Next Article in Journal
Experimental Study on the Strength and Durability for Slag Cement Mortar with Bentonite
Next Article in Special Issue
An RNA Triangle with Six Ribozyme Units Can Promote a Trans-Splicing Reaction through Trimerization of Unit Ribozyme Dimers
Previous Article in Journal
Structural, Mechanical, and Dielectric Properties of Polydimethylsiloxane and Silicone Elastomer for the Fabrication of Clinical-Grade Kidney Phantom
Previous Article in Special Issue
RNA-Peptide Conjugation through an Efficient Covalent Bond Formation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 11
Issue 3
10.3390/app11031174
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Novel Lipid-Oligonucleotide Conjugates Containing Long-Chain Sulfonyl Phosphoramidate Groups: Synthesis and Biological Properties

by
Alina Derzhalova
1,2,†,
Oleg Markov
2,†,
Alesya Fokina
1,3,†,
Yasuo Shiohama
4,
Timofei Zatsepin
5,6,
Masayuki Fujii
7,
Marina Zenkova
2 and
Dmitry Stetsenko
1,3,*
1
Department of Physics, Novosibirsk State University, 630090 Novosibirsk, Russia
2
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia
3
Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, 63090 Novosibirsk, Russia
4
Tropical Biosphere Research Center, University of the Ryukyus, Okinawa 903-0213, Japan
5
Skolkovo Institute of Science and Technology, Innovation Centre Skolkovo, 121205 Moscow, Russia
6
Department of Chemistry, Lomonosov Moscow State University, 119991 Moscow, Russia
7
Department of Biological & Environmental Chemistry, Kindai University, Iizuka, Fukuoka 820-8555, Japan
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to the manuscript.
Appl. Sci. 2021, 11(3), 1174; https://doi.org/10.3390/app11031174
Submission received: 8 December 2020 / Revised: 22 January 2021 / Accepted: 24 January 2021 / Published: 27 January 2021
(This article belongs to the Special Issue Nucleic Acids Conjugates for Biotechnological Applications)
Browse Figures
Versions Notes

Abstract

:
New lipid conjugates of DNA and RNA incorporating one to four [(4-dodecylphenyl)sulfonyl]phosphoramidate or (hexadecylsulfonyl)phosphoramidate groups at internucleotidic positions near the 3′ or 5′-end were synthesized and characterized. Low cytotoxicity of the conjugates and their ability to be taken up into cells without transfection agents were demonstrated. Lipid-conjugated siRNAs targeting repulsive guidance molecules a (RGMa) have shown a comparable gene silencing activity in PK-59 cells to unmodified control siRNA when delivered into the cells via Lipofectamine mediated transfection.

1. Introduction

Nucleic acid derivatives such as antisense oligonucleotides or small interfering RNAs (siRNAs) are extensively studied as therapeutic agents that target biologically important RNAs; either mRNAs or noncoding RNAs such as micro-RNAs via either enzyme-mediated RNA cleavage [1,2,3] or steric blocking of RNA function [4,5]. While the former may be applicable to a wide range of diseases including some genetic disorders [6], cancer [7], viral [8] and bacterial [9] infections, where the target RNA can be eliminated, the latter is often employed where a fine tuning of the RNA activity is required such as in splice switching [10]. The progress in the development of oligonucleotide-based therapies in the past few years has resulted in the recent approval of several antisense and siRNA drugs by the FDA and EMA [11]. However, widespread application of therapeutic oligonucleotides still suffers from their relatively inefficient cellular uptake and often poor bioavailability [12,13]. The ways of promoting cellular delivery of oligonucleotides and their analogues include their structural modification [14,15], noncovalent binding [16] or covalent conjugation [17,18] to the molecules that could improve translocation through the outer membrane and direct intracellular trafficking of nucleic acids. Among these, lipids in a wider sense including biomolecules such as cholesterol, tocopherol (vitamin E) or fatty acids, and their synthetic analogues such as, e.g., DOTMA [19] have been shown to improve cellular uptake of oligonucleotides, most relevantly, in the form of lipid-oligonucleotide conjugates (LONs) [20,21,22].
In particular, lipid conjugates of antisense oligonucleotides and siRNAs have improved transfection ability and extended half-life in the bloodstream with beneficial impact on therapeutic activity in vivo [23,24,25]. We describe herein a series of novel DNA and RNA lipid conjugates, which have been chemically modified by one to four long-chain N-(sulfonyl)phosphoramidate groups, namely, [(4-dodecylphenyl)sulfonyl]-phosphoramidate group (δ) or (hexadecylsulfonyl)phosphoramidate group (η) at the internucleotidic position(s) near the 3′- or 5′-end of the oligonucleotide chain (Figure 1). The oligonucleotides were obtained by an automated phosphoramidite solid-phase synthesis protocol that employs the Staudinger reaction between the support-bound phosphite triester and the respective sulfonyl azide instead of usual aqueous iodine oxidation to introduce either of the lipophilic modifications following a previously developed procedure [26,27,28].
The obtained lipid conjugates of oligodeoxyribonucleotides with one or two of the respective hydrophobic groups were nearly non-cytotoxic for either murine or human macrophages up to 20 μM concentration. Both types of lipid conjugates were able to enter the cells in a carrier free manner. Both features are beneficial for potential therapeutic application. The corresponding lipid conjugates of siRNAs with either two or four hydrophobic groups were designed to downregulate a validated target in multiple sclerosis, namely, repulsive guidance molecule a (RGMa) [29]. The conjugates with two groups were shown to possess silencing ability comparable to the unmodified siRNA when delivered by lipofectamine. This type of lipid conjugate may represent a useful addition to the inventory of therapeutic oligonucleotide derivatives.

2. Materials and Methods

2.1. Oligonucleotide Synthesis

Oligodeoxynucleotides and siRNAs containing ((4-dodecylphenyl)sulfonyl)phosphoramidate (δ) or (hexadecylsulfonyl)phosphoramidate (η) groups were assembled by automated solid-phase synthesis on a Mermaid MM-12 DNA/RNA synthesizer according to a modified β-cyanoethyl phosphoramidite protocol replacing aqueous iodine oxidation by a Staudinger reaction with either 4-dodecylbenzenesulfonyl azide or 1-hexadecanesulfonyl azide (0.5 M in acetonitrile for (δ) or in acetonitrile—THF (2:1 v/v) for (η), 120 min at ambient temperature) in an appropriate cycle of chain elongation [27,28]. Standard N-protected 5′-DMTr-3′-β-cyanoethyl-N,N’-phosphoramidites of deoxy, 2′-O-TBDMS-ribo and 2′-O-methylribonucleotides (Sigma-Aldrich Inc., St Louis, MO, USA) and 1000 Å CPG polymer supports (Glen Research Corp, Sterling, VA, USA) were used. After the completion of the synthesis, oligonucleotides were cleaved from support and deprotected by standard procedures followed by consecutive PAGE and RP-HPLC purification as described previously [30]. Molecular masses of the oligonucleotides were verified by ESI LC-MS (Table 1).
4-Dodecylbenzenesulfonyl azide was obtained from a commercial supplier (Sigma-Aldrich Inc., St Louis, MO, USA). 1-Hexadecanesulfonyl azide was prepared from the corresponding sulfonyl chloride and a slight excess of sodium azide in acetonitrile—THF (1:1 v/v) as a white solid as described in [31]. IR, 1H and 13C NMR spectra of the compound were consistent with the structure.

2.2. Dynamic Light Scattering (DLS) Characterization

Lipid-oligonucleotide conjugates (LONs) were analyzed at room temperature by dynamic light scattering (DLS) using a Zetasizer Nano ZS90 (Malvern Instruments Ltd., Malvern, UK). Size was measured in a DTS0012 cuvette (Malvern Instruments Ltd., Malvern, UK). All the scattered photons were collected at a 173° scattering angle. Measurement conditions were: material protein (RI: 1.450; Absorption: 0.001), dispersant water (Viscosity: 0,8872 cP; RI: 1.330) temperature at 25 °C and equilibration time was 3 s. Each test was triplicated. Nanoparticle size was determined in deionized water at 5 μM oligonucleotide concentration. The scattering intensity data was processed using the instrumental software to obtain the hydrodynamic diameter (Dh).

