mass measurements and risk of fracturein caucasian women: A review of findings from prospective studies. Am. J. Med. 1995, 98, 24S–28S. [Google Scholar] [CrossRef]
- Wirries, A.; Schubert, A.K.; Zimmermann, R.; Jabari, S.; Ruchholtz, S.; El-Najjar, N. Thymoquinone accelerates osteoblast differentiation and activates bone morphogenetic protein-2 and ERK pathway. Int. Immunopharmacol. 2013, 15, 381–386. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Xue, Y.; Zhang, Y.J.B. Effects of 0.4 T rotating magnetic field exposure on density, strength, calcium and metabolism of rat thigh bones. Bioelectromagnetics 2010, 27, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Katagiri, T.; Takahashi, N. Regulatory mechanisms of osteoblast and osteoclast differentiation. Oral Dis. 2010, 8, 147–159. [Google Scholar] [CrossRef] [PubMed]
- Uehara, K.; Takahashi, A.; Watanabe, M.; Nomura, Y. Shark protein improves bone mineral density in ovariectomized rats and inhibits osteoclast differentiation. Nutrition 2014, 30, 719–725. [Google Scholar] [CrossRef]
- Xie, C.-L.; Park, K.H.; Kang, S.S.; Cho, K.M.; Lee, D.H. Isoflavone-enriched soybean leaves attenuate ovariectomy-induced osteoporosis in rats by anti-inflammatory activity. J. Sci. Food Agric. 2021, 101, 1499–1506. [Google Scholar] [CrossRef]
- Fu, M.; Tian, Y.; Zhang, T.; Zhan, Q.; Zhang, L.; Wang, J. Comparative study of DHA-enriched phosphatidylcholine and EPA-enriched phosphatidylcholine on ameliorating high bone turnover via regulation of the osteogenesis-related Wnt/β-catenin pathway in ovariectomized mice. Food Funct. 2020, 11, 10094–10104. [Google Scholar] [CrossRef]
- Mei, F.; Meng, K.; Gu, Z.; Yun, Y.; Zhang, W.; Zhang, C.; Zhong, Q.; Pan, F.; Shen, X.; Xia, G.; et al. Arecanut (Areca catechu L.) Seed Polyphenol-Ameliorated Osteoporosis by Altering Gut Microbiome via LYZ and the Immune System in Estrogen-Deficient Rats. J. Agric. Food Chem. 2021, 69, 246–258. [Google Scholar] [CrossRef]
- Xia, G.; Wang, J.; Sun, S.; Zhao, Y.; Wang, Y.; Yu, Z.; Wang, S.; Xue, C. Sialoglycoproteins prepared from the eggs of Carassius auratus prevent bone loss by inhibiting the NF-κB pathway in ovariectomized rats. Food Funct. 2016, 7, 704–712. [Google Scholar] [CrossRef]
- Xia, G.; Yu, Z.; Zhao, Y.; Wang, Y.; Wang, S.; He, M.; Wang, J.; Xue, C. Sialoglycoproteins isolated from the eggs of Carassius auratus prevents osteoporosis by suppressing the activation of osteoclastogenesis related NF-κB and MAPK pathways. J. Funct. Foods 2015, 17, 491–503. [Google Scholar] [CrossRef]
- Xia, G.; Zhao, Y.; Yu, Z.; Tian, Y.; Wang, Y.; Wang, S.; Wang, J.; Xue, C. Phosphorylated Peptides from Antarctic Krill (Euphausia superba) Prevent Estrogen Deficiency Induced Osteoporosis by Inhibiting Bone Resorption in Ovariectomized Rats. J. Agric. Food Chem. 2015, 63, 9550–9557. [Google Scholar] [CrossRef]
- Canalis, E.; Economides, A.N.; Gazzerro, E. Bone morphogenetic proteins, their antagonists, and the skeleton. Endocr. Rev. 2003, 24, 218–235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stein, G.S.; Lian, J.B. Molecular Mechanisms Mediating Proliferation/Differentiation Interrelationships During Progressive Development of the Osteoblast Phenotype. Endocr. Rev. 1993, 14, 424–442. [Google Scholar] [CrossRef] [PubMed]