2.3. Cell Lines

RAW 264.7 cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich Inc., St Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GE Healthcare, Chicago, IL, USA) and 1% antibiotic/antimycotic mix (100 unit/mL penicillin, 0.1 mg/mL streptomycin and 0.25 μg/mL amphotericin) at 37 °C in a humidified atmosphere with 5% CO2 (standard conditions, SC) and passaged regularly to maintain exponential growth.
THP-1 cells were cultivated in Roswell Park Memorial Institute (RPMI) medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS, 1% antibiotic/antimycotic mix (100 unit/mL penicillin, 0.1 mg/mL streptomycin and 0.25 μg/mL amphotericin), 1% GlutaMAX (Thermo Fisher Scientific, Waltham, MA, USA), 1% HEPES (Thermo Fisher Scientific, Waltham, MA, USA) and 1% glucose (Sigma-Aldrich Inc., St Louis, MO, USA) under SC and passaged regularly to maintain exponential growth.
To generate human macrophages (Mφ) THP-1 cells were cultivated in complete RPMI medium in the presence of 200 nM PMA (Sigma-Aldrich Inc., St Louis, MO, USA) under SC for 48 h. Then, the culture medium was replaced with complete RPMI medium in the absence of PMA and cells were incubated for an additional 24 h under SC.
PK-59 human pancreatic cancer cells were cultivated in complete RPMI-1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) under SC and passaged regularly to maintain exponential growth.

2.4. MTT Assay of Cell Viability

RAW264.7 cells were seeded in 96-well plates at a density of 5 × 103 cells/well in complete DMEM and incubated for 24 h under SC to adhere. THP-1 cells were seeded in 96-well plates at a density of 50 × 103 cells/well in complete DMEM medium supplemented with 200 nM PMA and incubated for 72 h under SC to generate human Mφ as described above. Then, RAW264.7 and Mφ cells were incubated in the corresponding complete culture media supplemented with 5, 10 and 20 μM of the respective lipid-oligonucleotide conjugate (LON) for an additional 24 h under SC. Cytotoxicity of LONs was assessed by MTT assay. Briefly, MTT solution (Sigma-Aldrich, Darmstadt, Germany) was added to the cells up to 0.5 mg/mL and the incubation was continued under SC for an additional 2 h. Then, the MTT-containing medium was aspirated and the formazan crystals formed in living cells were solubilized with 100 μL/well of DMSO. The absorbance of each well was read at the test and reference wavelengths (λ) of 570 and 620 nm, respectively, on a Multiscan RC plate reader (Thermo LabSystems, Helsinki, Finland). The percentage of living cells was calculated as follows:
Living cells (%) = (OD570exp − OD620exp)/(OD570cont − OD620cont) × 100,
where OD570exp and OD570cont correspond to optical density in experimental and control wells, respectively, at λ 570 nm, and OD620exp and OD620cont correspond to optical density in experimental and control wells, respectively, at λ 620 nm. All experimental points were run in triplicate for statistical analysis.

2.5. Flow Cytometry

Intracellular accumulation of the lipid-oligonucleotide conjugates labeled with fluorophores, namely δ-Flu, 2δ-Flu, η-Flu and 2η-Flu, was assessed in RAW264.7 and human Mφ by flow cytometry. RAW264.7 cells were seeded into 24-well plates at a density of 80 × 103 cells/well in complete DMEM and cultivated overnight to adhere. THP-1 cells were seeded into 24-well plates at a density of 100 × 103 cells/well in complete RPMI medium supplemented with 200 nM PMA and incubated for 72 h under SC to generate human Mφ as described above. Subsequently, RAW 264.7 and Mφ were incubated in the corresponding complete media supplemented with 5 μM of the respective lipid-oligonucleotide conjugate under SC for 24 h. After incubation, cells were detached from the plate with 2% trypsin (MP Biomedicals, Irvine, CA, USA), resuspended in a complete culture medium, centrifuged at 200× g for 5 min, washed with PBS and fixed with 2% formaldehyde in a PBS buffer (10 min, room temperature). Cells were analyzed on a NovoCyte flow cytometer (ACEA Biosciences, Santa Clara, CA, USA) and the data were processed with a NovoExpress (ACEA Biosciences, Santa Clara, CA, USA). All experiments were run in triplicate for statistical analysis. The transfection efficiency (TE) was characterized by two values: percentage of fluorescence-positive cells in a population and mean fluorescent intensity (MFI) of cells in a sample.

2.6. Confocal Microscopy

RAW264.7 cells were seeded on coverslips (Marienfeld, Lauda-Königshofen, Germany) in 24-well plates at a density of 20 × 103 cells/well in complete DMEM medium and incubated for 24 h under SC to adhere. THP-1 cells were seeded on coverslips in 24-well plates at a density of 100 × 103 cells/well in complete RPMI medium supplemented with 200 nM PMA to obtain human Mφ as described above. Afterwards, RAW 264.7 cells and human Mφ were incubated in the corresponding complete media in the presence of 5 μM of the respective lipid-oligonucleotide conjugates under SC for 24 h. After incubation, coverslips with cells were washed twice with PBS, fixed with 3.7% formaldehyde in PBS buffer (15 min, 37 °C), and washed twice with PBS. The cells were stained with the Phalloidin-iFluor532 (Abcam, Cambridge, UK) or Phalloidin-TRITC (ECM Biosciences, Versailles, KY, USA) according to the manufacturer’s protocols. After staining, the cells were washed twice with PBS and placed on slides in a drop of ProLongTM Glass Antifade Mountant with NucBlueTM (Thermo Fisher Scientific, Waltham, MA, USA). Mounted samples were allowed to cure on a flat, dry surface for 18–24 h at room temperature in the dark. Intracellular localization of lipid-oligonucleotide conjugates was assessed by confocal fluorescent microscopy on an LSM710 (Zeiss, Oberkochen, Germany) using an αPlan-Apochromat 100x/1.46 Oil DIC M27 objective. Analysis of intracellular accumulation of LONs and Z-stacks was performed using ZEN software (Zeiss, Oberkochen, Germany). Confocal microscopic analysis was performed in three channels (blue, green, red). Fluorescence in the blue channel corresponded to DAPI (nuclei staining); the green channel corresponded to fluorescence of LONs labeled with fluorescein (Flu), and the red channel corresponded to Phalloidin-iFluor532 or Phalloidin-TRITC (cytoskeleton staining).

2.7. Gene Silencing

Experiments on siRNA-mediated silencing of repulsive guidance molecule a (RGMa) were carried out in the RGMa-expressing PK-59 human pancreatic cancer cell line. On the day of transfection, PK-59 cells were separately seeded in 24-well flat-bottomed plates at a density of 4 × 105 cells/well in 0.5 mL of growth medium without antibiotics. The cells were transfected with lipid-conjugated RGMa siRNAs carrying either two (passenger strand only) or four (both passenger and antisense strands) dodecylphenyl (Δ) or hexadecyl (H) groups at their 3’-end, or unmodified control RGMa siRNA (Table 1) at concentrations 1, 10, or 100 nM in a complex with Lipofectamine® 2000 (2 μL/well) according to the manufacturer’s instructions (Invitrogen Life Technologies Corporation, Frederick, MD, USA). The cells were then incubated at 37 °C in the atmosphere of 5% CO2 in a humidified incubator. Cells were harvested and assayed 24 h after transfection.
The level of RGMa expression was quantified by real-time, two-step reverse transcriptase PCR (qRT-PCR) assay. Briefly, total RNA was extracted from the collected cells using ISOGNE (Nippon Gene, Ltd., Toyama, Japan), treated with DNase I® (ThermoFisher Scientific, Waltham, MA, USA) and retro-transcribed using Oligo (dT)20 primer and ReverTra Ace® (Toyobo Co., Ltd., Japan). The resulting cDNA was quantified using the AriaMx Real-Time PCR System® (Agilent Technologies, Ltd., Santa Clara, CA, USA) using the following primers: 5′–TGGCCGCTCATCGACAATAA–3′, forward; and 5′–GCTTGTCCCCACCGTTCTTA–3′, reverse. Quantifications of RGMa mRNA expressions were normalized by the Comparative Ct Method (Ct) using 18S rRNA as an endogenous control to ensure accuracy; primers: 5′–GTAACCCGTTGAACCCCATT–3′, forward; and 5‘–CCATCCAATCGGTAGTAGCG–3′, reverse [32]. All the data are the means of triplicate determinations. Each determination was calculated from triplicate measurements. Each error bar indicates a standard deviation of the triplicate determinations. Non-silencing siRNA targeting EGFP was used as a negative control, which was designed to have a minimum of 4 mismatches to all human, mouse and rat genes, and confirmed to have minimal targeting by genome-wide microarray analysis [33]. Significant differences in the results were determined by the two-tailed Student’s t-test using GraphPad Prism. A probability value of p < 0.05 was considered to be significant in the present study.