- Blair, H.C.; Larrouture, Q.C.; Li, Y.; Lin, H.; Beer-Stoltz, D.; Liu, L.; Tuan, R.S.; Robinson, L.J.; Schlesinger, P.H.; Nelson, D.J. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng. Part B Rev. 2017, 23, 268–280. [Google Scholar] [CrossRef] [Green Version]
- Carvalho, M.S.; Poundarik, A.A.; Cabral, J.M.S.; da Silva, C.L.; Vashishth, D. Biomimetic matrices for rapidly forming mineralized bone tissue based on stem cell-mediated osteogenesis. Sci. Rep. 2018, 8, 14388. [Google Scholar] [CrossRef] [Green Version]
- Komori, T. Regulation of osteoblast differentiation by transcription factors. J. Cell. Biochem. 2010, 99, 1233–1239. [Google Scholar] [CrossRef]
- Tarkkonen, K.; Hieta, R.; Kytölä, V.; Nykter, M.; Kiviranta, R. Comparative analysis of osteoblast gene expression profiles and Runx2 genomic occupancy of mouse and human osteoblasts in vitro. Gene 2017, 626, 119–131. [Google Scholar] [CrossRef] [PubMed]
- Byers, B.A.; García, A.J. Exogenous Runx2 Expression Enhances in Vitro Osteoblastic Differentiation and Mineralization in Primary Bone Marrow Stromal Cells. Tissue Eng. 2004, 10, 1623–1632. [Google Scholar] [CrossRef]
- Visser, R.; Bodnarova, K.; Arrabal, P.M.; Cifuentes, M.; Becerra, J. Combining bone morphogenetic proteins-2 and -6 has additive effects on osteoblastic differentiationin vitroand accelerates bone formationin vivo. J. Biomed. Mater. Res. Part A 2015, 104, 178–185. [Google Scholar] [CrossRef]
- Dijke, P.T. Bone morphogenetic protein signal transduction in bone. Curr. Med. Res. Opin. 2006, 22, S7–S11. [Google Scholar] [CrossRef]
- Miyazono, K.; Maeda, S.; Imamura, T. BMP receptor signaling: Transcriptional targets, regulation of signals, and signaling cross-talk. Cytokine Growth Factor Rev. 2005, 16, 251–263. [Google Scholar] [CrossRef]
- Martín-Millán, M.; Gónzalez-Martín, M.C.; Ruíz, P.; Almeida, M.; Ros, M.A.; González-Macías, J. La vía Wnt/β-catenina disminuye la cantidad de osteoclastos en el hueso y favorece su apoptosis. Rev. Osteoporos. Metab. Miner. 2019, 11, 39–45. [Google Scholar] [CrossRef]
- Galli, C.; Piemontese, M.; Lumetti, S.; Manfredi, E.; Passeri, G. GSK3b-inhibitor lithium chloride enhances activation of Wnt canonical signaling and osteoblast differentiation on hydrophilic titanium surfaces. Clin. Oral Implant. Res. 2013, 24, 921–927. [Google Scholar] [CrossRef]
- Glass, D.A., 2nd; Bialek, P.; Ahn, J.D.; Starbuck, M.; Patel, M.S.; Clevers, H.; Taketo, M.M.; Long, F.; McMahon, A.P.; Lang, R.A.; et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev. Cell 2005, 8, 751–764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, J.; Xu, X.; Zhang, Q.; Yuan, Z.; Tan, B. The PI3K/AKT pathway promotes fracture healing through its crosstalk with Wnt/β-catenin. Exp. Cell Res. 2020, 394, 112137. [Google Scholar] [CrossRef]
- Kim, H.K.; Lee, S.; Leem, K.H. Protective effect of egg yolk peptide on bone metabolism. Menopause N. Y. 2011, 18, 307–313. [Google Scholar] [CrossRef]
- Xia, G.; Wang, S.; He, M.; Zhou, X.; Zhao, Y.; Wang, J.; Xue, C. Anti-osteoporotic activity of sialoglycoproteins isolated from the eggs of Carassius auratus by promoting osteogenesis and increasing OPG/RANKL ratio. J. Funct. Foods 2015, 15, 137–150. [Google Scholar] [CrossRef]
- Zhan, Q.; Dai, Y.; Wang, F.; Mai, X.; Wang, J. Metabonomic analysis in investigating the anti-osteoporotic effect of sialoglycoprotein isolated from eggs of carassius auratus on ovariectomized mice. J. Funct. Foods 2019, 61, 103514. [Google Scholar] [CrossRef]
- Seko, A.; Koketsu, M.; Nishizono, M.; Enoki, Y.; Ibrahim, H.R.; Juneja, L.R.; Kim, M.; Yamamoto, T. Occurrence of a sialylglycopeptide and free sialylglycans in hen’s egg yolk. Biochim. Biophys. Acta Gen. Subj. 1997, 1335, 23–32. [Google Scholar] [CrossRef]
- Zou, Y.; Wu, Z.; Chen, L.; Liu, X.; Gu, G.; Xue, M.; Wang, P.G.; Chen, M. An Efficient Approach for Large-Scale Production of Sialyglycopeptides from Egg Yolks. J. Carbohydr. Chem. 2012, 31, 436–446. [Google Scholar] [CrossRef]
- Kobayashi, T.; Koie, H.; Watanabe, A.; Ino, A.; Watabe, K.; Kim, M.; Kanayama, K.; Otsuji, K. Effects of food enriched with egg yolk hydrolysate (bone peptide) on bone metabolism in orchidectomized dogs. J. Vet. Med. Sci. 2015, 77, 503–506. [Google Scholar] [CrossRef] [Green Version]
- Leem, K.H.; Kim, M.G.; Kim, H.M.; Kim, M.; Lee, Y.J.; Kim, H.K. Effects of Egg Yolk Proteins on the Longitudinal Bone Growth of Adolescent Male Rats. Biosci. Biotechnol. Biochem. 2004, 68, 2388–2390. [Google Scholar] [CrossRef] [Green Version]
- Ji, M.; Leem, K.-H.; Kim, M.; Kim, H.K. Egg yolk soluble protein stimulates the proliferation and differentiation of osteoblastic MC3T3-E1 cells. Biosci. Biotechnol. Biochem. 2007, 71, 1327–1329. [Google Scholar] [CrossRef]
- Sun, B.; Bao, W.; Tian, X.; Li, M.; Liu, H.; Dong, J.; Huang, W. A simplified procedure for gram-scale production of sialylglycopeptide (SGP) from egg yolks and subsequent semi-synthesis of Man3GlcNAc oxazoline. Carbohydr. Res. 2014, 396, 62–69. [Google Scholar] [CrossRef]
- Liu, L.; Prudden, A.R.; Bosman, G.P.; Boons, G.J. Improved isolation and characterization procedure of sialylglycopeptide from egg yolk powder. Carbohydr. Res. 2017, 452, 122–128. [Google Scholar] [CrossRef] [PubMed]
- Mei, F.; Liu, J.; Wu, J.; Duan, Z.; Chen, M.; Meng, K.; Chen, S.; Shen, X.; Xia, G.; Zhao, M. Collagen Peptides Isolated from Salmo salar and Tilapia nilotica Skin Accelerate Wound Healing by Altering Cutaneous Microbiome Colonization via Upregulated NOD2 and BD14. J. Agric. Food Chem. 2020, 68, 1621–1633. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Zeng, M.; Zhao, Y. Thermal processed Crassostrea gigas impact the mouse gut microbiota. J. Funct. Foods 2020, 75, 104254. [Google Scholar] [CrossRef]
- Wang, W.; Olson, D.; Cheng, B.; Guo, X.; Wang, K. Sanguis Draconis resin stimulates osteoblast alkaline phosphatase activity and mineralization in MC3T3-E1 cells. J. Ethnopharmacol. 2012, 142, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Yang, Y.; Zhu, P.; Chen, W.; Qi, D.; Shi, X.; Zhang, C.; Yang, Z.; Li, P. Echinacoside promotes bone regeneration by increasing OPG/RANKL ratio in MC3T3-E1 cells. Fitoterapia 2012, 83, 1443–1450. [Google Scholar] [CrossRef]
- Park, K.; Ju, W.C.; Yeo, J.H.; Kim, J.Y.; Seo, H.S.; Uchida, Y.; Cho, Y. Increased OPG/RANKL ratio in the conditioned medium of soybean-treated osteoblasts suppresses RANKL-induced osteoclast differentiation. Int. J. Mol. Med. 2014, 33, 178–184. [Google Scholar] [CrossRef]