3. Results

3.1. Synthesis of Lipid-Oligonucleotide Conjugates (LONs) Incorporating Long-Chain (Sulfonyl)Phosphoramidate Groups

The synthesis of lipid conjugates of oligodeoxynucleotides having one or two ((4-dodecylphenyl)sulfonyl)phosphoramidate (δ) or (hexadecylsulfonyl)phosphoramidate (η) modifications of the phosphate linkages adjacent to the 5′-end (Figure 1A) was accomplished according to our previously reported protocols of automated solid-phase assembly via the phosphoramidite method employing the Staudinger reaction of the support-bound phosphite triester formed during the phosphoramidite coupling with 0.5 M solution of either 4-dodecylbenzenesulfonyl azide or 1-hexadecanesulfonyl azide in acetonitrile for 120 min at ambient temperature instead of the usual aqueous iodine oxidation [23,24]. Oligonucleotides containing 5’-dimethoxytrityl group (DMTr) were isolated by reverse-phased (RP) HPLC or, if necessary, purified to homogeneity by denaturing PAGE under the same conditions as normal phosphodiester oligodeoxynucleotides, followed by RP-HPLC to remove phosphodiester impurities. The molecular masses of the δ- and η-oligodeoxynucleotides obtained have been verified by ESI LC-MS (Table 1).
Sequences of siRNAs targeting RGMa mRNA were obtained from literature [25]. Lipid-siRNA conjugates containing 2–4 dodecylphenyl (δ) or hexadecyl (η) groups in the antisense and/or passenger chains were prepared according to the method above (Table 1). The 3′-overhangs of the siRNAs were modified by 2’-O-methyl diribonucleotides to increase enzymatic stability and avoid possible side reactions associated with the neighboring 2′-OH group when sulfonyl phosphoramidate groups were introduced into the overhang and at the 3′-terminal phosphate group (Figure 1B).

3.2. Spontaneous Nanoparticle Formation by LONs in Aqueous Media

As amphiphiles, lipid-oligonucleotide conjugates (LONs) can be expected to spontaneously form micelles in aqueous solutions. Indeed, dynamic light scattering (DLS) analysis revealed that both 2δ and 2η LONs formed nanoparticles in water characterized by mean diameters of 21.6 ± 8.8 and 79.7 ± 16.4 nm for 2η and 2δ, respectively (Figure 2). Interestingly, longer aliphatic chain (16-carbon vs. 12-carbon) at the internucleotidic position favored the formation of smaller nanoparticles, which may be responsible for a better cellular uptake of a more hydrophobic 2η LON (Figure 2).

3.3. LONs were Nontoxic to Murine or Human Macrophages at Therapeutic Concentrations

Introduction of lipophilic moieties into oligonucleotide chains can alter such properties of LONs as cyototoxicity. Cytotoxicity of the most hydrophobic LONs, namely, 2δ and 2η, was analyzed with respect to murine RAW264.7 and human THP-1-derived macrophages. Cells were incubated in complete media supplemented with different concentrations of one of LONs for 24 h followed by estimation of cell viability using colorimetric MTT assay. As depicted in Figure 3, both 2δ and 2η oligonucleotides were nontoxic to murine and human macrophages. IC50 obtained by extrapolation of dose-response curves ranged from 74 to 120 µM for 2δ and from 77 to 85 µM for 2η oligonucleotides, whereas the working concentration of LONs in subsequent experiments was chosen to be 5 µM. It is worth mentioning that murine macrophages were more sensitive to LONs in comparison with human THP-1-derived macrophages (IC50 were 74.2 ± 29.6 µM and 120.3 ± 31.6 µM for 2δ oligonucleotides, respectively; 77.0 ± 9.2 µM and 84.6 ± 17.2 µM for 2η oligonucleotides, respectively) (Figure 3).

3.4. Conjugates with Longer Lipidic Chains Accumulated in Cells with Higher Efficiency

The ability of LONs to accumulate in eukaryotic cells in the absence of a transfection agent (gymnosis) was studied by flow cytometry using fluorescein-labeled LONs and murine macrophages RAW264.7 or THP-1-induced human macrophages. The efficiency of intracellular accumulation of LONs was assessed by two parameters: the number of fluorescein-positive cells in the population and average level of the conjugate content in the cells (mean fluorescence intensity, MFI).
Accumulation of LONs in RAW264.7 and THP-1-induced macrophages differed considerably. LONs accumulated in RAW264.7 cells with moderate efficiency: 20–50% of cells were transfected with a MFI of 6–11 × 103 RFU (Figure 4A,B). As expected, the cells incubated and control oligonucleotide ODN-F displayed the lowest efficiency: 10% of fluorescent cells with MFI of 4 × 103 RFU, which corresponded to the baseline level of oligonucleotide taken up by the macrophages and/or adhered to the cell surface. We observed that more hydrophobic LONs, that is, the ones containing either two hydrocarbon chains instead of only one, or those having a longer aliphatic group: hexadecyl instead of dodecylphenyl, were showing more efficient accumulation in RAW264.7 cells (Figure 4A,B: compare conjugates having two vs. one group, and η- vs. δ-modified LONs) than their less hydrophobic counterparts and unmodified control ODN-F.
A similar but much more prominent accumulation of lipid-conjugated oligodeoxynucleotides was observed in human THP-1-induced macrophages. LONs accumulated in these cells with higher efficiency both in terms of the number of transfected cells and mean fluorescence intensity (Figure 4C,D). Conjugates 1δ-F and 1η-F containing one lipophilic group displayed similar transfection efficiency regardless of the type of lipid chains, either dodecylphenyl (δ) or hexadecyl (η): 43% cells were transfected with MFI of 8 × 103 RFU, which was fourfold higher as compared to the control ODN-F (Figure 4C,D). Increasing the number of lipophilic groups from one to two resulted in a significant enhancement of transfection efficiency. 2δ LON yielded 85% cells with fluorescence intensity 25 × 103 RFU whereas 2η conjugate was taken up with the highest efficiency, accumulating in nearly 100% cells with fluorescence intensity 150 × 103 RFU (Figure 4C,D), which is on par with the level achieved by liposome-mediated oligonucleotide delivery [34].

3.5. Lipid-Oligonucleotide Conjugates are Efficiently Taken up by Cells in the Absence of Transfection Agents and Localize Mostly in the Cytoplasm within Endosomes

Confocal microscopic analysis was carried out to verify and characterize intracellular localization of LONs. RAW 264.7 and human THP-1-induced macrophages were incubated with 5.0 μM fluorescein-labeled LONs in complete medium for 24 h. After incubation, cells were stained with Phalloidin-iFluor532 or Phalloidin-TRITC (actin microfilaments) and NucBlue (nuclei) (Figure 5, Figure 6 and Figure 7).
Firstly, to prove that LONs do not expose on the cell membranes but do penetrate into the cells, confocal microscopic analysis was performed and Z-stack images were built. It was demonstrated that LON 2η, the most efficient one according to flow cytometry data, was indeed localized in the cytosol of RAW264.7 cells and THP-1-induced macrophages (Figure 5). In addition, LON 1η was shown to efficiently accumulate in KB-8-5 cells (see Supplementary Materials, Figure S4).
It can be seen that the efficiency of intracellular accumulation of LONs according to confocal microscopy (Figure 6 and Figure 7) correlate well with the obtained flow cytometry data (Figure 4). Oligonucleotides containing two lipophilic groups accumulated in cells with much higher efficiency in comparison with LONs containing only one group, LON 2η with two hexadecyl groups being the best penetrator. LONs 1δ-F and 1η-F containing only one lipophilic modification accumulated in cells with efficiency not significantly higher than that of the control unmodified oligonucleotide ODN-F. However, these LONs penetrated into the cells whereas ODN-F mainly adhered to the cell membrane (Figure S5, Supplementary Materials).
In detail, LONs were evenly distributed in the cytosol, localizing mainly in endosomes; this was conjectured from the presence of numerous bright green fluorescent dots containing LONs in the cytosol of both cell lines tested (Figure 6 and Figure 7).

3.6. Lipid-Conjugated RGMa siRNAs Demonstrated Gene-Silencing Ability Similar to Unmodified RGMa siRNA in PK-59 Human Pancreatic Carcinoma Cell Culture

The gene silencing ability of lipid-conjugated siRNAs in comparison with unconjugated siRNA was elucidated in human pancreatic carcinoma PK-59 cells expressing repulsive guidance molecule a (RGMa). RGMa is a glycoprotein, which is a potent inhibitor of axonal re-myelination and, thus, is regarded as a potential therapeutic target for multiple sclerosis (MS) treatment [35]. Inhibition of RGMa by human monoclonal antibodies promotes neuronal regeneration and repair [36]. RGMa siRNA sequence was obtained from literature [29]. Lipid-conjugated RGMa siRNAs were modified at the 3’-end by either two (passenger strand only) or four (both passenger and antisense strands) dodecylphenyl (Δ) or hexadecyl (H) groups. To compare silencing activity under similar conditions, transfection was carried out at concentrations of siRNA 1, 10 and 100 nM in the presence of Lipofectamine® 2000. The levels of RGMa expression as assessed by RT-PCR are shown in Figure 8.
The gene silencing effect of siRNA conjugates 2Δ-RGMa and 2H-RGMa that carried two lipophilic groups at the 3’-end of the passenger strand was comparable to that of the unconjugated RGMa siRNA at a concentration of 100 nM. At the same time, the activity of the conjugates 4Δ-RGMa and 4H-RGMa containing four lipophilic groups at both 3′-ends of passenger and antisense strands was reduced as compared to the unmodified control siRNA.

4. Discussion

A previously developed methodology of Staudinger reaction-mediated in-line oligonucleotide modification [26,27,28] was employed herein to obtain lipophilic conjugates of oligodeoxynucleotides and siRNAs carrying one or more extended hydrocarbon chains, 4-dodecylphenyl or hexadecyl, attached to the internucleotidic phosphate groups via the (sulfonyl)phosphoramidate linkage, which is hydrolytically stable and carries negative charge under physiological conditions (Figure 1A,B). The scheme allows one to modify any internucleotidic or terminal phosphate group within a DNA or 2′-OMe RNA chain from the 5′– to 3′–end by a facile chemical reaction with a stable sulfonyl azide precursor during automated DNA/RNA assembly without recourse to a special phosphoramidite monomer, which is usually obtained by a multi-step synthesis [18,20,21]. The obtained lipid-oligonucleotide conjugates (LONs) can be conveniently isolated by the usual C18 reverse-phased HPLC, due to significant difference in retention times with unmodified oligonucleotides (see Supplementary Materials) for HPLC profiles and ESI-MS spectra). Our preliminary data have shown that such lipophilic groups are fully compatible with other phosphate group modifications such as phosphorothioate, mesyl phosphoramidate [27,37,38] and phosphoryl guanidine [39].
Notably, we have observed spontaneous nanoparticle formation in aqueous solution by LONs containing two adjacent hydrophobic chains, with nanoparticle size dependent on the type of the side-chain (Figure 2). Nanoparticle formation by oligonucleotides is thought to be essential for good cellular uptake [40], structured RNA studies [41] and design of stimuli-responsive drug delivery systems [42].
Low cytotoxicity is another beneficial characteristic of such LONs, which allows one to vary the concentration of an oligonucleotide over a wide range to optimize its therapeutic dosage for further in vitro and in vivo studies. We have confirmed that LONs used in this study evinced low cytotoxicity. Calculated IC50 of studied LONs fell within the 75 to 120 µM range, which was significantly higher than concentrations of antisense oligonucleotides targeting therapeutically relevant RNAs commonly used in vitro and in vivo: nanomolar concentrations [43,44,45,46] or <5 µM [47] or therapeutic doses of siRNAs and antisense oligonucleotides approved by FDA and EMA for clinical practice: for siRNAs 21 nmol/kg for Patisiran [48] and 153 nmol/kg for Givosiran [49]; for antisense oligonucleotides <5 µmoles/kg for Golodirsen [50], Volanesorsen [51] and Inotersen [52]. It is worth noting that the increase in hydrophobicity of the conjugates have no influence on their cytotoxicity (Figure 3). This result prompts us to expect that the increase of the number of side-chains or introduction of more hydrophobic groups, for example, hydrocarbon chains longer than 16 carbon atoms into LONs will not increase significantly the overall cytotoxicity of conjugates.
We demonstrated that LONs accumulated in the cells with intracellular distribution analogous to that of oligonucleotides delivered by liposomal formulations (Figure 4 and Figure 5) [53,54,55]. It appears that LONs penetrated through the outer membrane and localized in cytosol predominantly in endosomes 24 h after addition (Figure 6 and Figure 7). It is known that endosomal escape of therapeutic oligonucleotides is one of the rate-limiting steps of their delivery and the key to successful intracellular performance of nucleic acid therapeutics [56]. Although longer term kinetics of LON accumulation (>24 h) was not studied, it can be assumed that such LONs will require longer times for their endosomal escape, similarly to cholesterol-conjugated siRNAs [57].
Cytoplasmic distribution of the developed LONs may be advantageous as far as the targets of therapeutic oligonucleotides (antisense oligonucleotides, siRNAs and anti-miRs) are localized in the cytosol such as mRNAs and many miRNAs. Application of the developed LONs to modulate splicing of pre-mRNA requires additional investigation including optimization of the number and length of the side-chains, selection of optimal delivery conditions etc. to achieve nuclear delivery of the conjugates. We demonstrated that dodecylphenyl and hexadecyl modifications did not significantly impede gene-silencing activity of lipophilic siRNAs delivered into cells by Lipofectamine (Figure 8). However, further studies on elucidating a wider spectrum of biological activities of siRNAs and antisense oligonucleotides carrying such (sulfonyl)phosphoramidate-based lipophilic groups are required.
One potential application for lipid-oligonucleotide conjugates as described herein could be the design of therapeutic oligonucleotides for the treatment of multiple sclerosis (MS), a severe neurodegenerative disease characterized by the destruction of the myelin sheaths of neurons [58]. Kitayama et al. [29] uncovered a link between the destruction of axonal myelin sheaths during MS and repulsive guidance molecule a (RGMa): a glycoprotein, which is a powerful inhibitor of neuronal regeneration. Inhibition of RGMa by human monoclonal antibodies stimulate re-myelination and regeneration of damaged neurons in the laboratory in vivo model of MS [36]. Thus, reducing the level of RGMa by downregulation of the corresponding gene by antisense oligonucleotide or siRNA could be a promising strategy for therapeutic intervention in MS.
We studied RGMa inhibition in the RGMa-expressing PK-59 pancreatic cancer cell line using lipid-siRNA conjugates containing either two or four dodecylphenyl or hexadecyl chains at the 3′-end of one or both of the complementary RNA strands, respectively (Figure 1B; Table 1). It was evident that siRNA conjugates containing two adjacent lipid groups in the passenger strand were able to downregulate RGMa mRNA with a similar efficiency to that of the unmodified control RGMa siRNA at 100 nM concentration while those carrying four of either dodecylphenyl or hexadecyl groups were significantly inferior (Figure 8). We foresee that such therapeutic lipid-oligonucleotide conjugates (LONs) displaying low toxicity and improved cellular uptake may demonstrate high efficiency and minimal side effects in future experiments in vivo.