- Wang, C.; Yu, T.; Tan, L.; Cheng, J. Bioinformatics analysis of gene expression profile in callus tissues of osteoporotic phenotype mice induced by osteoblast-specific Krm2 overexpression. Int. J. Rheum. Dis. 2016, 19, 1263–1271. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Duan, R.; Wu, B.; Huang, W.; Zhang, X.; Qu, M.; Liu, T.; Yu, X. Gene expression profiles and bioinformatics analysis of insulin-like growth factor-1 promotion of osteogenic differentiation. Mol. Genet. Genom. Med. 2019, 7, e00921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Wang, H.; Zhou, X.-Z.; Li, N.; Guo, Y.-C.; Chen, T.-P. Pentraxin 3 promotes the osteoblastic differentiation of MC3T3-E1 cells through the PI3K/Akt signaling pathway. Biosci. Rep. 2020, 40. [Google Scholar] [CrossRef] [PubMed]
- Huber-Lang, M.; Ignatius, A.; Brenner, R.E. Role of Complement on Broken Surfaces After Trauma. Adv. Exp. Med. Biol. 2015, 865, 43–55. [Google Scholar]
- Xu, C.P.; Li, X.; Hu, Y.J.; Cui, Z.; Wang, L.; Liang, L.; Zhou, Y.L.; Yang, Y.J.; Yu, B. Quantitative proteomics reveals ELP2 as a regulator to the inhibitory effect of TNF-alpha on osteoblast differentiation. J. Proteom. 2015, 114, 234–246. [Google Scholar] [CrossRef] [PubMed]
- Jeong, B.-C. ATF3 mediates the inhibitory action of TNF-α on osteoblast differentiation through the JNK signaling pathway. Biochem. Biophys. Res. Commun. 2018, 499, 696–701. [Google Scholar] [CrossRef]
- Ke, K.; Sul, O.; Chung, S.; Suh, J.; Choi, H.S. Lack of NOD2 attenuates ovariectomy-induced bone loss via inhibition of osteoclasts. J. Endocrinol. 2017, 235, 85–96. [Google Scholar] [CrossRef]
- Wang, K.; Li, S.; Gao, Y.; Feng, X.; Liu, W.; Luo, R.; Song, Y.; Tu, J.; Liu, Y.; Yang, C. BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages. Bone 2018, 114, 257–267. [Google Scholar] [CrossRef]
- Hong, L.; Sharp, T.; Khorsand, B.; Fischer, C.; Amendt, B.A. MicroRNA-200c Represses IL-6, IL-8, and CCL-5 Expression and Enhances Osteogenic Differentiation. PLoS ONE 2016, 11, e0160915. [Google Scholar]
- Lin, S.K.; Chang, H.H.; Chen, Y.J.; Wang, C.C.; Galson, D.L.; Hong, C.Y.; Kok, S.H. Epigallocatechin-3-gallate diminishes CCL2 expression in human osteoblastic cells via up-regulation of phosphatidylinositol 3-Kinase/Akt/Raf-1 interaction: A potential therapeutic benefit for arthritis. Arthritis Rheum. 2010, 58, 3145–3156. [Google Scholar] [CrossRef]
- Mathews, S.; Bhonde, R.; Gupta, P.K.; Totey, S. Extracellular matrix protein mediated regulation of the osteoblast differentiation of bone marrow derived human mesenchymal stem cells. Differentiation 2012, 84, 185–192. [Google Scholar] [CrossRef]
- Ventura, R.D.; Padalhin, A.R.; Kim, B.; Park, M.K.; Lee, B.T. Evaluation of bone regeneration potential of injectable extracellular matrix (ECM) from porcine dermis loaded with biphasic calcium phosphate (BCP) powder. Mater. Sci. Eng. C 2020, 110, 110663. [Google Scholar] [CrossRef]
- Hoshiba, T.; Kawazoe, N.; Chen, G. The balance of osteogenic and adipogenic differentiation in human mesenchymal stem cells by matrices that mimic stepwise tissue development. Biomaterials 2012, 33, 2025–2031. [Google Scholar] [CrossRef] [PubMed]
- Klees, R.F.; Salasznyk, R.M.; Vandenberg, S.; Bennett, K.; Plopper, G.E. Laminin-5 activates extracellular matrix production and osteogenic gene focusing in human mesenchymal stem cells. Matrix Biol. 2007, 26, 106–114. [Google Scholar] [CrossRef] [Green Version]
- Castillo, A.B. Focal Adhesion Kinase Plays a Role in Osteoblast Mechanotransduction In Vitro but Does Not Affect Load- Induced Bone Formation In Vivo. PLoS ONE 2012. [Google Scholar] [CrossRef] [PubMed]