5. Conclusions

To conclude, we have obtained lipid conjugates of oligodeoxynucleotides and siRNAs carrying one, two or four hydrophobic ((4-dodecylphenyl)sulfonyl)phosphoramidate or (hexadecylsulfonyl)phosphoramidate groups at either 5′- or 3′-internucleotidic positions by a modified protocol of the phosphoramidite synthesis replacing usual aqueous iodine oxidation by the Staudinger reaction between a solid-supported phosphite triester and the corresponding long-chain sulfonyl azide.
The oligodeoxynucleotide conjugates were characterized by low cytotoxicity in either murine or human macrophages and improved cell uptake into the same in the absence of a transfection agent. Spontaneous formation of nanoparticles was observed in aqueous solutions of doubly-conjugated oligonucleotides having either of the two lipophilic modifications at the 5′-end, which may be responsible for the improved cellular uptake of the respective conjugates. Notably, the size of the nanoparticles decreased with the increase in the length of the hydrocarbon chain from dodecylphenyl to hexadecyl. Flow cytometry revealed the superior uptake of hexadecyl conjugates over the dodecyl ones into human macrophages. Intracellular localization of the conjugates according to confocal microscopy was predominantly cytosolic with the majority of the fluorescence within endosomes.
Finally, two adjacent lipophilic dodecylphenyl or hexadecyl groups placed within the 3’-terminal overhang and at the 3′-terminal phosphate of the passenger strand did not significantly impair the gene-silencing ability of siRNAs targeting repulsive guidance molecule (RGMa) mRNA in PK-59 cell culture, whereas the siRNAs carrying four of the same at the 3′-ends of both passenger and antisense strands were considerably less active. Thus, lipid-siRNA conjugates with optimized number and position of the lipid chains could be a prospective candidate for future experiments in an in vivo model of multiple sclerosis and, potentially, other diseases when RNA targeting is applicable.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-3417/11/3/1174/s1, Figures S1–S3: IR, 1H and 13C spectra of 1-hexadecanesulfonyl azide; reverse-phased HPLC profiles and ESI mass spectra of modified oligonucleotides, Figure S4: Intracellular accumulation of η-F conjugate in KB-8-5 cells, Figure S5: Intracellular accumulation of δ-F and η-F conjugates in RAW264.7 cells and THP-1-induced macrophages.

Author Contributions

The first three authors (A.D., O.M. and A.F.) made equal contributions to the work. Conceptualization, D.S.; methodology, M.Z., M.F., D.S. and T.Z.; software, O.M.; validation, D.S., M.F. and M.Z.; formal analysis, O.M. and Y.S.; investigation, A.D. and Y.S.; resources, M.Z. and T.Z.; data curation, O.M., A.F. and Y.S.; writing—original draft preparation, O.M. and D.S.; writing—review and editing, O.M., M.Z. and D.S.; visualization, O.M. and A.D.; supervision, O.M. and A.F.; project administration, M.Z., M.F. and D.S.; funding acquisition, M.Z., D.S. and M.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Russian Science Foundation, grant No. 19-74-30011 (cytotoxicity, confocal microscopy, flow cytometry, dynamic light scattering), Russian Foundation for Basic Research, grant No. 18-515-57006 (siRNA synthesis), the Ministry of Science and Higher Education of the Russian Federation, project No. FSUS-2020-0035 to Novosibirsk State University (oligodeoxynucleotide synthesis), and Japan Medical Research Foundation, grant No. 2018JP002 (biological activity).

Data Availability Statement

Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Crooke, S.T. Molecular mechanisms of antisense oligonucleotides. Nucleic Acid Ther. 2017, 27, 70–77. [Google Scholar] [CrossRef]
  2. Shen, X.; Corey, D.R. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs. Nucleic Acids Res. 2018, 46, 1584–1600. [Google Scholar] [CrossRef]
  3. Smith, C.I.E.; Zain, R. Therapeutic Oligonucleotides: State of the Art. Annu. Rev. Pharmacol. Toxicol. 2019, 59, 605–630. [Google Scholar] [CrossRef] [PubMed]
  4. Evers, M.M.; Toonen, L.J.A.; van Roon-Mom, W.M.C. Antisense oligonucleotides in therapy for neurodegenerative disorders. Adv. Drug Deliv. Rev. 2015, 87, 90–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Aung-Htut, M.T.; McIntosh, C.S.; Ham, K.A.; Pitout, I.L.; Flynn, L.L.; Greer, K.; Fletcher, S.; Wilton, S.D. Systematic Approach to Developing Splice Modulating Antisense Oligonucleotides. Int. J. Mol. Sci. 2019, 20, 5030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Bennett, C.F.; Baker, B.F.; Pham, N.; Swayze, E.; Geary, R.S. Pharmacology of Antisense Drugs. Annu. Rev. Pharmacol. Toxicol. 2017, 57, 81–105. [Google Scholar] [CrossRef]
  7. Castanotto, D.; Stein, C.A. Antisense oligonucleotides in cancer. Curr. Opin. Oncol. 2014, 26, 584–589. [Google Scholar] [CrossRef]
  8. Wagner, A.; Bock, C.T.; Fechner, H.; Kurreck, J. Application of modified antisense oligonucleotides and siRNAs as antiviral drugs. Future Med. Chem. 2015, 7, 1637–1642. [Google Scholar] [CrossRef]
  9. Hegarty, J.P.; Stewart, D.B. Advances in therapeutic bacterial antisense biotechnology. Appl. Microbiol. Biotechnol. 2018, 102, 1055–1065. [Google Scholar] [CrossRef]
  10. Shimo, T.; Maruyama, R.; Yokota, T. Designing Effective Antisense Oligonucleotides for Exon Skipping. In Duchenne Muscular Dystrophy. Methods and Protocols; Bernardini, C., Ed.; Humana Press: New York, NY, USA, 2018. [Google Scholar]
  11. Ma, C.-C.; Wang, Z.-L.; Xu, T.; He, Z.-Y.; Wei, Y.-Q. The approved gene therapy drugs worldwide: From 1998 to 2019. Biotechnol. Adv. 2020, 40, 107502. [Google Scholar] [CrossRef]
  12. Juliano, R.L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016, 44, 6518–6548. [Google Scholar] [CrossRef] [PubMed]
  13. Roberts, T.C.; Langer, R.; Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat. Rev. Drug. Discov. 2020, 19, 673–694. [Google Scholar] [CrossRef] [PubMed]
  14. Pattanayak, S.; Khatra, H.; Saha, S.; Sinha, S. A cationic morpholino antisense oligomer conjugate: Synthesis, cellular uptake and inhibition of Gli1 in the hedgehog signalling pathway. RSC Adv. 2014, 4, 1951–1954. [Google Scholar] [CrossRef]
  15. Hnedzko, D.; McGee, D.W.; Karamitas, Y.A.; Rozners, E. Sequence-selective recognition of double-stranded RNA and enhanced cellular uptake of cationic nucleobase and backbone-modified peptide nucleic acids. RNA 2017, 23, 58–69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Wang, M.; Wu, B.; Shah, S.N.; Lu, P.; Lu, Q. Polyquaternium-mediated delivery of morpholino oligonucleotides for exon-skipping in vitro and in mdx mice. Drug Deliv. 2017, 24, 952–961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Morcos, P.A.; Li, Y.; Jiang, S. Vivo-Morpholinos: A non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. Biotechniques 2018, 45, 613–623. [Google Scholar] [CrossRef]
  18. Craig, K.; Abrams, M.; Amiji, M. Recent preclinical and clinical advances in oligonucleotide conjugates. Expert Opin. Drug Deliv. 2018, 15, 629–640. [Google Scholar] [CrossRef]
  19. Ren, T.; Song, Y.K.; Zhang, G.; Liu, D. Structural basis of DOTMA for its high intravenous transfection activity in mouse. Gene Ther. 2000, 7, 764–768. [Google Scholar] [CrossRef] [Green Version]
  20. Patwa, A.; Gissot, A.; Bestel, I.; Barthélémy, P. Hybrid lipid oligonucleotide conjugates: Synthesis, self-assemblies and biomedical applications. Chem. Soc. Rev. 2011, 40, 5844–5854. [Google Scholar] [CrossRef]
  21. Zhao, B.; Tian, Q.; Bagheri, Y.; You, M. Lipid–oligonucleotide conjugates for simple and efficient cell membrane engineering and bioanalysis. Curr. Opin. Biomed. Eng. 2020, 13, 76–83. [Google Scholar] [CrossRef]
  22. Li, X.; Feng, K.; Li, L.; Yang, L.; Pan, X.; Yazd, H.S.; Cui, C.; Li, J.; Moroz, L.; Sun, Y.; et al. Lipid-oligonucleotide conjugates for bioapplications. Nat. Sci. Rev. 2020, 7, 1933–1953. [Google Scholar] [CrossRef]
  23. Osborn, M.F.; Khvorova, A. Improving siRNA Delivery In Vivo Through Lipid Conjugation. Nucleic Acid Ther. 2018, 28, 128–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Østergaard, M.E.; Jackson, M.; Low, A.; Chappell, A.E.; Lee, R.G.; Peralta, R.Q.; Yu, J.; Kinberger, G.A.; Dan, A.; Carty, R.; et al. Conjugation of hydrophobic moieties enhances potency of antisense oligonucleotides in the muscle of rodents and non-human primates. Nucleic Acids Res. 2019, 47, 6045–6058. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Chernikov, I.V.; Meschaninova, M.I.; Chernolovskaya, E.L. Preparation, Determination of Activity, and Biodistribution of Cholesterol-Containing Nuclease-Resistant siRNAs In Vivo. In RNA Interference and CRISPR Technologies. Technical Advances and New Therapeutic Opportunities; Sioud, M., Ed.; Humana Press: New York, NY, USA, 2020. [Google Scholar]
  26. Prokhorova, D.V.; Chelobanov, B.P.; Burakova, E.A.; Fokina, A.A.; Stetsenko, D.A. New oligodeoxyribonucleotide derivatives bearing internucleotide N-tosyl phosphoramidate groups: Synthesis and complementary binding to DNA and RNA. Russ. J. Bioorg. Chem. 2017, 43, 38–42. [Google Scholar] [CrossRef]
  27. Chelobanov, B.P.; Burakova, E.A.; Prokhorova, D.V.; Fokina, A.A.; Stetsenko, D.A. New oligodeoxynucleotide derivatives containing N-(methanesulfonyl)-phosphoramidate (mesyl phosphoramidate) internucleotide group. Russ. J. Bioorg. Chem. 2017, 43, 664–668. [Google Scholar] [CrossRef]
  28. Burakova, E.A.; Derzhalova, A.S.; Chelobanov, B.P.; Fokina, A.A.; Stetsenko, D.A. New Oligodeoxynucleotide Derivatives Containing N-(Sulfonyl)-Phosphoramide Groups. Russ. J. Bioorg. Chem. 2017, 45, 662–668. [Google Scholar] [CrossRef]
  29. Kitayama, M.; Ueno, M.; Itakura, T.; Yamashita, T. Activated Microglia Inhibit Axonal Growth through RGMa. PLoS ONE 2011, 6, e25234. [Google Scholar] [CrossRef]
  30. Farzan, V.M.; Ulashchik, E.A.; Martynenko-Makaev, Y.V.; Kvach, M.V.; Aparin, I.O.; Brylev, V.A.; Prikazchikova, T.A.; Maklakova, S.Y.; Majouga, A.G.; Ustinov, A.V.; et al. Automated Solid-Phase Click Synthesis of Oligonucleotide Conjugates: From Small Molecules to Diverse N-Acetylgalactosamine Clusters. Bioconjug. Chem. 2017, 28, 2599–2607. [Google Scholar] [CrossRef]
  31. Matano, Y.; Ohkubo, H.; Honsho, Y.; Saito, A.; Seki, S.; Imahori, H. Synthesis and Charge-Carrier Transport Properties of Poly(phosphole P-alkanesulfonylimide)s. Org. Lett. 2013, 15, 932–935. [Google Scholar] [CrossRef]
  32. Kamerkar, S.; LeBleu, V.S.; Sugimoto, H.; Yang, S.; Ruivo, C.F.; Melo, S.A.; Lee, J.J.; Kalluri, R. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature 2017, 546, 498–503. [Google Scholar] [CrossRef]
  33. Song, E.; Lee, S.K.; Wang, J.; Ince, N.; Ouyang, N.; Min, J.; Chen, J.; Lieberman, S.P. RNA interference targeting Fas protects mice from fulminant hepatitis. J. Nat. Med. 2003, 9, 347–351. [Google Scholar] [CrossRef] [PubMed]
  34. Markov, O.V.; Filatov, A.V.; Kupryushkin, M.S.; Chernikov, I.V.; Patutina, O.A.; Strunov, A.A.; Chernolovskaya, E.L.; Vlassov, V.V.; Pyshnyi, D.V.; Zenkova, M.A. Transport Oligonucleotides—A Novel System for Intracellular Delivery of Antisense Therapeutics. Molecules 2020, 25, 3663. [Google Scholar] [CrossRef] [PubMed]