- Licini, C.; Vitale-Brovarone, C.; Mattioli-Belmonte, M. Collagen and non-collagenous proteins molecular crosstalk in the pathophysiology of osteoporosis. Cytokine Growth Factor Rev. 2019, 49, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, M.S.; Cabral, J.M.S.; da Silva, C.L.; Vashishth, D. Bone Matrix Non-Collagenous Proteins in Tissue Engineering: Creating New Bone by Mimicking the Extracellular Matrix. Polymer 2021, 13, 1095. [Google Scholar] [CrossRef]
- Paradis, F.-H.; Hales, B.F. The Effects of Class-Specific Histone Deacetylase Inhibitors on the Development of Limbs During Organogenesis. Toxicol. Ences Off. J. Soc. Toxicol. 2015, 148, 220–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeanne, M.; Gould, D.B. Genotype-phenotype correlations in pathology caused by collagen type IV alpha 1 and 2 mutations. Matrix Biol. 2016, 57, 29–44. [Google Scholar] [CrossRef] [Green Version]
- Hopwood, B. Gene expression profile of the bone microenvironment in human fragility fracture bone. Bone 2009, 44, 87–101. [Google Scholar] [CrossRef]
- Dun, H. Morphological and proteomic analysis of early stage of osteoblast differentiation in osteoblastic progenitor cells. Exp. Cell Res. 2010, 316, 2291–2300. [Google Scholar]
- Wen, Y.; Yang, H.; Wu, J.; Wang, A.; Jin, Z. COL4A2 in the tissue-specific extracellular matrix plays important role on osteogenic differentiation of periodontal ligament stem cells. Theranostics 2019, 9, 4265–4286. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) |
---|---|
COL-I | F- GACAGGCGAACAAGGTGACAGAG |
R- CAGGAGAACCAGGAGAACCAGGAG | |
BMP2 | F- AAGCGTCAAGCCAAACACAAACAG |
R- GAGGTGCCACGATCCAGTCATTC | |
RUNX2 | F- CGGCAAGATGAGCGACGTGAG |
R- TGCTGCTGCTGCTGCTGTTG | |
β-CATENIN | F- TGCCGTTCGCCTTCATTATGGAC |
β-ACTIN | R- TGGGCAAAGGGCAAGGTTTCG F- GTGACGTTGACATCCGTAAAGA R- GTAACAGTCCGCCTAGAAGCAC |
Pathway | ID | Gene Name | Corrected p-Value | |||
---|---|---|---|---|---|---|
UP | ||||||
ECM–receptor interaction | mmu04512 | COL2A1 | 0.016550785 | |||
COL4A2 | ||||||
COL4A1 | ||||||
Protein digestion and absorption | mmu04974 | COL2A1 | 0.016550785 | |||
COL4A2 | ||||||
COL4A1 | ||||||
Focal adhesion | mmu04510 | COL2A1 | 0.016550785 | |||
COL4A2 | ||||||
COL4A1 | ||||||
PDGFB | ||||||
Amoebiasis | mmu05146 | COL2A1 | 0.024727215 | |||
COL4A2 | ||||||
COL4A1 | ||||||
DOWN | ||||||
TNF signaling pathway | mmu04668 | CCL5 | 0.028943572 | |||
CCL2 | ||||||
NOD2 | ||||||
MMP9 | ||||||
BCL3 | ||||||
Complement and coagulation cascades | mmu04610 | F13a1 | 0.036868851 | |||
C4b | ||||||
Serpinf2 | ||||||
C3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, S.; Meng, K.; Chen, M.; Zhu, L.; Xiang, Q.; Quan, Z.; Xia, G.; Shen, X. Transcriptome Analysis of Egg Yolk Sialoglycoprotein on Osteogenic Activity in MC3T3-E1 Cells. Appl. Sci. 2021, 11, 6428. https://doi.org/10.3390/app11146428
He S, Meng K, Chen M, Zhu L, Xiang Q, Quan Z, Xia G, Shen X. Transcriptome Analysis of Egg Yolk Sialoglycoprotein on Osteogenic Activity in MC3T3-E1 Cells. Applied Sciences. 2021; 11(14):6428. https://doi.org/10.3390/app11146428
Chicago/Turabian StyleHe, Sizhe, Keke Meng, Muxue Chen, Lehui Zhu, Qingying Xiang, Zhangyan Quan, Guanghua Xia, and Xuanri Shen. 2021. "Transcriptome Analysis of Egg Yolk Sialoglycoprotein on Osteogenic Activity in MC3T3-E1 Cells" Applied Sciences 11, no. 14: 6428. https://doi.org/10.3390/app11146428