  35. Kubo, T.; Tokita, S.; Yamashita, T. Repulsive guidance molecule-a and demyelination: Implications for multiple sclerosis. J. Neuroimmune Pharmacol. 2012, 7, 524–528. [Google Scholar] [CrossRef] [PubMed]
  36. Mothe, A.J.; Tassew, N.G.; Shabanzadeh, A.P.; Penheiro, R.; Vigouroux, R.J.; Huang, L.; Grinnell, C.; Cui, Y.F.; Fung, E.; Monnier, P.P.; et al. RGMa inhibition with human monoclonal antibodies promotes regeneration, plasticity and repair, and attenuates neuropathic pain after spinal cord injury. Sci. Rep. 2017, 7, 10529. [Google Scholar] [CrossRef] [PubMed]
  37. Miroshnichenko, S.K.; Patutina, O.A.; Burakova, E.A.; Chelobanov, B.P.; Fokina, A.A.; Vlassov, V.V.; Altman, S.; Zenkova, M.A.; Stetsenko, D.A. Mesyl phosphoramidate antisense oligonucleotides as an alternative to phosphorothioates: Improved biochemical and biological properties. Proc. Natl. Acad. Sci. USA 2019, 116, 1229–1234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Patutina, O.A.; Gaponova (Miroshnichenko), S.K.; Sen’kova, A.V.; Savin, I.A.; Gladkikh, D.V.; Burakova, E.A.; Fokina, A.A.; Maslov, M.A.; Shmendel’, E.V.; Wood, M.J.A.; et al. Mesyl phosphoramidate backbone modified antisense oligonucleotides targeting miR-21 with enhanced in vivo therapeutic potency. Proc. Natl. Acad. Sci. USA 2020, 117. in press. [Google Scholar] [CrossRef]
  39. Kupryushkin, M.S.; Pyshnyi, D.V.; Stetsenko, D.A. Phosphoryl Guanidines: A New Type of Nucleic Acid Analogues. Acta Nat. 2014, 6, 116–118. [Google Scholar] [CrossRef]
  40. Ezzat, K.; Aoki, Y.; Koo, T.; McClorey, G.; Benner, L.; Coenen-Stass, A.; O’Donovan, L.; Lehto, T.; Garcia-Guerra, A.; Nordin, J.; et al. Self-Assembly into Nanoparticles Is Essential for Receptor Mediated Uptake of Therapeutic Antisense Oligonucleotides. Nano Lett. 2015, 15, 4364–4373. [Google Scholar] [CrossRef] [Green Version]
  41. Deo, S.; Patel, T.R.; Dzananovic, E.; Booy, E.P.; Zeid, K.; McEleney, K.; Harding, S.E.; McKenna, S.A. Activation of 2′5′-Oligoadenylate Synthetase by Stem Loops at the 5′-End of the West Nile Virus Genome. PLoS ONE 2014, 9, e92545. [Google Scholar] [CrossRef] [Green Version]
  42. Awino, J.K.; Gudipati, S.; Hartmann, A.K.; Santiana, J.J.; Cairns-Gibson, D.F.; Gomez, N.; Rouge, J.L. Nucleic Acid Nanocapsules for Enzyme-Triggered Drug Release. J. Am. Chem. Soc. 2017, 139, 6278–6281. [Google Scholar] [CrossRef]
  43. Soutschek, J.; Akinc, A.; Bramlage, B.; Charisse, K.; Constien, R.; Donoghue, M.; Elbashir, S.; Geick, A.; Hadwiger, P.; Harborth, J.; et al. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 2004, 432, 173–178. [Google Scholar] [CrossRef] [PubMed]
  44. Karaki, S.; Benizri, S.; Mejías, R.; Baylot, V.; Branger, N.; Nguyen, T.; Vialet, B.; Oumzil, K.; Barthélémy, P.; Rocchi, P. Lipid-oligonucleotide conjugates improve cellular uptake and efficiency of TCTP-antisense in castration-resistant prostate cancer. J. Control. Release 2017, 258, 1–9. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, Y.; Zhu, F.; Liu, Y.; Zheng, M.; Wang, Y.; Zhang, D.; Anraku, Y.; Zou, Y.; Li, J.; Wu, H.; et al. Blood-brain barrier-penetrating siRNA nanomedicine for Alzheimer’s disease therapy. Sci. Adv. 2020, 6, eabc7031. [Google Scholar] [CrossRef] [PubMed]
  46. Sathyaprakash, C.; Manzano, R.; Varela, M.A.; Hashimoto, Y.; Wood, M.J.A.; Talbot, K.; Aoki, Y. Development of LNA Gapmer Oligonucleotide-Based Therapy for ALS/FTD Caused by the C9orf72 Repeat Expansion. In Gapmers: Methods and Protocols; Yokota, T., Maruyama, R., Eds.; Springer: New York, NY, USA, 2020; pp. 185–208. [Google Scholar]
  47. Scoles, D.R.; Meera, P.; Schneider, M.D.; Paul, S.; Dansithong, W.; Figueroa, K.P.; Hung, G.; Rigo, F.; Bennett, C.F.; Otis, T.S.; et al. Antisense oligonucleotide therapy for spinocerebellar ataxia type 2. Nature 2017, 544, 362–366. [Google Scholar] [CrossRef] [PubMed]
  48. Adams, D.; Gonzalez-Duarte, A.; O’Riordan, W.D.; Yang, C.C.; Ueda, M.; Kristen, A.V.; Tournev, I.; Schmidt, H.H.; Coelho, T.; Berk, J.L.; et al. Patisiran, an RNAi therapeutic, for hereditary transthyretin amyloidosis. N. Engl. J. Med. 2018, 379, 11–21. [Google Scholar] [CrossRef] [PubMed]
  49. Scott, L.J. Givosiran: First Approval. Drugs 2020, 80, 335–339. [Google Scholar] [CrossRef]
  50. Heo, Y.-A. Golodirsen: First Approval. Drugs 2020, 80, 329–333. [Google Scholar] [CrossRef]
  51. Paik, J.; Duggan, S. Volanesorsen: First Global Approval. Drugs 2019, 79, 1349–1354. [Google Scholar] [CrossRef]
  52. Keam, S.J. Inotersen: First Global Approval. Drugs 2018, 78, 1371–1376. [Google Scholar] [CrossRef]
  53. Remaut, K.; Lucas, B.; Braeckmans, K.; Demeester, J.; De Smedt, S.C. Pegylation of liposomes favours the endosomal degradation of the delivered phosphodiester oligonucleotides. J. Control. Release 2007, 117, 256–266. [Google Scholar] [CrossRef]
  54. Chen, J.; Yu, Z.; Chen, H.; Gao, J.; Liang, W. Transfection efficiency and intracellular fate of polycation liposomes combined with protamine. Biomaterials 2011, 32, 1412–1418. [Google Scholar] [CrossRef] [PubMed]
  55. Ara, M.N.; Matsuda, T.; Hyodo, M.; Sakurai, Y.; Hatakeyama, H.; Ohga, N.; Hida, K.; Harashima, H. An aptamer ligand based liposomal nanocarrier system that targets tumor endothelial cells. Biomaterials 2014, 35, 7110–7120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Varkouhi, A.K.; Scholte, M.; Storm, G.; Haisma, H.J. Endosomal escape pathways for delivery of biologicals. J. Control. Release 2011, 151, 220–228. [Google Scholar] [CrossRef] [PubMed]
  57. Petrova, N.S.; Chernikov, I.V.; Meschaninova, M.I.; Dovydenko, I.S.; Venyaminova, A.G.; Zenkova, M.A.; Vlassov, V.V.; Chernolovskaya, E.L. Carrier-free cellular uptake and the gene-silencing activity of the lipophilic siRNAs is strongly affected by the length of the linker between siRNA and lipophilic group. Nucleic Acids Res. 2012, 40, 2330–2344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Dobson, R.; Giovannoni, G. Multiple sclerosis—A review. Eur. J. Neurol. 2019, 26, 27–40. [Google Scholar] [CrossRef] [Green Version]
Applsci 11 01174 g001 550
Figure 1. Structures and positions of hydrophobic groups in lipid-oligonucleotide conjugates used in this study: oligodeoxynucleotide (A); small interfering RNA (siRNA) (B).
Figure 1. Structures and positions of hydrophobic groups in lipid-oligonucleotide conjugates used in this study: oligodeoxynucleotide (A); small interfering RNA (siRNA) (B).
Applsci 11 01174 g001
Applsci 11 01174 g002 550
Figure 2. Hydrodynamic diameters of nanoparticles formed spontaneously in water by 2δ (A) and 2η (B) lipid-oligonucleotide conjugates. Dynamic light scattering (DLS) data.
Figure 2. Hydrodynamic diameters of nanoparticles formed spontaneously in water by 2δ (A) and 2η (B) lipid-oligonucleotide conjugates. Dynamic light scattering (DLS) data.
Applsci 11 01174 g002
Applsci 11 01174 g003 550
Figure 3. Dose-response curves of 2δ and 2η LONs for RAW264.7 (A,B) and human THP-1 induced macrophages (C,D). Cells were incubated with LONs in a complete medium for 24 h. The results are shown as a percentage of viable cells observed after cell incubation with LON relative to untreated cells (100%). All experimental points were run in triplicate for statistical analysis. Data are presented as MEAN ± SD. The dotted curve shows extrapolation to 50% of viable cells.
Figure 3. Dose-response curves of 2δ and 2η LONs for RAW264.7 (A,B) and human THP-1 induced macrophages (C,D). Cells were incubated with LONs in a complete medium for 24 h. The results are shown as a percentage of viable cells observed after cell incubation with LON relative to untreated cells (100%). All experimental points were run in triplicate for statistical analysis. Data are presented as MEAN ± SD. The dotted curve shows extrapolation to 50% of viable cells.
Applsci 11 01174 g003
Applsci 11 01174 g004 550
Figure 4. Accumulation of fluorescein-labeled LONs in murine macrophages RAW264.7 (A,B) and THP-1-induced human macrophages (C,D). The percentage of fluorescent cells (A,C) and mean fluorescence intensity (B,D) were measured by flow cytometry 24 h post transfection. Data are presented as MEAN ± SD.
Figure 4. Accumulation of fluorescein-labeled LONs in murine macrophages RAW264.7 (A,B) and THP-1-induced human macrophages (C,D). The percentage of fluorescent cells (A,C) and mean fluorescence intensity (B,D) were measured by flow cytometry 24 h post transfection. Data are presented as MEAN ± SD.
Applsci 11 01174 g004
Applsci 11 01174 g005 550
Figure 5. Intracellular localization of 2η LON in murine macrophages RAW264.7 (A) and THP-1-induced human macrophages (B). Analysis was performed by confocal fluorescent microscopy (αPlan-Apochromat 100x/1.46 Oil DIC M27 objective) 24 h post transfection. Data are presented as orthogonal projections. Blue signal is DAPI (nuclear staining), green signal is fluorescein-labeled 2η LON, red signal is Phalloidin-iFluor532 (A) or Phalloidin-TRITC (B). Scale bar 10 μm.
Figure 5. Intracellular localization of 2η LON in murine macrophages RAW264.7 (A) and THP-1-induced human macrophages (B). Analysis was performed by confocal fluorescent microscopy (αPlan-Apochromat 100x/1.46 Oil DIC M27 objective) 24 h post transfection. Data are presented as orthogonal projections. Blue signal is DAPI (nuclear staining), green signal is fluorescein-labeled 2η LON, red signal is Phalloidin-iFluor532 (A) or Phalloidin-TRITC (B). Scale bar 10 μm.
Applsci 11 01174 g005
Applsci 11 01174 g006 550
Figure 6. Intracellular accumulation of LONs in RAW264.7. Analysis of samples was performed 24 h after addition of fluorescein-labeled conjugates (5 μM) to the cells. Analysis was performed using αPlan-Apochromat 100x/1.46 Oil DIC M27 objective. Three-channel (BGR) pictures were obtained using staining by DAPI (nuclei staining) (B); fluorescein-labeled LONs (G); Phalloidin-iFluor532 (cytoskeleton staining) (R). Scale bars 20 μm. ODN-F—control unmodified oligonucleotide labeled with fluorescein.
Figure 6. Intracellular accumulation of LONs in RAW264.7. Analysis of samples was performed 24 h after addition of fluorescein-labeled conjugates (5 μM) to the cells. Analysis was performed using αPlan-Apochromat 100x/1.46 Oil DIC M27 objective. Three-channel (BGR) pictures were obtained using staining by DAPI (nuclei staining) (B); fluorescein-labeled LONs (G); Phalloidin-iFluor532 (cytoskeleton staining) (R). Scale bars 20 μm. ODN-F—control unmodified oligonucleotide labeled with fluorescein.
Applsci 11 01174 g006
Applsci 11 01174 g007 550
Figure 7. Intracellular accumulation of LONs in human THP-1-induced macrophages. Analysis of samples was performed 24 h after addition of fluorescein-labeled conjugates (5 μM) to the cells. Analysis was performed using αPlan-Apochromat 100x/1.46 Oil DIC M27 objective. Three-channel (BGR) pictures were obtained using staining by DAPI (nuclear staining) (B); fluorescein-labeled LONs (G); Phalloidin-TRITC (cytoskeleton staining) (R). Scale bars 20 μm. ODN-F—control unmodified oligonucleotide labeled with fluorescein.
Figure 7. Intracellular accumulation of LONs in human THP-1-induced macrophages. Analysis of samples was performed 24 h after addition of fluorescein-labeled conjugates (5 μM) to the cells. Analysis was performed using αPlan-Apochromat 100x/1.46 Oil DIC M27 objective. Three-channel (BGR) pictures were obtained using staining by DAPI (nuclear staining) (B); fluorescein-labeled LONs (G); Phalloidin-TRITC (cytoskeleton staining) (R). Scale bars 20 μm. ODN-F—control unmodified oligonucleotide labeled with fluorescein.
Applsci 11 01174 g007
Applsci 11 01174 g008 550
Figure 8. Inhibition of RGMa expression in PK-59 human pancreatic carcinoma cell culture by lipid conjugates of RGMa siRNAs vs. unmodified siRNA (RGMa). The conjugates were modified near the 3’-end by two (passenger chain only) or four (both chains) lipophilic groups (Δ—dodecylphenyl, H—hexadecyl).
Figure 8. Inhibition of RGMa expression in PK-59 human pancreatic carcinoma cell culture by lipid conjugates of RGMa siRNAs vs. unmodified siRNA (RGMa). The conjugates were modified near the 3’-end by two (passenger chain only) or four (both chains) lipophilic groups (Δ—dodecylphenyl, H—hexadecyl).
Applsci 11 01174 g008
Table
Table 1. Structures and molecular masses of oligonucleotides and their lipid conjugates (LONs).
Table 1. Structures and molecular masses of oligonucleotides and their lipid conjugates (LONs).
TypeDesignationOligonucleotide Sequence, 5′–3′ 1Molecular Mass, Da2
Calc. [M]Exp. [M]
Model antisense oligonucleotideODNagtctcgacttgctacc 35121.255120.98
ODN-F 4agtctcgacttgctacc-Flu5688.745687.93
1δ aδgtctcgacttgctacc5248.865426.08
2δ aδgδtctcgacttgctacc5736.365733.28
1δ-F aδgtctcgacttgctacc-Flu5996.355993.21
2δ-F aδgδtctcgacttgctacc-Flu6303.856300.41
1η aηgtctcgacttgctacc5408.875406.11
2η aηgηtctcgacttgctacc5696.385693.34
1η-F aηgtctcgacttgctacc-Flu5976.365973.24
2η-F aηgηtctcgacttgctacc-Flu6263.876260.47
siRNAEGFPSense CCUACGGCAAGCUGACCCUGA6698.106695.84
Antisense AGGGUCAGCUUGCCGUAGGUG6812.106811.57
RGMaSense CCAUCAUCUUCAAGAACUUCC6563.996565.38
Antisense AAGUUCUUGAAGAUGAUGGUG6806.206811.30
2Δ-RGMaSense CCAUCAUCUUCAAGAACUUCδCδ-p67219.407220.40
Antisense AAGUUCUUGAAGAUGAUGGUG6806.206811.30
4Δ-RGMaSense CCAUCAUCUUCAAGAACUUCδCδ-p7219.407220.40
Antisense AAGUUCUUGAAGAUGAUGGCδCδ-p7460.607466.90
2H-RGMaSense CCAUCAUCUUCAAGAACUUCηCη-p7260.007262.90
Antisense AAGUUCUUGAAGAUGAUGGUG6806.206811.30
4H-RGMaSense CCAUCAUCUUCAAGAACUUCηCη-p7260.007262.90
Antisense AAGUUCUUGAAGAUGAUGGUηGη-p7501.207502.00
1 Lowercase letters indicate deoxyribonucleotides, uppercase letters—ribonucleotides, underlined uppercase—2′-O-methylribonucleotides. 2 According to ESI LC-MS in the negative ions mode. 3 Control oligonucleotide with random sequence specially constructed not to affect gene expression in cells. 4 Flu—3′-terminal fluorescein label. 5 The symbols (δ), (η) mark the positions of dodecylphenyl or hexadecyl groups, respectively. 6 p—3′-terminal phosphate group.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Derzhalova, A.; Markov, O.; Fokina, A.; Shiohama, Y.; Zatsepin, T.; Fujii, M.; Zenkova, M.; Stetsenko, D. Novel Lipid-Oligonucleotide Conjugates Containing Long-Chain Sulfonyl Phosphoramidate Groups: Synthesis and Biological Properties. Appl. Sci. 2021, 11, 1174. https://doi.org/10.3390/app11031174

AMA Style

Derzhalova A, Markov O, Fokina A, Shiohama Y, Zatsepin T, Fujii M, Zenkova M, Stetsenko D. Novel Lipid-Oligonucleotide Conjugates Containing Long-Chain Sulfonyl Phosphoramidate Groups: Synthesis and Biological Properties. Applied Sciences. 2021; 11(3):1174. https://doi.org/10.3390/app11031174

Chicago/Turabian Style

Derzhalova, Alina, Oleg Markov, Alesya Fokina, Yasuo Shiohama, Timofei Zatsepin, Masayuki Fujii, Marina Zenkova, and Dmitry Stetsenko. 2021. "Novel Lipid-Oligonucleotide Conjugates Containing Long-Chain Sulfonyl Phosphoramidate Groups: Synthesis and Biological Properties" Applied Sciences 11, no. 3: 1174. https://doi.org/10.3390/app11031174

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop