Next Article in Journal
A Metaheuristic Framework with Experience Reuse for Dynamic Multi-Objective Big Data Optimization
Previous Article in Journal
Congruential Summation-Triggered Identification of FIR Systems under Binary Observations and Uncertain Communications
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Plant Synthetic Promoters

by
Piotr Szymczyk
1,* and
Małgorzata Majewska
2
1
Department of Biology and Pharmaceutical Botany, Medical University of Łódź, Muszyńskiego 1, 90-151 Łódz, Poland
2
Independent Researcher, 90-151 Łódź, Poland
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(11), 4877; https://doi.org/10.3390/app14114877
Submission received: 14 April 2024 / Revised: 25 May 2024 / Accepted: 30 May 2024 / Published: 4 June 2024
(This article belongs to the Section Applied Biosciences and Bioengineering)

Abstract

:
This article examines the structure and functions of the plant synthetic promoters frequently used to precisely regulate complex regulatory routes. It details the composition of native promoters and their interacting proteins to provide a better understanding of the tasks associated with synthetic promoter development. The production of synthetic promoters is performed by relatively small libraries produced generally by basic molecular or genetic engineering methods such as cis-element shuffling or domain swapping. The article also describes the preparation of large-scale libraries supported by synthetic DNA fragments, directed evolution, and machine or deep-learning methodologies. The broader application of novel, synthetic promoters reduces the prevalence of homology-based gene silencing or improves the stability of transgenes. A particularly interesting group of synthetic promoters are bidirectional forms, which can enable the expression of up to eight genes by one regulatory element. The introduction and controlled expression of several genes after one transgenic event strongly decreases the frequency of such problems as complex segregation patterns and the random integration of multiple transgenes. These complications are commonly observed during the transgenic crop development enabled by traditional, multistep transformation using genetic constructs containing a single gene. As previously tested DNA promoter fragments demonstrate low complexity and homology, their abundance can be increased by using orthogonal expression systems composed of synthetic promoters and trans-factors that do not occur in nature or arise from different species. Their structure, functions, and applications are rendered in the article. Among them are presented orthogonal systems based on transcription activator-like effectors (dTALEs), synthetic dTALE activated promoters (STAPs) and dCas9-dependent artificial trans-factors (ATFs). Synthetic plant promoters are valuable tools for providing precise spatiotemporal regulation and introducing logic gates into the complex genetic traits that are important for basic research studies and their application in crop plant development. Precisely regulated metabolic routes are less prone to undesirable feedback regulation and energy waste, thus improving the efficiency of transgenic crops.

1. Introduction

Global climate change has elevated the role of sustainable agriculture; there is a growing demand for novel plant genotypes or genetically modified plants with increased tolerance to biotic and abiotic stresses or secondary metabolite production [1,2,3,4,5,6,7]. This can be enabled by the expression of foreign genes that increase resistance to insects, herbicides as glyphosate, or by facilitating biosynthesis, such as carotenes or astaxanthin in rice [8,9,10,11,12,13,14,15,16]. Usually, these modifications use the constitutive CAMV35S or native plant promoters to drive transgene expression, often resulting in the silencing, toxicity, or decreased viability of modified plants [17,18,19,20,21,22,23]. Plant genetic modifications support other methods in increasing plant resistance to biotic and abiotic stresses, such as crop breeding and priming [24,25]. However, to avoid unnecessary feedback regulation or energy loss, there is a need for precise, simultaneous spatiotemporal or development-stage-dependent regulation of numerous transgenes [26,27]. Such fine-tuning of transgene expression could be enabled by orthogonal synthetic activators, repressors, and promoter systems containing the introduced cis-active elements, as these would allow better control of transcription regulator binding and gene expression [28,29].
Traditionally, promoters could be recognized as 5′-terminal gene fragments that control expression through the coordinated recruitment of particular proteins known as trans-factors, recognizing cis-active oligonucleotide sequences in the DNA [30,31,32,33,34,35]. The trans-factor is organized around the promoter; it interacts with a particular cis-active element to build up a protein complex with RNA polymerase II, resulting in the creation of the RNA polymerase II preinitiation complex [36,37,38,39,40,41,42].
However, relatively little is known of the precise nature of the cis-elements. Although their position weight matrices (PWM) have been characterized, their real, in vivo occurring regulatory functions are usually performed by imperfectly matched, weak, and cooperative DNA–protein interactions dependent on DNA or protein modification [43,44,45,46,47]. Interactions between cis-active elements and trans-factors are also strongly regulated by the local 3D shape of DNA [48].
In the broader context, gene expression is regulated by various coding and non-coding regions encompassing far-localized elements; these include enhancers, silencers, insulators, gene-embedded promoters, introns, 3′ and 5′ untranslated regions (UTRs), and terminators. These affect not only the chromatin state or assembly of the RNA polymerase II preinitiation complex, but also the 3′-end processing, stability, translation efficiency, and nuclear-to-cytoplasmic export of mRNAs [49,50,51,52,53,54].
Trans-factors can be further regulated through various post-translational modifications such as ubiquitination, acetylation, and phosphorylation; as such, the gene expression rate is dependent on a plethora of signaling events occurring within the plant cell after exposure to biotic or abiotic stresses [43,55,56,57,58,59,60,61]. Therefore, the changes in promoter activity influenced by trans-factors alter gene expression, influencing current plant cell metabolic demand or external regulatory events [62,63,64]. Coordinated gene expression is stimulated by numerous signaling routes. This is reflected in the promoter structure, typically consisting of cis-active motifs forming evolution-conserved clusters known as cis-regulatory modules (CRM); these contain cis-active elements assembled closely enough to support the interaction between recognizing trans-factors [65,66,67,68,69,70,71,72]. Such promoter-dependent dimerization or oligomerization of trans-factors could further increase the complexity of the biological response to changes within plant cells [31,67]. According to Blanchette et al., the CRM could be found as far as over 100 kb upstream from the TSS and within 1–10 kb downstream from the 3′ end of the gene [73].
The regulation of gene expression by promoter regions and other regulatory DNA sequences, such as enhancers, silencers, or insulators, allows the plant metabolism to respond to a particular demand. However, this response remains rough, and requires further post-translational protein modification or precise enzyme regulation to be refined [72,74,75,76,77]. Therefore, the changes in gene expression are not directly associated with modifications of the encoded protein concentration or enzyme activity.
Despite these limitations, studies on plant synthetic promoters provide valuable information concerning the regulatory mechanisms controlling gene expression in complex traits, enabling the regulation of metabolic pathway activity [28,50,78]. Moreover, of particular importance is research on plant bidirectional and orthogonal expression systems, providing solutions to problems associated with the coordinated and controlled expression of stacked genes as well as decreasing the exposition to homologous DNA sequences [28,78,79]. Besides the putative practical applications, studies on plant synthetic promoters are often performed on the whole genome scale, supported by advanced machine and deep learning algorithms. These studies supply essential and novel information concerning the regulatory functions of promoter segments or cis-active motifs in the context of DNA or chromatin structure modifications [35,44,46,50,78].

2. Sections of Plant Promoters

2.1. Core Promoter

Studies on the Arabidopsis thaliana genome suggest that, in plants, the promoters of complex transcriptional regulation, which are common in the stress-responsive genes, tend to be longer (1672 bp) than other genes that respond to fewer signals (1113 bp) [80]. This could be explained by the relative austerity of cis-active motifs, and lower space requirement to gather them into promoters which reply to limited stimuli. The segment of the promoter localized at approximately 50–100 bp upstream and downstream from the transcription start site (TSS) is recognized as a core or minimal promoter, where transcription initiation occurs (Figure 1) [81].
The first core promoter component identified in the SV40 early region is the TATAbox [82]. Such elements are localized approximately 32 bp upstream from the transcription start site (TSS) in plant genes (Figure 1) [83,84]. While the distribution of the TATAbox is species-specific, in most cases it is found around ~30 bp upstream of the TSS. In sorghum, the peak was found ~40 bp upstream of the TSS, with an additional lower peak at ~30 bp upstream of the TSS. In the maize genome, two additional peaks of TATA-box localization were observed at ~55 and ~70 bp upstream of the TSS. Core promoters containing a TATA-box were up to fourfold more active than those without TATA, particularly when the TATA-box is found 23 to 59 bp upstream of the TSS. Therefore, increasing the distance from TATA-box to the TSS decreases the strength of maize promoters [85].
The consensus sequence of TATA-box in plants is TATAWAW (W = A/T) [86]. However, computational analyses of 79 plant promoters suggest that the TATA-box consensus sequence is TCACTATATATAG [87]. The TATA-box is bound by a subunit of TFIID known as TATA-box binding protein (TBP), enabling the assembly of the RNA polymerase II preinitiation complex [81,88]. The relative stability of TATA-box localization in relation to the TSS, combined with the information of interacting proteins, distinguishes TATA-box from other regulatory DNA sequences in the core promoter.
The importance of the TATA-box sequence for proper gene expression regulation was confirmed by Amack et al. [89]. The authors used PCR and specific primers to introduce single nucleotide substitutions to the TATA-box of the CaMV35S promoter. Two obtained variants, A4T and T5A, showed, respectively, 1.2- and 1.1-fold higher activity in plant protoplasts as compared to the wild-type TATA-box sequence. Moreover, eight mutants (T1G, A4C, A4G, T5A, A6G, A7C, A7G, and A7T) presented a similar or higher activity to the wild-type TATA-box [89]. The TATA box is required not only for accurate transcription initiation but also to determine the level and selectivity of gene expression in plants [90,91,92]. Molina et al. found that among 12,749 tested dicot A. thaliana genes, only approximately 29% indicated a TATA-box, as did only 19% of monocot Oryza sativa genes [83,93]. The common lack of TATA-box in plant core promoters suggests its putative functional substitution by other core promoter elements as Inr or Y patch, supporting the correct DNA–protein interaction during RNA polymerase II preinitiation complex formation [85,90]. Moreover, TATA-box genes are less frequently found among those present in EST databases and have shorter 5′UTRs (108 bp) than TATA-less promoters (138 bp), lacking the TATA-box element [83]. The presence of a TATA-box is also common in gene promoters regulated by light or biotic and abiotic stress [92,94].
Nucleotide frequency matrices within TSS in dicot and monocot plants and different promoters were described by Shahmuradov et al. [95]. The analysis of promoters revealed the sequence WnT/aC/tA/cw (−4 to +2) in 217 unrelated dicot plants, and aNnCA (−2 to +3) in 70 unrelated monocots [95]. Similarly, 171 TATA-box promoters showed T/cCAnM, while 130 TATA-less promoters indicated T/a/cYA/ca/c/tt/a/g (−2 to +3), where W=A or T, N=any nucleotide of A, C, T, or G, Y=C or T, and M=A or C [95]. A general rule of TSS in A. thaliana and rice is the localization of Y (C or T) at −1 and R (A or G) at +1 [96].
Besides the TATA-box, an important constituent required for plant transcription initiation is the Inr of the PyTCANTPyPy consensus sequence, usually overlapping the TSS (Figure 1) [90,91]. In plant photosynthesis nuclear genes, the TATA-box is frequently lacking, and its role is played by Inr interacting with the TFIID trans-factor [90,96]. This interaction is supported by the evolution-conserved downstream promoter element (DPE) A/GGA/TCGTG (Drosophila melanogaster) interacting with subunits of TFIID in the form of the heterotetramer dTAFII60–dTAFII40 [97].
Another regulatory sequence found in plant promoters is the Y patch, built from repeated pyrimidine CT or TC dimers, which may alternatively exist as a Y-patch-related motif (TTTCTTCTTC) (Figure 1) [96].The fraction of Y patches in plant promoters with distribution peaks around TSS is directionally oriented and methylation sensitive [96]. Moreover, plant promoters with Y-patch and Inr sequences are also generally stronger than those lacking them, suggesting their putative function in a proper organization of an RNA polymerase II preinitiation complex [85]. Some elements of core promoters observed in humans and D. melanogaster were not found in A. thaliana, such as the Sp1-binding sites or CpG and BRE elements, referring to the putative specificity of DNA–protein interactions between plants and animals [96,98].
The analysis of both core promoter types, TATA-box- and TATA-less-containing Inr, suggests that TATA and Inr are not swappable and regulate light-responsive gene expression in a different way. Moreover, the TATA-box core promoters are enriched in AC/CA motifs, conserved around the TSS and immediately downstream in the 5′-UTR region. However, TATA-less promoters showed a higher percentage of pyrimidine-rich TC/CT motifs around the TSS and immediately downstream in the 5′-UTR region [99].The putative functional role of these differences in DNA sequences could be explained by X-ray crystallography studies providing details of DNA–protein interactions in both types of core promoters.
In A. thaliana, three types of core promoters were identified: TATA, GA, and Coreless (Figure 1). An analysis of 10,285 gene promoters indicated that the TATA-containing promoters are relatively long and a short distance from the TSS or CDS [100]. Moreover, their expression profile is high and regulated. In contrast, the Coreless promoters do not contain any elements such as TATA, Y patch, GA, or CA, are relatively short, and are found a long distance from the TSS or CDS. The expression level of these promoters is low, and they are constitutive in nature [100]. Putatively, the transcription initiation in these promoters is controlled by specific and abundant cis-regulatory elements as well as the open nucleosomal status. Another GA type of plant core promoter regulates the expression of constitutive genes and is characterized by a short distance from TSS or CDS [100].
By combining the cap-trapper and massively parallel signature sequencing methods (CT-MPSS), it was possible to identify 158,237 Arabidopsis transcription start site (TSS) tags corresponding to 38,311 TSS loci [101]. The TATA-type promoters (25.1%) are enriched in the Y patch and the Inr motif, and cause high gene expression with sharp-peak TSS clusters. By contrast, the GA type, representing 21.6% of A. thaliana core promoters, is not associated with Y patch or Inr, and contains broad-type TSS clusters [101]. Probably, plants’ GA elements play a role similar to mammalian CpG islands; however, GA elements are not methylated [101]. Until now, the significance of the presented differences in the context of a proper transcription initiation has not been studied experimentally. Moreover, the distribution of TSS and the corresponding core promoters in the plant genome should not be seen as a stable process but rather as a dynamic one that could be altered by the introduction of foreign DNA into the genome [102].
The association of TATA-box promoters with conditional, regulated gene expression was recently tested [103]. The Coreless promoters indicated a bias towards uniform expression regulation in dicots but not in monocots. A comparison of different plant species found they tended to demonstrate similar expression patterns for a particular promoter. However, the orthologs of the uniformly expressed genes could be found more easily than those of conditional genes. Moreover, none of the screened core-promoter types was consistently associated with changes in gene expression patterns. Therefore, a correlation only occurs between the promoter architecture and the expression parameters [103].
The last cis-active element observed in plant core promoters is the CCAAT motif, which is localized on its borders, predominantly between −120 and −40 in dicots and −460 to −140 in monocots (Figure 1) [104]. The CCAAT motif is also observed in plant enhancers [105]. The CCAAT cis-element is bound by the CCAAT-binding factor (CBF), also known as nuclear transcription factor Y (NF-Y) [106]. The NF-Y transcription factor is composed of three subunits: NF-YA, NF-YB, and NF-YC [107]. Of these, NF-YB and NF-YC dimerize through their histone fold domain (HFD), which can bind DNA in a non-sequence-specific fashion. The obtained DNA–protein complexes are bound by NF-YA to build trimeric structures. Upon trimerization, NF-YA specifically recognizes the CCAAT-box [105]. In soybean (Glycine max), the NFYA interacts with FVE, which is complexed with histone deacetylase HDA13 to potentially repress transcription by reducing H3K9 acetylation at target loci [108].
An important role in the regulation of gene expression is played by 5′-UTR regions. Some of the trans-factor binding sites, such as those for ERF, SBP, G2-like, GATA, and ARR-B, are concentrated within the region localized 200 bp downstream from TSS in A. thaliana [109,110].

2.2. Proximal Promoter

The proximal promoter, encompassing the region within up to 300 bp upstream from TSS, houses most of the functional cis-active elements required for the proper spatiotemporal or stress-responsive regulation of gene expression (Figure 1) [67,81,111,112,113]. According to Yu et al., 63% of all A. thaliana cis-active elements are concentrated within a region slightly exceeding the proximal promoter, up to 400 bp upstream from TSS [109]. Also in the peach (Prunus persica),cis-active motifs are concentrated within −500 to +200 in relation to TSS [114]. Moreover, the results of Keilwagen et al. clearly show that the preferred localization of AuxRE (TGTSTSB, where S = C or G and B=C, G, or T) lies within the proximal promoter, 250 bp upstream from TSS [115].Furthermore, these cis-active motifs are gathered within conserved cis-regulatory modules (CCRM), enabling interactions between trans-factors bound by neighboring, closely spaced cis-active motifs [67,113,116]. Jo et al. suggest that LEC1 interacts with ABA-responsive element binding protein3 (AREB3), basic leucin zipper67 (bZIP67), and ABA-insensitive (ABI3) trans-factors to regulate various sets of genes controlling morphogenesis, gibberellin signaling, photosynthesis, and maturation-related processes during soybean seed development [117]. Similarly, the TaNAC100 trans-factor could orchestrate the expression of starch synthesis genes in wheat [118]. Also, the responsiveness to auxin is mediated not only by a single AuxRE but also by multiple AuxREs. In the composite AuxRE elements associated with auxin response, ABRE-like and Y patch are 5′-flanking or overlapping AuxRE, whereas the AuxRE-like motif is 3′-flanking [110].
The relationship between trans-factor concentration, dimerization efficiency, and affinity to cis-active elements was studied among trans-factors in the CCRM-1 of the Glu gene; the gene is responsible for the biosynthesis of high-molecular-weight glutenin subunits (HMW-GS) [113]. The concentration of the WUSCHEL trans-factor could regulate its predominance as a monomer or dimer through the cooperative binding of corresponding cis-elements, which would increase the prevalence of dimers at lower concentrations, accompanied by increased CLAVATA3 gene expression [119].Transcription factor complexes organized within proximal promoters interact with mediator subunits looped towards the RNA polymerase II preinitiation complex, to affect its activity, represented by gene transcription rate (Figure 1) [34]. Among examples of such interactions is the MED25 subunit physically associated with the basic helix-loop-helix transcription factor MYC2 in the promoter regions of MYC2 target genes to positively affect MYC2-regulated gene expression. However, the binding of MED25 to the basic leu zipper transcription factor ABA-insensitive 5 (ABI5) in promoter regions of ABI5 target genes shows a negative effect on ABI5-regulated gene transcription [120]. Moreover, MED18 subunit interacts with SUPPRESSOR OF FRIGIDA4 and ABA-insensitive4 to regulate flowering time and abscisic acid (ABA) responses, respectively [121].

2.3. Plant Enhancers

Enhancers can regulate gene expression over large distances, independent of orientation [122,123]. Although the plant enhancers stimulate target gene expression over a distance of up to 140 kb, they could also be found within up to 400 bp from TSS (Figure 1) [124,125,126,127,128]. Moreover, differences between enhancers and promoters are often fuzzy, and their roles are interchangeable, as some promoters (epromoters) could function as enhancers [129].
Enhancer activation requires the binding of an initial set of trans-factors which recognize their cognate cis-elements on DNA wrapped in nucleosomes [130,131,132]. Following this, the signal-dependent trans-factors interact with cis-elements, these being more degenerate in enhancers than promoters. These support the protein–protein interactions and strengthen the cooperativity of their binding to DNA [123,133,134,135,136]. Together with trans-factors, various coactivators such as the mediator complex, lysine acetyltransferases p300, and CREB-binding protein (CBP) are recruited to maintain the nucleosome-free chromatin state (Figure 1) [137,138,139,140,141]. As a result, the plant active enhancers pea PetE and maize b1 are enriched in H3/H4ac and H3K9/K14ac, respectively [127,142]; however, elevated H3K27ac only acts as a marker of active enhancers in animals, not in plants [143,144]. Another epigenetic modification typical of active enhancers is the monomethylation of H3K4 (H3K4me1) [145]. It is possible that H3K4me1 is required for nucleosome removal, and H3K27ac for the production of the short (~200-nt) transcripts known as enhancer RNA (eRNA) [145,146]. Nascent eRNA in active enhancers recruits repressive histone and DNA modifiers, as polycomb repressive complex 2 (PRC2) and DNA methyltransferase 1 (DNMT1) to further protect the open DNA state from their suppressive influence [147,148].
Enhancers communicate with promoters mostly through looping interactions, engaging nuclear matrix components such as lamins, to bring the two gene elements into close proximity (Figure 1) [127]. Although the relationship between these interactions and gene activity is unclear, several models suggest that the pivotal role in creating linking contact is played by mediator/RNA PolII, polycomb repressive complex, or trans-factor dimerization. Moreover, low-affinity interactions or trans-factors, transcriptional co-activators, and other proteins can create protein aggregates, promoting and reinforcing enhancer–promoter association [149,150,151].
Therefore, the activation of enhancer and the maintenance of its active state is a coordinated, multistep process, precisely regulated through the recruitment of particular proteins that are sensitive to molecular signals, modifying their performance. Thus, the activity of mediator subunits, affecting the functions of the entire enhancer is regulated by crucial plant phytohormones. Among them are jasmonic acid (JA) regulating MED25, ABA controlling the MED18 or general plant defense processes affecting MED21, MED19a and CKD8 activity [34].

3. Objectives and General Methodology of Synthetic Promoter Creating

Modern plant biotechnology may require the modification of up to 15 genes [152]. Indeed, for all metabolic and signaling pathways in plants, the engineering of complex regulatory networks requires the coordinated expression of numerous genes [152,153,154,155]. Therefore, sets of different regulatory elements as synthetic promoters are needed. Novel synthetic promoters are also needed to resolve the problems observed after the repeated application of the same synthetic promoters, such as plasmid instability or homology-based gene silencing [156,157].
Genetically modified plants could produce valuable metabolites, acquire resistance to herbicidal, insect, or fungal expositions, and efficiently grow under abiotic stress conditions [155,158]. Although the final outcome of such approaches is the modification of metabolic fluxes adopting sessile plants to external conditions, the starting point is the precise and simultaneous expression control of numerous genes [159,160,161,162].
The stacking of numerous genes in transgenic plants requires sequential transformation by single gene vectors or multiple separate gene expression vectors [163,164]. Conventional breeding techniques require multiple crosses of different transgenic events. These traditional strategies suffer from inherent pitfalls such as complex segregation patterns and the random integration of multiple transgenes, resulting in non-stoichiometric and variable transgene expression [165,166].
One efficient solution involves using a single transgenic event to allow the coordinated expression of multiple transgenes by the minimum number of regulatory elements [160,167]. Such stacking is an optimal method of allowing the simultaneous expression of a gene set, as it integrates them into adjacent regions of the genome and reduces the probability of transgene segregation in later generations [168,169]. Multicistronic plant expression vector systems have been developed for this purpose [170,171,172].
One particularly useful approach that would allow the controlled expression of numerous genes involves the use of bidirectional promoter systems [173,174,175,176]. Contrary to tandemly repeated monodirectional expression cassettes, bidirectional promoters can identify optimal promoter contributions for transgene co-expression, available in a single round of cloning, expression, and screening experiments. However, a library of synthetic promoters is required to study their varying expression levels and regulatory profiles in both expression directions [177]. According to Kumar et al., the gene stacking approach could potentially be extended to express 6–8 genes with a single bidirectional promoter [173].
Synthetic promoters join different cis-regulatory elements with the core promoter to combine tissue specificity with increased or precisely tuned expression within the same construct [85,178,179,180,181]. Cis-active elements within synthetic promoters are introduced according to their positions, copy number, spacing, and orientation to promote optimum spacing among cis-motifs and corresponding trans-factors [182,183,184,185,186,187,188].
The obtained promoters possess different tissue-specific, strength, and inducibility properties, enabling the co-expression of numerous genes at different levels, as is required by the complex biosynthesis traits or regulatory circuits responding to various environmental conditions, i.e., biotic, abiotic, tissue-specific, light stress, or hormonal stimulation [184,185,189,190,191,192,193,194]. To avoid unwanted recombination or homology-dependent gene silencing, the expression of each gene is regulated by a different promoter [189,195].
A promising approach for increasing the diversity of available synthetic promoters as a remedy to decreasing plasmid stability and homology-based gene silencing involves the use of orthogonal expression systems based on promoters and trans-factors that do not occur in nature or originate from different species [28,29,157,196,197,198,199]. Expression of such an orthogonal system is usually controlled by a tissue-specific or inducible promoter, enabling the biosynthesis of the orthogonal trans-factor. The produced trans-factors recognize cis-elements in promoters that are absent in the native gene to avoid off-target effects [28,29,196,199,200]. As orthogonal trans-factors, they could also be adapted transcription activator-like effectors (TALEs) due to the modular structure of their DNA-binding site. Such DNA-binding domains could be engineered to recognize a DNA sequence that does not occur in the genome [199,201]. Moreover, orthogonal expression systems are also based on artificial transcription factors (ATFs) built from the deactivated form of the Cas9 protein (dCas9) and the transcriptional activator domains VP64 or EDLL, repressor domain SRDX, or DNA epigenetic modifiers [196,202,203].

3.1. Methods of Synthetic Promoter Generation

The methods of choice for producing relatively small synthetic promoter sets are PCR-based techniques [204,205,206,207,208,209]. Recently, plant synthetic promoters were prepared by PCR-based deletion mutagenesis and subsequent GUS activity assays. In this way, two core promoters were obtained from the Stellaria media Antimicrobial Peptide1 (AMP1) and Antimicrobial Peptide2 (AMP2) genes. Although the shorter versions of the pro-SmAMP1 and pro-SmAMP2 promoters, represented by the −58 and −60 bp fragments, were weak, the longer fragments of 102 and 104 bp were used as core promoters, as these largely retain the properties of the original promoters [210]. Primer-driven PCR mutagenesis was also used to obtain variants of the synthetic promoter pCL that could regulate the cold-induced sweetening of potatoes. Several point mutations were introduced into the region encompassing the 5′ and 3′ sides of the C-repeat/dehydration-responsive element (CRT/DRT), localized within −490 to −500 bp from TSS. Moreover, the additional cassette of 27 bp containing the second CRT/DRT element was placed 31 bb from the existing CRT/DRE site [211].
Zhang et al. suggest that even discrete point mutations of the repeated G-box (CACGTG) and its 2–4 bp long flanking regions could significantly increase reporter GFP gene expression, opening up the potential for useful and predictable genome editing approaches in the promoter regions [212].
Besides the presented approaches dealing with the mutagenesis of a single promoter, which provide only a relatively small number of variants, the promoter sequence can be subjected to stepwise-directed evolution using error-prone PCR to obtain larger libraries. It was found that 83 cycles of mutation, construction, screening, and property characterization of the 74-bp-long Ptrc promoter, with 10–20 of the lowest and highest-activity variants sampled after each step, resulted in a library of 3665 clones. Among them, a 454-fold difference was found between the strongest and weakest expression rates [213]. A smaller library containing hundreds of variants has been obtained by shuffling the figwort mosaic virus full-length transcript promoter (F) and the sub-genomic transcript promoter (FS) sequences. Shuffled promoters were weaker than those prepared by hybridization. However, the shuffled libraries contained promoters with a broad spectrum of activities, enabling the application of both weaker and stronger variants in metabolic engineering approaches [209]. To significantly increase the complexity of synthetic promoter libraries, a combination of site-directed mutation with degenerate primers, overlap-extension PCR, and Gibson assembly was proposed. The prepared libraries showed a diversity in the order of 10⁴–10⁷ variants and were screened rapidly by performing fluorescence-activated cell sorting (FACS) of the transformed yeast cells [214].
Construction of larger synthetic promoter libraries composed of over 108 elements is possible by avoiding the use of already-known DNA sequences. Random, 80-bp-long DNA oligos are synthesized and used to build such complex libraries in yeast, theoretically enabling the study of all pairwise interactions between TF (trans-factor) binding sites in the context of orientation and specific spacing constraints. However, the analysis of such large synthetic promoter libraries has problems; for example, the complexity of the synthetic promoter library (>108) exceeds the number of sorted yeast cells (<108). Also, the analysis of such large libraries using simplified TF binding models, assuming their position, orientation, and TF–TF interaction independence, explained nearly 93% of the variation in gene expression in the tested libraries; it proved to be insufficient in relation to native yeast genes, where only ~16% of variability was demonstrated [46].

3.2. Cis-Element Juggling and Domain Swapping

As the components of synthetic promoters, existing juggled or shuffled cis-elements of oligonucleotides are usually involved. However, larger promoter domains with known regulatory properties could be exchanged in the process of domain swapping [215,216,217,218,219,220]. Alternatively, completely novel cis-elements or domain variants identified by searches of available promoter databases or obtained through artificial intelligence support could be experimentally validated in plant material and then employed to construct synthetic promoters [221]. An example of cis-element shuffling involves the placement of the cis-elements of known functions in a novel or synthetic stretch of DNA. Optionally, fragments of one promoter could be exchanged with functionally equivalent domains from other heterologous promoters [195]. The latter approach is often practiced as ligating the upstream activation sequence (UAS) from one promoter to the TATA box-containing domain of another promoter. It is expected that the transfer of the cis-element or upstream DNA sequence from one promoter into another containing the TATA sequence could provide a novel transcription regulatory mechanism [128,181,222].
Placing the TATA-box of the CAMV35S promoter (TATATAA) within a synthetic stretch of DNA formed a synthetic core promoter demonstrating 85% of the activity of the native sequence. However, core promoters prepared by domain swapping were significantly weaker, indicating only 20–68% of CAMV35S activity. These relatively weaker synthetic promoters could be important for complex metabolic engineering approaches, where the decreased or precisely tuned load of heterologously expressed genes could be salutary to host primary metabolic routes [195,223,224,225,226,227]. Further applications of domain hybridization generated many superior plant promoters [128,181,209,222,228,229,230].
Viral and plant pathogen genomes are relatively simple and easily available sources of naturally occurring cis-active elements that can be used to prepare novel synthetic promoters through domain hybridization [181,183,222,230]. These synthetic promoters could indicate the higher activity of CAMV35S. Indeed, two recombinant promoters, S100 and D100, prepared from the strawberry vein banding virus, demonstrated 1.8 and 2.2 times greater activity in tobacco (Nicotiana tabacum) than the CaMV35S promoter. The S100 recombinant promoter (621 bp) was obtained from the 250bp long upstream activation sequence (UAS) of the strawberry vein banding virus (SV10UAS; −352 to 102 relative to TSS) and the 371bp long TATA-containing core promoter domain (SV10CP; −352 to +19) of the same gene. Correspondingly, the 726bplong D100 promoter was assembled by fusion of the 170bp long UAS of the dahlia mosaic virus (DaMV14UAS; −203 to−33) with its 556-bp-long core promoter domain (DaMV4CP; −474 to +82) [231].
Similarly, the synthetic promoter FUASCsV8C was designed by placing the upstream activation sequence (UAS) of the figwort mosaic virus (FMV; −249 to −54) at the 5′-end of the cassava vein mosaic virus (CsVMV) promoter fragment 8 (CsVMV8; −215 to +166). This hybridized, synthetic promoter exhibited approximately 2.1-times higher GUS activities in tobacco protoplasts and 2.0-times higher activity in agroinfiltration assays, compared to the CaMV35S promoter [222].
Synthetic promoters can be significantly stronger than CAMV35, as shown by the construction of two chimeric promoters, MBR3 and FBR3, by fusing the UASs (upstream activation sequences) of mirabilis mosaic virus(MUAS; −297 to +38; 335 bp) and figwort mosaic virus(FUAS; −249 to +54; 303 bp), respectively, to the core promoter domain of BR3 (BR3; −212 to +160; 372 bp). The activities of MBR3 and FBR3 promoters were comparable to the activity of the CaMV35S2 promoter and four times stronger than that of the CaMV35S, as confirmed by histochemical and fluorometric GUS assays [232].
The construction of synthetic promoters uses novel cis-active elements such as the W-box sequence (GACTTTT), MYB-like (TGGTTT), bZIP-related (TACGTGACG), and TACGTCACG, from the genome of the fungal pathogen Phytophthora sojae. These cis-active motifs, assembled in tetrameric mode, were found to drive the expression of the CAMV35S core-based synthetic promoter in response to the elicitor peptide Pep25 (N-DVTAGAEVWNQPVRGFKVYEQTEMT-C) from P. sojae [183].
The source of cis-active elements or larger promoter domains is complex and not fully characterized in plant genomes. The selection of cis-active motifs responsible for drought stress began with in silico analyses of 63 and 183 soybean drought-inducible genes, which were fused to the minimal 35S promoter as concatamers of 4–7 elements [184,185]. Analogously, two cis-regulatory motifs M1.1 (TAAAATAAAGTTCTTTAATT) and M2.3 (ATATAATTAAGT) in the soybean (G. max) genome, reacting to the infection of cyst nematode (SCN), were used as fourfold repeats to develop synthetic promoters; these in turn were used to drive GUS expression in roots infected by Meloidogyne incognito [189]. Moreover, the simultaneous response to fungal pathogens mediated by SA (salicylic acid) and MJ (methyl jasmonate) was achieved in synthetic promoters containing core 35S placed downstream to dimers of both D (31 bp) and F (39 bp) cis-active motifs from the ArabidopsisAtCMPG1 gene [190].
Since cis-elements in pathogen genes have evolved to utilize the plant’s transcriptional machinery, such as TGACG-motif binding (TGA) of basic leucine zipper (bZIP) TFs, they are much stronger activators of synthetic promoters than other TFs found in plant constitutive promoters. However, the combination of three different plant cis-active elements recognized by weak and dissimilar activators induced considerably greater reporter gene expression; this may have been mediated by passive cooperativity and not the direct interaction between trans-factors, as the suggested result of extending the distance between the cis-active motifs [186].
Other properties of synthetic promoters not related to pathogen resistance could be engineered by the application of different cis-active elements. The deployment of a six-times repeated ABA responsive element (6xABRE) upstream to a minimal CAMV35S promoter −90 to −1 produced a system that responded to ABA, salt and mannitol treatment in transformed A. thaliana roots [233]. Combining a more complex set of seven cis-active elements from three photorespiratory genes in A. thaliana (AtPLGG1, AtBASS6, AtPGLP) resulted in the formation of synthetic promoters that could respond to elevated temperature, low CO2, and high irradiance stress. Among the analyzed cis-responsive elements, MYB and b-ZIP reduced transgene expression rate, measured by luciferase activity, by recruiting transcriptional repressors. However, bHLH increased luciferase activity in response to elevated temperatures, and AP2 in response to high irradiance [192]. Studies on the role of UTR regions in plants and viruses suggest that plant-derived UTRs outperform viral UTRs under ambient conditions. However, plant-derived UTRs are more sensitive to environmental stress conditions [192].
To construct synthetic promoters, both cis-elements and larger fragments could be assigned as enhancers or entire promoters of selected crop genes, extending the number of available plant synthetic promoters [128,221]. To that end, the publicly available RNA-seq datasets were searched to find genes indicating a high dynamic range, activity in different plant species, and ubiquitous expression in diverse tissues. The obtained genes demonstrated a range of mean transcript abundances, suggesting differences in their strengths. A prepared set of 15 plant constitutive promoters driving these genes showed expression levels spanning nearly two orders of magnitude [221]. Seven of them were stronger than the NOS, and five are comparable with the CAMV35S promoter [221]. Moreover, Jores et al. used the CAMV35S core enhancer (subdomains A1 and B1-3), together with enhancers from three plant genes to stimulate CAMV35S minimal promoter activity, independently of orientation; the activity was identified by self-transcribing active regulatory region sequencing (STARR-seq). These enhancers efficiently stimulate synthetic expression systems only when positioned relatively nearly, within 500 bp from the CAMV35S minimal core promoter and outside of the 3′UTR [128].
Creating synthetic promoters opens the doorway to analyzing subtle or mutually exclusive metabolic events. The close spacing between cis-elements bound by trans-factors responding to SA and JA, or alternatively auxin or cytokinin treatment, allowed antagonistic pairs of plant regulators, such as JA/SA or auxin/cytokinin, to be studied. The obtained synthetic promoters could attenuate the antagonistic effects of the SA/JA and auxin/cytokinin pairs and strengthen responses to these stimuli [193]. Also, the feedback-regulated catabolism of SA to 2,3-dihydroxybenzoic acid, together with such physiologic effects as SA concentration in plant tissue, growth rate, leaf senescence, and pathogen resistance, was reconstructed in plants by the application of synthetic promoters containing the SA 3-hydroxylase (S3H) gene under the control of the SA-inducible promoter from SA 5-hydroxylase (S5H) [193]. Furthermore, plant synthetic promoters based on the Q system from Neurospora crassa could not only be activated by the expression of QF2 and QF2w trans-factors but also constrained by the QS repressor, enabling the precise control of gene expression rate [234,235]. In addition, the precise control of three gene expression levels could be used to modulate photosynthesis efficiency and plant productivity by photorespiratory bypass. Such a synthetic photorespiratory circumvent, known as the GMA bypass, allows the plastidial glycolate to decompose, leading to the release of CO2 directly into the chloroplasts and an increase in the local CO2/O2 ratio. To efficiently execute such a task, two different constitutive promoters, viz. CaMV35S and the maize UBIQUITIN promoter (pUbi), were exercised to avoid gene-silencing effects while driving Cucurbita maxima malate synthase (CmMS) and O. sativa ascorbate peroxidase 7 (OsAPX7), respectively. However, the third gene in the GMA bypass, known as O. sativa glycolate oxidase 1 (OsGLO1), should be controlled by a light-inducible Rubisco small subunit promoter to dynamically adapt the gene expression rate to changes in light conditions and significantly improve photosynthetic efficiency [194].

4. Native and Synthetic Bidirectional Promoters

Bidirectional promoters assure more coordinated expression of several genes than unidirectional promoters [236]. This was observed for the bidirectional promoter obtained from the ZeamaysUbiquitin-1 (ZMUbi1) gene, which was utilized to regulate the expression of insect (cry34Ab1 and cry35Ab1) or herbicide (aad1) resistance and a phi-yfp reporter gene in corn (Zea mays) [173].
A set of green-tissue-specific, bidirectional promoters was built by combining the unidirectional promoter POsrbcs-550 with the inversely oriented OsTub6 intron to increase both the transcription efficiency and green-tissue expression rate of GFP in the 5′ direction. Another group of regulatory elements, viz. the reverse-oriented core promoter of POsrbcs-550 (POsrbcs-62), or its alternative PD540-544, the reversed first intron of OsAct (OsAct1) and four-times repeated GEAT regulatory motif, were joined to increase the high level of the 3′-directed Gus gene expression [236]. In transgenic O. sativa, the obtained constructs demonstrated generally predominant expression in green tissues, i.e., leaves, stems, panicles and sheaths, and low expression in roots and endosperm [236].
Some bidirectional promoters exist naturally as 1156-bp-long fragments in the hot pepper genome, localized between two head-to-head-oriented genes: sesquiterpene cyclase (EAS) and a hydroxylase (EAH). A study of promoter deletion mutants in Nicotiana benthamiana leaves, assessed by EGFP and shRLUC reporter genes, found the minimal promoters for the pathogen-inducible expression of both genes to be a 199-bp fragment containing the GCC-box of EAH and a downstream 226-bp fragment of EAS bearing four W-boxes [237].
The naturally occurring bidirectional histone gene promoters PHTX1, PHHX1, and PHHX2 are much shorter than monodirectional promoters and drive gene expression in a TATA-box-dependent manner [177]. Thanks to their compactness and clear regulatory mechanism in both directions, these promoters allow plant gene expression to be regulated. Therefore, these bidirectional promoters were used to construct a library of 168 synthetic BDPs in the yeast Komagataella phaffii (syn. Pichia pastoris) to allow the rapid screening and optimization of different expression ratios [177]. Prepared synthetic promoters showed not a constitutive but rather a tight cell-cycle-regulated expression. Such tight, temporal expression control of metabolic pathway genes combined with the precise regulation of subsequent gene co-expression rate protects against excessive loads of heterologous proteins or concentrations of toxic metabolites [177]. By truncating and deleting PHHX2 fragments, BDPs of varying strength were produced. In addition, expression was made inducible by fusing shortened and bidirectionalized versions of the methanol utilization pathway promoters PDAS1-DAS2 with reversely oriented histone core promoters. Such an inducible approach was efficiently exercised in taxadiene biosynthesis, where the CYP2D6 and CPR genes were controlled by methanol-inducible PDAS1-DAS2; GGPPS was also regulated by a PGAP+CAT1 fusion promoter that is repressed in the presence of glucose, partially derepressed when the glucose is absent, and fully induced by methanol [177]. Moreover, assembly of the four carotenoid pathway biosynthesis genes CrtE, CrtB, CrtI, and CrtY under the control of histone BDPs enables the achievement of a 14.9-fold higher β-carotene yield as compared to a monodirectional PGAP constitutive promoter [177].
A related approach enabled the expression of β-carotene ketolase and hydroxylase genes in maize seed using a seed-specific bidirectional promoter. The obtained transgenic maize lines accumulated astaxanthin from 47.76 to 111.82 mg/kg DW in seeds, and the maximum level is approximately sixfold higher than that in previous reports (16.2–16.8 mg/kg DW) [238].

5. Orthogonal Expression Systems

Recently developed orthogonal expression systems built from over 500 elements could be employed to introduce complex, multi-gated logic principles such as “or”, “nor” or “kill” into genetic circuits. Such a broad range or regulatory effect was obtained after combining five concatenated cis-active elements from yeast (Gal4, MCM1, ata1, Matα2, Gat1, Yap1) with the WUS minimal promoter (Figure 2) [28]. Such yeast cis-active elements were used to construct plant synthetic promoters of low homology to already existing systems. The presented cis-active motifs were recognized by DBD from yeast or bacterial trans-factors. These DBDs are joined to plant or virus TAD and NLS sequences, to build an orthogonal trans-factor, not existing in nature, recognizing only cis-active motifs within the synthetic promoter (Figure 2). Although the expression of a synthetic trans-factor was controlled by native plant promoter, the prepared expression system enabled the decoupling of the transcriptional regulation of transgenes from those endogenous to the genome, which is characteristic of orthogonal systems [28]
The regulatory properties of synthetic trans-factors were extended by the repression activity achieved by combining the yeast DBD from Gal4 with the SRDX repression domain (Figure 3 and Figure 4) [28]. The expression of synthetic trans-factors was controlled by an endosperm-specific At2S3 or phosphate-responsive AtPht1.1. promoter. Interestingly, the MCM1 and Yap1 containing solely DBDs, without the addition of TAD, preserved some trans-activity properties, suggesting that DBDs may have inherent activation functions that may be interrupted by the introduction of a TAD [28].
Synthetic transcription regulators were also created from bacterial TF-derived DBDs, combined with the TAD domain from VP16 or Arabidopsis ethylene response factor 2 (ERF2) and the SV40 nuclear localization signal (NLS). An orthogonal set of plant synthetic promoters was created by fusing a core plant promoter, encompassing positions −66 to +18 of the CaMV35S, with the six copies of the DNA sequence (operator) bound by these TFs. The repressor activity was mediated also by synthetic regulators composed exclusively of DNA binding domains and NLS sequences, localized 3′ downstream to the core promoter (Figure 4). The obtained direct and layered logic gates are used to qualitatively modify the expression of the root-specific promoters SOMBRERO (proSMB) and PIN-FORMED 4 (proPIN4) [29].
An interesting approach to developing plant synthetic promoters controlled by orthogonal regulators is the application of transcription activator-like effectors (dTALEs) [198]. In addition, synthetic dTALE activated promoters (STAPs) can be prepared; these are composed of a 19-base-long degenerate sequence, followed by an 18-base-long TALE-site, a TATA-box, a 43-base-long degenerate sequence, and the ATG start codon (Figure 5). This is consistent with the observation that locating the TALE site within approximately −55 or −40 of the gene is sufficient to confer TALE-mediated inducibility. Forty-three of these promoters were tested in transient assays in N. benthamiana using a GUS reporter gene; the results found their expression strength to range from around 5% to almost 100% of viral CAMV35S promoter activity. Moreover, these STAPs were neatly utilized to transiently express three genes for the production of a plant diterpenoid in N. benthamiana [201].
The STAPs developed by Brückner et al. for application in dicot plants served as the starting point to assemble related systems (STAP1 and STAP2) in a monocot plant, O. sativa [197,201]. To ensure the spatial regulation of the GUS reporter gene, the TALE-dependent expression was driven by the bundle sheath cell-specific Zoysia japonica PHOSPHOENOLPYRUVATE CARBOXYKINASE (ZjPCK) promoter (ZjPCKpro) and two PHOSPHOENOLPYRUVATE CARBOXYLASE promoters (PEPCpro), maintaining direct and strong mesophyll-specific gene expression in rice. The tissue gene expression mediated by the STAP1 and STAP2 systems was heritable and scalable enough to efficiently regulate up to four different genes in one genetic construct. Moreover, dTALE1 expression was characterized by relatively low off-target activity, as indicated by a comparison of RNAseq data from wild-type and T2 plants. Only 139 upregulated and eight downregulated genes could be attributable to dTALE1 expression [197]. TALES could be exercised not only for the direct regulation of STAPS but also indirectly for the control of orthogonal TF expression [186].
DNA sequences recognized and bound by TALEs, known as effector binding elements (EBEs), could be predicted in silico and exercised to build repeatedly repeated fragments, controlling the expression of reporter genes with significant biological functions. One such example is the avrGf2 gene from the bacterial pathogen Xanthomonas citri. The gene can induce plant cell death, protecting against the development of the pathogen [239].
Artificial trans-factors (ATF) are typically created by fusing the deactivated form of the Cas9 protein (dCas9) to the transcriptional activator domain VP64. The ATF dCas9:VP64 upregulates the expression of reporter genes via specific guide RNAs (gRNAs) that target the promoter region upstream from them (Figure 6). The expression of ATF is usually controlled by CAMV35S, while the gRNA transcription rate is regulated by Pol III (U6) [196]. The presented system is known as the first generation of dCas9-dependent ATFs and was further developed to achieve the effective modulation of target gene expression. The novel form, known as the second generation of dCas9-dependent ATFs, contains the modified gRNA, which contains two aptamer loops to allow the attachment of the viral MS2 protein (Figure 7). The MS2 protein is bound by activators (VPR), transcriptional repressors (SRDX), or epigenetic regulators such as the catalytic core domain of Homo sapiens p300, H3K27 histone acetyltransferase, H3K9 histone methyltransferase, the SET domain of KRYPTONITE (KYP), or H3K9 methyltransferase from Arabidopsis [202,203].
In addition to constitutive CAMV35S, the expression of dCas9:EDLL and MS2:VPR could also be regulated by a copper-inducible promoter containing a cis-active motif named copper-binding site (CBS), recognized by the copper-responsive factor CUP2, fused to the yeast Gal4 domain [199]. The presented system enabled a 2600-fold increase in endogenous N. benthamiana DFR transcription, and a 245-fold increase in PAL2 gene expression, with only trace expression observed in the absence of copper ions [200]. Another approach to introducing inducibility into the orthogonal expression systems was proposed by Lopez-Salmeron et al. [240]. The authors developed an inducible, tissue-specific expression system based on the chimeric transcription factor LhG4 fused to the ligand binding domain of the rat corticoid receptor (GR), localized under the control of well-characterized, cell-type-specific promoters. In resting conditions, the GR domain is bound by the cytosolic HSP90, handling the transcription factor outside of the nucleus. After the addition of the synthetic ligand dexamethasone (Dex), nuclear translocation is induced, and LhG4 will mediate transcription of expression cassettes under the control of a synthetic pOp-type promoter [240].

6. Machine Learning and Deep Learning Support to Synthetic Promoter Preparation

The fast and accurate prediction of promoter strength remains challenging, resulting in time- and labor-consuming promoter construction and characterization. This challenge is mainly due to the shortfall of suitable high-throughput analytical methodology and the lack of a large promoter library with sufficient dynamic range, gradient strength, and clear sequence profiles to be used for machine learning (ML) [46]. ML approaches offer models that characterize the properties between synthetic promoter structure and functions [46,241]. This information broadens our understanding of gene regulation and points out new principles for later testing [242]. ML models such as linear regression and random forests combine input data, such as sequences of promoters, distribution of cis-active elements, DNA structural properties, position weight matrices, or k-mer frequencies, to obtain output information as the expression patterns of the corresponding synthetic promoters [46,48,50]. To better predict the synthetic promoter strength, the improved ML-based approach known as EVMP (extended vision mutant priority) system was developed. The EVMP uses better mutation information through the equivalent transformation of synthetic promoters into base promoters which are input into BaseEncoder and corresponding k-mer mutations, which are entered into VarEncoder. Therefore, the EVMP can significantly improve the prediction accuracy of promoter strength [243]. Advanced ML algorithms produce highly accurate models of gene expression, uncovering novel regulatory features in nucleotide sequences involving multiple cis-regulatory regions across whole genes and DNA structural properties. Among them are deep neural networks (DNN), containing multiple hidden layers, each learning an informative representation of DNA regulatory sequences [50].
The ML systems work with the large libraries of synthetic promoter variants and corresponding expression data [46]. The input/output data is then split into training and testing parts for building the model and the final validation. The ML model’s accuracy generally increases when a greater number of promoter sequences and corresponding RNA-seq, ATAC-seq, and self-transcribing active regulatory region sequencing (STARR-seq) data are applied [85,244]. However, such ML approaches cannot properly predict the properties of synthetic promoter sequences in the context of other regulatory elements such as the position of enhancers, 3′ and 5′UTRs, DNA methylation or histone acetylation status [50,245,246]. These details should be included in the more advanced form of ML, known as deep learning (DL), which uses multi-layer perceptron (MLP), convolutional neural networks (CNN) and generative adversarial networks (GAN) to analyze complex patterns and relationships in data [49,85,242,247,248,249,250]. DL models implemented in over 20,000 mRNA datasets in seven model organisms from bacteria to humans indicated that the expression of a gene is controlled not by a single regulatory motif or region, but by the entire gene regulatory structure and specific combinations of regulatory elements [49]. Among the different neural network architectures applied to obtain the presented results are the following: one to four CNN layers, one to two bidirectional recurrent neural networks (RNN) layers, and one to two fully connected (FC) layers. However, after concurrent and consecutive training of the presented networks by weight transfer on different variables, the best results were observed for a concurrently trained CNN (three layers)–FC (two layers) model [49].
The mutual limitation of ML and DL model development is that available ML and DL models are developed and trained on genomic DNA that is too short, evolution-constrained and has insufficient sequence diversity to learn all relevant parameters. However, synthetic, random DNA sequences can be used to test and train a larger sequence space as compared to the genome: ML models trained on these synthetic data can predict genomic activity better than genome-trained models [46,251]. Moreover, the DL algorithms usually neglect evolutionary processes within biological systems, often resulting in false positives and counterfeit interpretations. Among others, gene-family-guided splitting and ortholog contrasts can be used to include evolutionary significance in DL models. Analysis of the obtained model weight suggests that the 5′ UTR is more important for large-scale gene expression changes, while the 3′ UTR is more significant for fine-tuning mRNA levels [252].
Advanced ML and DL algorithms produce a large quantity of results which should be verified and validated experimentally. To meet such analytical requirements, high-throughput, automated methods of protoplast transformation were developed [253,254]. Moreover, the phenotypic properties of transformed protoplasts, expressing fluorescent proteins (FPs) could be studied by the fluorescence-inducing laser projector (FILP)-supported by an ultra-low-noise camera to resolve the individual FP’s patterns and to phenotype transgenic plants [255]. The application of this system enabled the study of 2000 synthetic promoters transfected into N. benthamiana protoplasts within several weeks [255].

7. Discussion

The properties of synthetic promoters and their applications have been described in several review articles [256,257,258,259,260,261]. However, research in this field is progressing rapidly, fueled by climate change, decreasing arable land area, and a fast-growing global population [1]. The presented processes increase the demand for the genetic modification of plant’s complex metabolic routes, which could be supported by synthetic promoters, enabling the precise spatiotemporal regulation of multiple transgenes [153,154,155,178,179,180]. Therefore, the presentation of the novel research results, combined with an individual perspective of the area, could add interesting features to the presented studies. Plant genetic modification by synthetic promoters is pivotal for introducing metabolic switches, and for enabling the development of novel, more efficient, or stress-resistant crop variants with outstanding characteristics or an increased biosynthesis rate of valuable metabolites [1,4,5,9,10].
Genetic modifications of common crop plants require the application of up to 15 different genes [12,13,152,155,158]. Their activity should be precisely regulated to adjust the right proportions between all transcripts within complex traits. Such a task is realized by synthetic promoter sets of exactly adjusted activities [195,197,198,199,200,201,202,203]. The precise regulation of co-expressed genes in complex metabolic traits by synthetic promoters of different strengths protects against imbalance in metabolite concentration, feedback regulation of induction and energy losses [27,178,194]. However, the repeated use of the same or related DNA native promoter sequences, combined with conventional, multi-round breeding techniques, results in homology-based gene silencing, plasmid instability, complex segregation patterns, and the random integration of multiple transgenes expressed at varied and poorly controlled levels [156,157,165,166]. Therefore, novel sets of synthetic promoters with low homology to those already existing are developed and applied to plant transformation [28,29,196,199,200,201]. Moreover, transgenes are generally stacked in a single construct controlled by a minimum number of synthetic promoters that should not be homologous to those already used in plant genetic modification [160,167,170,171,172]. This reduces the frequency and scale of complex segregation patterns and random integration into the plant genome [168,169]. This necessity for gene stacking, combined with the decreasing number of available native promoters, is addressed by a more broad development and application of synthetic bidirectional promoters that are relatively short and compact, enabling the expression and precise regulation of up to six–eight genes for each synthetic promoter [173,174,175,176,177,238]. A more common application of these promoters is supported by already available multicistronic vectors [170].
Therefore, the demand for novel synthetic promoters is still increasing, ordered by an increased rate of complex plant genetic modifications, requesting the application of more genes and their promoters for each transgenic plant [152,153,154,155]. They are typically obtained by hybridizing existing cis-active elements with other core promoters or by exchanging entire promoters as well as their domains [195,215,216,217,218,219,220,221,222]. Therefore, synthetic promoters fuse different domains or cis-regulatory elements with the core promoter, thus combining both tissue specificity and increased or precisely tuned expression in the same construct [85,178,180,181]. Cis-active elements are introduced according to their positions, copy number, distance, and orientation to promote optimum spacing among the cis-motifs and corresponding trans-factors, which could mutually interact and build functional di- or oligomer complexes [182,183,184,185,186,188]. The prepared synthetic promoters demonstrate different tissue specificities, as well as strengths, and inducibility properties to precisely control the co-expression of numerous genes in complex biosynthesis traits [189,190,191,192,193,194]. In addition to the exchange of domains or cis-elements, novel synthetic promoter variants can also be prepared by the introduction of genetic changes into existing cis-active elements and core promoters [89,214]. Usually, these approaches are based on error-prone PCR [204,205,206,207,208,209,210,211,212]. Larger libraries of synthetic promoters are obtained after repeated applications of directed evolution [213]. The further growth of libraries above 108 elements requires the application of synthetic DNA fragments not related to known DNA genome sequences [46]. However, the analysis of such large libraries usually employs ML or DL to identify relations between DNA sequence properties and promoter activity [46,50,241,242,243,251,262,263]. To improve these ML and DL approaches, they are trained on synthetic, random DNA fragments to test a larger sequence space; models trained on such synthetic data can predict genomic activity better than those solely trained on genome DNA [46,251]. More complex relationships between synthetic promoter structure, activity and DNA methylation or histone acetylation status are efficiently addressed by multilayered DL algorithms, while the ML models could not grasp these labyrinthine qualities precisely [242,247,248,249,250].
Usually, information obtained from the ML and DL methods is verified experimentally to test the accuracy of model predictions [213,264], and the repeated construction of ML/DL models followed by the experimental validation of the promoter properties has yielded stepwise improvement. Synthetic promoter libraries used in ML and DL architecture are not only of a large size but they need to indicate a sufficient dynamic range, gradient strength, and clear sequence profiles [46]. However, the large scale of the applied libraries requires the more broad application of high-throughput analytical tool methods, such as high-capacity protoplast transformation, combined with a fluorescence-inducing laser projector (FLIP) platform equipped with an ultra-low-noise camera; this has been used to discriminate between numerous fluorescent signatures under different stress conditions [253,254,255].
Besides the ML- and DL-dependent production and analysis of huge synthetic promoter libraries, synthetic promoters are also developed on the basis of orthogonal expression systems. The main advantage of these systems is the general lack of similarity with existing DNA promoter sequences, resulting in low homology-based gene silencing [28,29,186,198]. Moreover, trans-factors recognizing them are also synthetic, built from elements obtained from yeast, bacteria and plants, enabling the complete decoupling of the transgenes transcriptional regulation from those endogenous to the genome [28]. Transcriptional activity of orthogonal expression systems could be precisely tuned and accustomed to use in complex logic gates to provide a very precise control of complex genetic circuits [28,29,201,202,203].

8. Conclusions and Future Directions

Future research should aim to clarify the informative content of cis-elements and their relations with chromatin architecture using a broader application of DL, supported by large enough libraries of appropriate dynamic range, gradient strength, and clear sequence profiles. Moreover, the development of more efficient methods of analyzing large-scale synthetic promoter libraries as high-capacity protoplast transformation and FLIP platform should be encouraged. Furthermore, the development of novel synthetic promoters, which is already supported by ML and DL algorithms, should be less reliant on evolution-dependent and relatively low-complexity genomic DNA sequences. Therefore, more research is needed on the promoters which are completely synthetic and independent of genomic DNA, as this can be used to develop and train more reliable ML and DL models to avoid evolution-based biases in genome DNA. The improved ML and DL systems could further support the expansion and enrichment of well characterized artificial promoter libraries. These developments will increase the understanding of complex, multilayered regulatory mechanisms governing gene expression control. Moreover, the growing population of different, non-homologous plant synthetic promoters of strictly characterized properties will augment the development of complex plant modifications, stripped of common limitations induced by a frequent application of small-size, native promoter sets.

Author Contributions

Conceptualization, writing—original draft preparation, P.S.; visualization, writing—review and editing M.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by statutory funds of the Department of Biology and Pharmaceutical Botany at the Medical University of Łódź (503/3-012-01/503-31-001-19-00).

Acknowledgments

Authors are very grateful to Edward Lowczowski, a native English speaker from Foreign Language Center at Medical University of Łódź (Poland) for performing the proofreading of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Henry, R.J. Innovations in plant genetics adapting agriculture to climate change. Curr. Opin. Plant Biol. 2020, 56, 168–173. [Google Scholar] [CrossRef] [PubMed]
  2. Liu, B.R.; Chen, C.W.; Huang, Y.W.; Lee, H.J. Cell-Penetrating Peptides for Use in Development of Transgenic Plants. Molecules 2023, 28, 3367. [Google Scholar] [CrossRef] [PubMed]
  3. Srivastava, A.; Jain, G.; Sushmita; Chandra, S.; Kalia, V.; Upadhyay, S.K.; Dubey, R.S.; Verma, P.C. Failure of metanol detoxification in pests confers broad spectrum insect resistance in PME overexpressing transgenic cotton. Plant Sci. 2023, 333, 111737. [Google Scholar] [CrossRef] [PubMed]
  4. Li, B.; Chen, Z.; Chen, H.; Wang, C.; Song, L.; Sun, Y.; Cai, Y.; Zhou, D.; Ouyang, L.; Zhu, C.; et al. Stacking Multiple Genes Improves Resistance to Chilo suppressalis, Magnaporthe oryzae, and Nilaparvata lugens in Transgenic Rice. Genes 2023, 14, 1070. [Google Scholar] [CrossRef] [PubMed]
  5. Carrière, Y.; Degain, B.; Unnithan, G.C.; Tabashnik, B.E. Inheritance and fitness cost of laboratory-selected resistance to Vip3Aa in Helicoverpa zea (Lepidoptera: Noctuidae). J. Econ. Entomol. 2023, 116, 1804–1811. [Google Scholar] [CrossRef] [PubMed]
  6. Lithanatudom, P.; Chawansuntati, K.; Saenjum, C.; Chaowasku, T.; Rattanathammethee, K.; Wungsintaweekul, B.; Osathanunkul, M.; Wipasa, J. In-vitro antimalarial activity of metanolic leaf- and stem-derived extracts from four Annonaceae plants. BMC Res. Notes 2023, 16, 381. [Google Scholar] [CrossRef] [PubMed]
  7. Al-Khayri, J.M.; Sudheer, W.N.; Banadka, A.; Lakshmaiah, V.V.; Nagella, P.; Al-Mssallem, M.Q.; Alessa, F.M.; Rezk, A.A. Biotechnological approaches for the production of gymnemic acid from Gymnema sylvestre R. Br. Appl. Microbiol. Biotechnol. 2023, 107, 4459–4469. [Google Scholar] [CrossRef] [PubMed]
  8. Wei, J.Z.; Lum, A.; Schepers, E.; Liu, L.; Weston, R.T.; McGinness, B.S.; Heckert, M.J.; Xie, W.; Kassa, A.; Bruck, D.; et al. Novel insecticidal proteins from ferns resemble insecticidal proteins from Bacillus thuringiensis. Proc. Natl. Acad. Sci. USA 2023, 120, e2306177120. [Google Scholar] [CrossRef] [PubMed]
  9. Chae, H.; Wen, Z.; Hootman, T.; Himes, J.; Duan, Q.; McMath, J.; Ditillo, J.; Sessler, R.; Conville, J.; Niu, Y.; et al. eCry1Gb.1Ig, A Novel Chimeric Cry Protein with High Efficacy against Multiple Fall Armyworm (Spodoptera frugiperda) Strains Resistant to Different GM Traits. Toxins 2022, 14, 852. [Google Scholar] [CrossRef]
  10. Li, C.; Zhang, J.; Ren, Z.; Xie, R.; Yin, C.; Ma, W.; Zhou, F.; Chen, H.; Lin, Y. Development of ‘multiresistance rice’ by an assembly of herbicide, insect and disease resistance genes with a transgene stacking system. Pest. Manag. Sci. 2021, 77, 1536–1547. [Google Scholar] [CrossRef]
  11. Dong, Y.; Ng, E.; Lu, J.; Fenwick, T.; Tao, Y.; Bertain, S.; Sandoval, M.; Bermudez, E.; Hou, Z.; Patten, P.; et al. Desensitizing plant EPSP synthase to glyphosate: Optimized global sequence context accommodates a glycine-to-alanine change in the active site. J. Biol. Chem. 2019, 294, 716–725. [Google Scholar] [CrossRef] [PubMed]
  12. Ha, S.H.; Kim, J.K.; Jeong, Y.S.; You, M.K.; Lim, S.H.; Kim, J.K. Stepwise pathway engineering to the biosynthesis of zeaxanthin, astaxanthin and capsanthin in rice endosperm. Metab. Eng. 2019, 52, 178–189. [Google Scholar] [CrossRef] [PubMed]
  13. Zhu, Q.; Zeng, D.; Yu, S.; Cui, C.; Li, J.; Li, H.; Chen, J.; Zhang, R.; Zhao, X.; Chen, L.; et al. From Golden Rice to aSTARice: Bioengineering Astaxanthin Biosynthesis in Rice Endosperm. Mol. Plant. 2018, 11, 1440–1448. [Google Scholar] [CrossRef] [PubMed]
  14. Moghissi, A.A.; Pei, S.; Liu, Y. Golden rice: Scientific, regulatory and public information processes of a genetically modified organism. Crit. Rev. Biotechnol. 2016, 36, 535–541. [Google Scholar] [CrossRef] [PubMed]
  15. Welsch, R.; Li, L. Golden Rice-Lessons learned for inspiring future metabolic engineering strategies and synthetic biology solutions. Methods Enzymol. 2022, 671, 1–29. [Google Scholar] [CrossRef] [PubMed]
  16. Oyediran, I.; Rice, M.E.; Conville, J.; Boudreau, E.; Morsello, S.; Burd, T. Btcorn hybrids expressing mCry3A and eCry3.1Ab Proteins protect cornroots against western cornroot worm injury. Pest. Manag. Sci. 2023, 79, 4839–4846. [Google Scholar] [CrossRef] [PubMed]
  17. Liu, L.; Zhang, L.; Fu, J.; Shen, W.; Fang, Z.; Dai, Y.; Jia, R.; Liu, B.; Liang, J. Fitness and Ecological Risk of Hybrid Progenies of Wild and Herbicide-Tolerant Soybeans With EPSPS Gene. Front. Plant Sci. 2022, 13, 922215. [Google Scholar] [CrossRef] [PubMed]
  18. Fu, J.; Liu, B.; Liu, L.; Fang, Z. Fitness of Insect-resistant transgenic rice T1C-19 under four growing conditions combining land use and weed competition. GM Crops Food 2021, 12, 328–341. [Google Scholar] [CrossRef] [PubMed]
  19. Ohnishi, Y.; Kawashima, T. Evidence of a novel silencing effect on transgenes in the Arabidopsisthaliana sperm cell. Plant Cell 2023, 35, 3926–3936. [Google Scholar] [CrossRef]
  20. Ravanrouy, F.; Niazi, A.; Moghadam, A.; Taghavi, S.M. MAP30 transgenic tobacco lines: From silencing to inducing. Mol. Biol. Rep. 2021, 48, 6719–6728. [Google Scholar] [CrossRef]
  21. Hendrix, B.; Hoffer, P.; Sanders, R.; Schwartz, S.; Zheng, W.; Eads, B.; Taylor, D.; Deikman, J. Systemic GFP silencing is associated with high transgene expression in Nicotiana benthamiana. PLoS ONE 2021, 16, e0245422. [Google Scholar] [CrossRef]
  22. Wang, W.; Wu, Y.; Shi, R.; Sun, M.; Li, Q.; Zhang, G.; Wu, J.; Wang, Y.; Wang, W. Overexpression of wheat α-mannosidase gene TaMP impairs salt tolerance in transgenic Brachypodium distachyon. Plant Cell Rep. 2020, 39, 653–667. [Google Scholar] [CrossRef]
  23. Abdeen, A.; Miki, B. The pleiotropic effects of the bar gene and glufosinate on the Arabidopsis transcriptome. Plant Biotechnol. J. 2009, 7, 266–282. [Google Scholar] [CrossRef]
  24. Tan, S.; Cao, J.; Xia, X.; Li, Z. Advances in 5-Aminolevulinic Acid Priming to Enhance Plant Tolerance to Abiotic Stress. Int. J. Mol. Sci. 2022, 23, 702. [Google Scholar] [CrossRef]
  25. Li, C. Breeding crops by design for future agriculture. J. Zhejiang Univ. Sci. B 2020, 21, 423–425. [Google Scholar] [CrossRef]
  26. Rajani, M.S.; Bedair, M.F.; Li, H.; Duff, S.M.G. Phenotypic effects from the expression of a deregulated AtGAD1 transgene and GABA pathway suppression mutants in maize. PLoS ONE 2021, 16, e0259365. [Google Scholar] [CrossRef]
  27. Xiang, X.; Hu, B.; Pu, Z.; Wang, L.; Leustek, T.; Li, C. Co-overexpression of AtSAT1 and EcPAPR improves seed nutritional value in maize. Front. Plant Sci. 2022, 13, 969763. [Google Scholar] [CrossRef]
  28. Belcher, M.S.; Vuu, K.M.; Zhou, A.; Mansoori, N.; Ramos, A.A.; Thompson, M.G.; Scheller, H.V.; Loqué, D.; Shih, P.M. Design of orthogonal regulatory systems for modulating gene expression in plants. Nat. Chem. Biol. 2020, 16, 857–865. [Google Scholar] [CrossRef]
  29. Brophy, J.A.N.; Magallon, K.J.; Duan, L.; Zhong, V.; Ramachandran, P.; Kniazev, K.; Dinneny, J.R. Synthetic genetic circuits as a means of reprogramming plant roots. Science 2022, 377, 747–751. [Google Scholar] [CrossRef]
  30. Villao-Uzho, L.; Chávez-Navarrete, T.; Pacheco-Coello, R.; Sánchez-Timm, E.; Santos-Ordóñez, E. Plant Promoters: Their Identification, Characterization, and Role in Gene Regulation. Genes 2023, 14, 1226. [Google Scholar] [CrossRef]
  31. Strader, L.; Weijers, D.; Wagner, D. Plant transcription factors—Being in the right place with the right company. Curr. Op. Plant Biol. 2022, 65, 102136. [Google Scholar] [CrossRef]
  32. Biłas, R.; Szafran, K.; Hnatuszko-Konka, K.; Kononowicz, A.K. Cis-regulatory elements used to control gene expression in plants. Plant Cell Tiss. Organ. Cult. 2016, 127, 269–287. [Google Scholar] [CrossRef]
  33. Majewska, M.; Wysokińska, H.; Kuźma, Ł.; Szymczyk, P. Eukaryotic and prokaryotic promoter databases as valuable tools in exploring the regulation of gene transcription: A comprehensive overview. Gene 2018, 644, 38–48. [Google Scholar] [CrossRef]
  34. Chen, J.; Yang, S.; Fan, B.; Zhu, C.; Chen, Z. The Mediator Complex: A Central Coordinator of Plant Adaptive Responses to Environmental Stresses. Int. J. Mol. Sci. 2022, 23, 6170. [Google Scholar] [CrossRef]
  35. O’Malley, R.C.; Huang, S.C.; Song, L.; Lewsey, M.G.; Bartlett, A.; Nery, J.R.; Galli, M.; Gallavotti, A.; Ecker, J.R. Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape. Cell 2016, 165, 1280–1292, Erratum in Cell 2016, 166, 1598. [Google Scholar] [CrossRef]
  36. Eyboulet, F.; Wydau-Dematteis, S.; Eychenne, T.; Alibert, O.; Neil, H.; Boschiero, C.; Nevers, M.C.; Volland, H.; Cornu, D.; Redeker, V.; et al. Mediator independently orchestrates multiple steps of preinitiation complex assembly in vivo. Nucleic Acids Res. 2015, 43, 9214–9231. [Google Scholar] [CrossRef]
  37. Eychenne, T.; Novikova, E.; Barrault, M.B.; Alibert, O.; Boschiero, C.; Peixeiro, N.; Cornu, D.; Redeker, V.; Kuras, L.; Nicolas, P.; et al. Functional interplay between Mediator and TFIIB in preinitiation complex assembly in relation to promoter architecture. Genes. Dev. 2016, 30, 2119–2132. [Google Scholar] [CrossRef]
  38. Nguyen, V.Q.; Ranjan, A.; Liu, S.; Tang, X.; Ling, Y.; Wisniewski, J.; Mizuguchi, G.; Li, K.Y.; Jou, V.; Zheng, Q.; et al. Spatiotemporal coordination of transcription preinitiation complex assembly in live cells. Mol. Cell 2021, 81, 3560–3575.e6. [Google Scholar] [CrossRef]
  39. Xiao, J.; Jin, R.; Yu, X.; Shen, M.; Wagner, J.D.; Pai, A.; Song, C.; Zhuang, M.; Klasfeld, S.; He, C.; et al. Cis and trans determinants of epigenetic silencing by Polycomb repressive complex 2 in Arabidopsis. Nat. Genet. 2017, 49, 1546–1552. [Google Scholar] [CrossRef] [PubMed]
  40. Bharti, K.; Von Koskull-Döring, P.; Bharti, S.; Kumar, P.; Tintschl-Körbitzer, A.; Treuter, E.; Nover, L. Tomato heat stress transcription factor HsfB1 represents a novel type of general transcription coactivator with a histone-like motif interacting with the plant CREB binding protein ortholog HAC1. Plant Cell 2004, 16, 1521–1535. [Google Scholar] [CrossRef] [PubMed]
  41. Mao, Y.; Pavangadkar, K.A.; Thomashow, M.F.; Triezenberg, S.J. Physical and functional interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold-induced transcription factor CBF1. Biochim. Biophys. Acta 2006, 1759, 69–79. [Google Scholar] [CrossRef] [PubMed]
  42. Kong, L.; Zhi, P.; Liu, J.; Li, H.; Zhang, X.; Xu, J.; Zhou, J.; Wang, X.; Chang, C. Epigenetic Activation of Enoyl-CoA Reductase By An Acetyltransferase Complex Triggers Wheat Wax Biosynthesis. Plant Physiol. 2020, 183, 1250–1267. [Google Scholar] [CrossRef] [PubMed]
  43. Louphrasitthiphol, P.; Siddaway, R.; Loffreda, A.; Pogenberg, V.; Friedrichsen, H.; Schepsky, A.; Zeng, Z.; Lu, M.; Strub, T.; Freter, R.; et al. Tuning transcription factor availability through acetylation-mediated genomic redistribution. Mol. Cell 2020, 79, 472–487.e10. [Google Scholar] [CrossRef] [PubMed]
  44. Grau, J.; Schmidt, F.; Schulz, M.H. Widespread effects of DNA methylation and intra-motif dependencies revealed by novel transcription factor binding models. Nucleic Acids Res. 2023, 51, e95. [Google Scholar] [CrossRef] [PubMed]
  45. Fontana, M.; Roosjen, M.; Crespo García, I.; van den Berg, W.; Malfois, M.; Boer, R.; Weijers, D.; Hohlbein, J. Cooperative action of separate interaction domains promotes high-affinity DNA binding of Arabidopsis thaliana ARF transcription factors. Proc. Natl. Acad. Sci. USA 2023, 120, e2219916120. [Google Scholar] [CrossRef] [PubMed]
  46. de Boer, C.G.; Vaishnav, E.D.; Sadeh, R.; Abeyta, E.L.; Friedman, N.; Regev, A. Deciphering eukaryotic gene-regulatory logic with 100 million random promoters. Nat. Biotechnol. 2020, 38, 56–65. [Google Scholar] [CrossRef] [PubMed]
  47. Shahein, A.; López-Malo, M.; Istomin, I.; Olson, E.J.; Cheng, S.; Maerkl, S.J. Systematic analysis of low-affinity transcription factor binding site clusters in vitro and in vivo establishes their functional relevance. Nat. Commun. 2022, 13, 5273. [Google Scholar] [CrossRef] [PubMed]
  48. Sielemann, J.; Wulf, D.; Schmidt, R.; Bräutigam, A. Local DNA shape is a general principle of transcription factor binding specificity in Arabidopsis thaliana. Nat. Commun. 2021, 12, 6549. [Google Scholar] [CrossRef] [PubMed]
  49. Zrimec, J.; Börlin, C.S.; Buric, F.; Muhammad, A.S.; Chen, R.; Siewers, V.; Verendel, V.; Nielsen, J.; Töpel, M.; Zelezniak, A. Deep learning suggests that gene expression is encoded in all parts of a co-evolving interacting gene regulatory structure. Nat. Commun. 2020, 11, 6141. [Google Scholar] [CrossRef] [PubMed]
  50. Zrimec, J.; Zelezniak, A.; Gruden, K. Toward learning the principles of plant gene regulation. Trends Plant Sci. 2022, 12, 1206–1208. [Google Scholar] [CrossRef]
  51. Pérez-González, A.; Caro, E. Effect of transcription terminator usage on the establishment of transgene transcriptional gene silencing. BMC Res. Notes 2018, 11, 511. [Google Scholar]
  52. De Felippes, F.; McHale, M.; Doran, R.L.; Roden, S.; Eamens, A.L.; Finnegan, E.J.; Waterhouse, P.M. The key role of terminators on the expression and post-transcriptional gene silencing of transgenes. Plant J. 2020, 104, 96–112. [Google Scholar] [CrossRef]
  53. Das, S.; Bansal, M. Variation of gene expression in plants is influenced by gene architecture and structural properties of promoters. PLoS ONE 2019, 14, e0212678. [Google Scholar] [CrossRef]
  54. Kurbidaeva, A.; Purugganan, M. Insulators in Plants: Progress and Open Questions. Genes 2021, 12, 1422. [Google Scholar] [CrossRef] [PubMed]
  55. Chico, J.M.; Lechner, E.; Fernandez-Barbero, G.; Canibano, E.; García-Casado, G.; Franco-Zorrilla, J.M.; Hammann, P.; Zamarreño, A.M.; García-Mina, J.M.; Rubio, V.; et al. CUL3BPM E3 ubiquitin ligases regulate MYC2, MYC3, and MYC4 stability and JA responses. Proc. Natl. Acad. Sci. USA 2020, 117, 6205–6215. [Google Scholar] [CrossRef]
  56. Huang, W.; Miao, M.; Kud, J.; Niu, X.; Ouyang, B.; Zhang, J.; Ye, Z.; Kuhl, J.C.; Liu, Y.; Xiao, F. SlNAC1, a stress-related transcription factor, is fine-tuned on both the transcriptional and the post-translational level. New Phytol. 2013, 197, 1214–1224, Erratum in New Phytol. 2013, 200, 284. [Google Scholar] [CrossRef]
  57. Fan, B.; Liao, K.; Wang, L.N.; Shi, L.L.; Zhang, Y.; Xu, L.J.; Zhou, Y.; Li, J.F.; Chen, Y.Q.; Chen, Q.F.; et al. Calcium-dependent activation of CPK12 facilitates its cytoplasm-to-nucleus translocation to potentiate plant hypoxia sensing by phosphorylating ERF-VII transcription factors. Mol. Plant 2023, 16, 979–998. [Google Scholar] [CrossRef]
  58. Song, J.; Lin, R.; Tang, M.; Wang, L.; Fan, P.; Xia, X.; Yu, J.; Zhou, Y. SlMPK1- and SlMPK2-mediated SlBBX17 phosphorylation positively regulates CBF-dependent cold tolerance in tomato. New Phytol 2023, 239, 1887–1902. [Google Scholar] [CrossRef]
  59. Wu, C.J.; Shan, W.; Liu, X.C.; Zhu, L.S.; Wei, W.; Yang, Y.Y.; Guo, Y.F.; Bouzayen, M.; Chen, J.Y.; Lu, W.J.; et al. Phosphorylation of transcription factor bZIP21 by MAP kinase MPK6-3 enhances banana fruit ripening. Plant Physiol. 2022, 188, 1665–1685. [Google Scholar] [CrossRef] [PubMed]
  60. Eisner, N.; Maymon, T.; Sanchez, E.C.; Bar-Zvi, D.; Brodsky, S.; Finkelstein, R.; Bar-Zvi, D. Phosphorylation of Serine 114 of the transcription factor ABSCISIC ACID INSENSITIVE 4 is essential for activity. Plant Sci. 2021, 305, 110847. [Google Scholar] [CrossRef]
  61. Jantz, D.; Berg, J.M. Reduction in DNA-binding affinity of Cys2His2 zinc finger proteins by linker phosphorylation. Proc. Natl. Acad. Sci. USA 2004, 101, 7589–7593. [Google Scholar] [CrossRef] [PubMed]
  62. Viana, A.J.C.; Matiolli, C.C.; Newman, D.W.; Vieira, J.G.P.; Duarte, G.T.; Martins, M.C.M.; Gilbault, E.; Hotta, C.T.; Caldana, C.; Vincentz, M. The sugar-responsive circadian clock regulator bZIP63 modulates plant growth. New Phytol. 2021, 231, 1875–1889. [Google Scholar] [CrossRef] [PubMed]
  63. Frank, A.; Matiolli, C.C.; Viana, A.J.C.; Hearn, T.J.; Kusakina, J.; Belbin, F.E.; Newman, D.W.; Yochikawa, A.; Cano-Ramirez, D.L.; Chembath, A.; et al. Circadian Entrainment in Arabidopsis by the Sugar-Responsive Transcription Factor bZIP63. Curr. Biol. 2018, 28, 2597–2606.e6. [Google Scholar] [CrossRef] [PubMed]
  64. Muralidhara, P.; Weiste, C.; Collani, S.; Krischke, M.; Kreisz, P.; Draken, J.; Feil, R.; Mair, A.; Teige, M.; Müller, M.J.; et al. Perturbations in plant energy homeostasis prime lateral root initiation via SnRK1-bZIP63-ARF19 signaling. Proc. Natl. Acad. Sci. USA 2021, 118, e2106961118. [Google Scholar] [CrossRef] [PubMed]
  65. Chen, X.; Neuwald, A.F.; Hilakivi-Clarke, L.; Clarke, R.; Xuan, J. ChIP-GSM: Inferring active transcription factor modules to predict functional regulatory elements. PLoS Comput. Biol. 2021, 17, e1009203. [Google Scholar]
  66. Ni, P.; Su, Z. PCRMS: A database of predicted cis-regulatory modules and constituent transcription factor binding sites in genomes. Database 2022, 2022, baac024. [Google Scholar] [PubMed]
  67. Amoutzias, G.D.; Robertson, D.L.; Van de Peer, Y.; Oliver, S.G. Choose your partners: Dimerization in eukaryotic transcription factors. Trends Biochem. Sci. 2008, 33, 220–229. [Google Scholar] [PubMed]
  68. Freire-Rios, A.; Tanaka, K.; Crespo, I.; van der Wijk, E.; Sizentsova, Y.; Levitsky, V.; Lindhoud, S.; Fontana, M.; Hohlbein, J.; Boer, D.R.; et al. Architecture of DNA elements mediating ARF transcription factor binding and auxin-responsive gene expression in Arabidopsis. Proc. Natl. Acad. Sci. USA 2020, 117, 24557–24566. [Google Scholar] [PubMed]
  69. Kumar, S.; Zavaliev, R.; Wu, Q.; Zhou, Y.; Cheng, J.; Dillard, L.; Powers, J.; Withers, J.; Zhao, J.; Guan, Z.; et al. Structural basis of NPR1 in activating plant immunity. Nature 2022, 605, 561–566. [Google Scholar] [CrossRef]
  70. Shi, X.; Che, Z.; Xu, G.; Ming, Z. Crystal structure of transcription factor TGA7 from Arabidopsis. Biochem. Biophys. Res. Commun. 2022, 637, 322–330. [Google Scholar] [CrossRef]
  71. Lee, H.W.; Kang, N.Y.; Pandey, S.K.; Cho, C.; Lee, S.H.; Kim, J. Dimerization in LBD16 and LBD18 transcription factors is critical for lateral root formation. Plant Physiol. 2017, 174, 301–311. [Google Scholar] [CrossRef]
  72. Liu, H.; Gao, J.; Sun, J.; Li, S.; Zhang, B.; Wang, Z.; Zhou, C.; Sulis, D.B.; Wang, J.P.; Chiang, V.L.; et al. Dimerization of PtrMYB074 and PtrWRKY19 mediates transcriptional activation of PtrbHLH186 for secondary xylem development in Populus trichocarpa. New Phytol. 2022, 234, 918–933. [Google Scholar] [CrossRef]
  73. Blanchette, M.; Bataille, A.R.; Chen, X.; Poitras, C.; Laganiere, J.; Lefebvre, C.; Deblois, G.; Giguere, V.; Ferretti, V.; Lefèbvre, C.; et al. Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression. Genome Res. 2006, 16, 656–668. [Google Scholar]
  74. Leivar, P.; Antolín-Llovera, M.; Ferrero, S.; Closa, M.; Arró, M.; Ferrer, A.; Boronat, A.; Campos, N. Multilevel control of Arabidopsis 3-hydroxy-3-methylglutaryl coenzyme A reductase by protein phosphatase 2A. Plant Cell 2011, 23, 1494–1511. [Google Scholar]
  75. Xu, Z.; Guo, W.; Mo, B.; Pan, Q.; Lu, J.; Wang, Z.; Peng, X.; Zhang, Z. Mitogen-activated protein kinase 2 specifically regulates photorespiration in rice. Plant Physiol. 2023, 193, 1381–1394. [Google Scholar] [CrossRef]
  76. Xin, X.; Wei, D.; Lei, L.; Zheng, H.; Wallace, I.S.; Li, S.; Gu, Y. CALCIUM-DEPENDENT PROTEIN KINASE32 regulates cellulose biosynthesis through post-translational modification of cellulose synthase. New Phytol. 2023, 239, 2212–2224. [Google Scholar] [CrossRef]
  77. Zhong, V.; Archibald, B.N.; Brophy, J.A.N. Transcriptional and post-transcriptional controls for tuning gene expression in plants. Curr. Opin. Plant Biol. 2023, 71, 102315. [Google Scholar] [CrossRef]
  78. Shrestha, A.; Khan, A.; Dey, N. cis-trans Engineering: Advances and Perspectives on Customized Transcriptional Regulation in Plants. Mol. Plant. 2018, 11, 886–898. [Google Scholar] [CrossRef]
  79. Normantovich, M.; Amitzur, A.; Offri, S.; Pashkovsky, E.; Shnaider, Y.; Nizan, S.; Yogev, O.; Jacob, A.; Taylor, C.G.; Desbiez, C.; et al. The melon Fom-1-Prv. resistance gene pair: Correlated spatial expression and interaction with a viral protein. Plant Direct. 2024, 8, e565. [Google Scholar] [CrossRef]
  80. Kristiansson, E.; Thorsen, M.; Tamás, M.J.; Nerman, O. Evolutionary forces act on promoter length: Identification of enriched cis-regulatory elements. Mol. Biol. Evol. 2009, 26, 1299–1307. [Google Scholar] [CrossRef]
  81. Roy, A.L.; Singer, D.S. Core promoters in transcription: Old problem, new insights. Trends Biochem. Sci. 2015, 40, 165–171. [Google Scholar] [CrossRef]
  82. Mathis, D.J.; Chambon, P. The SV40 early region TATA box is required for accurate in vitro initiation of transcription. Nature 1981, 290, 310–315. [Google Scholar] [CrossRef]
  83. Molina, C.; Grotewold, E. Genome wide analysis of Arabidopsis core promoters. BMC Genom. 2005, 6, 25. [Google Scholar] [CrossRef]
  84. Murray, A.; Mendieta, J.P.; Vollmers, C.; Schmitz, R.J. Simple and accurate transcriptional start site identification using Smar2C2 and examination of conserved promoter features. Plant J. 2022, 112, 583–596. [Google Scholar] [CrossRef]
  85. Jores, T.; Tonnies, J.; Wrightsman, T.; Buckler, E.S.; Cuperus, J.T.; Fields, S.; Queitsch, C. Synthetic promoter designs enabled by a comprehensive analysis of plant core promoters. Nat. Plants 2021, 7, 842–855. [Google Scholar] [CrossRef]
  86. Loganantharaj, R. Discriminating TATA box from putative TATA boxes in plant genome. Int. J. Bioinform. Res. Appl. 2006, 2, 36–51. [Google Scholar] [CrossRef]
  87. Joshi, C.P. An inspection of the domain between putative TATA box and translation start site in 79 plant genes. Nucleic Acids Res. 1987, 15, 6643–6653. [Google Scholar] [CrossRef]
  88. Savinkova, L.K.; Sharypova, E.B.; Kolchanov, N.A. On the Role of TATA Boxes and TATA-Binding Protein in Arabidopsis thaliana. Plants 2023, 12, 1000. [Google Scholar] [CrossRef]
  89. Amack, S.C.; Ferreira, S.S.; Antunes, M.S. Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box. ACS Synth. Biol. 2023, 12, 178–185. [Google Scholar] [CrossRef]
  90. Nakamura, M.; Tsunoda, T.; Obokata, J. Photosynthesis nuclear genes generally lack TATA-boxes: A tobacco photosystem I gene responds to light through an initiator. Plant J. 2002, 29, 1–10. [Google Scholar] [CrossRef]
  91. Achard, P.; Lagrange, T.; El-Zanaty, A.F.; Mache, R. Architecture and transcriptional activity of the initiator element of the TATA-less RPL21 gene. Plant J. 2003, 35, 743–752. [Google Scholar] [CrossRef]
  92. Kiran, K.; Ansari, S.A.; Srivastava, R.; Lodhi, N.; Chaturvedi, C.P.; Sawant, S.V.; Tuli, R. The TATA-box sequence in the basal promoter contributes to determining light-dependent gene expression in plants. Plant Physiol. 2006, 142, 364–376. [Google Scholar] [CrossRef]
  93. Civán, P.; Svec, M. Genome-wide analysis of rice (Oryza sativa L. subsp. japonica) TATA box and Y Patch promoter elements. Genome 2009, 52, 294–297. [Google Scholar] [CrossRef]
  94. Zhang, Y.; Yuan, Y.; Xi, H.; Zhang, Y.; Gao, C.; Ma, M.; Huang, Q.; Li, F.; Yang, Z. Promotion of apoplastic oxidative burst by artificially selected GhCBSX3A enhances Verticillium dahliae resistance in upland cotton. Plant J. 2024. [Google Scholar] [CrossRef]
  95. Shahmuradov, I.A.; Gammerman, A.J.; Hancock, J.M.; Bramley, P.M.; Solovyev, V.V. PlantProm: A database of plant promoter sequences. Nucleic Acids Res. 2003, 31, 114–117. [Google Scholar] [CrossRef]
  96. Yamamoto, Y.Y.; Ichida, H.; Matsui, M.; Obokata, J.; Sakurai, T.; Satou, M.; Seki, M.; Shinozaki, K.; Abe, T. Identification of plant promoter constituents by analysis of local distribution of short sequences. BMC Genom. 2007, 8, 67. [Google Scholar] [CrossRef]
  97. Burke, T.W.; Kadonaga, J.T. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes. Dev. 1997, 11, 3020–3031. [Google Scholar] [CrossRef]
  98. Yamamoto, Y.Y.; Ichida, H.; Abe, T.; Suzuki, Y.; Sugano, S.; Obokata, J. Differentiation of core promoter architecture between plants and mammals revealed by LDSS analysis. Nucleic Acids Res. 2007, 35, 6219–6226. [Google Scholar] [CrossRef]
  99. Srivastava, R.; Rai, K.M.; Srivastava, M.; Kumar, V.; Pandey, B.; Singh, S.P.; Bag, S.K.; Singh, B.D.; Tuli, R.; Sawant, S.V. Distinct role of core promoter architecture in regulation of light-mediated responses in plant genes. Mol. Plant 2014, 7, 626–641. [Google Scholar] [CrossRef]
  100. Yamamoto, Y.Y.; Yoshioka, Y.; Hyakumachi, M.; Obokata, J. Characteristics of core promoter types with respect to gene structure and expression in Arabidopsis thaliana. DNA Res. 2011, 18, 333–342. [Google Scholar] [CrossRef]
  101. Yamamoto, Y.Y.; Yoshitsugu, T.; Sakurai, T.; Seki, M.; Shinozaki, K.; Obokata, J. Heterogeneity of Arabidopsis core promoters revealed by high-density TSS analysis. Plant J. 2009, 60, 350–362. [Google Scholar] [CrossRef]
  102. Kudo, H.; Matsuo, M.; Satoh, S.; Hata, T.; Hachisu, R.; Nakamura, M.; Yamamoto, Y.Y.; Kimura, H.; Matsui, M.; Obokata, J. Cryptic promoter activation occurs by at least two different mechanisms in the Arabidopsis genome. Plant J. 2021, 108, 29–39. [Google Scholar] [CrossRef]
  103. Yang, E.J.Y.; Maranas, C.J.; Nemhauser, J.L. A comparative analysis of stably expressed genes across diverse angiosperms exposes flexibility in underlying promoter architecture. G3 2023, 13, jkad206. [Google Scholar] [CrossRef]
  104. Kumari, S.; Ware, D. Genome-wide computational prediction and analysis of core promoter elements across plant monocots and dicots. PLoS ONE 2013, 8, e79011. [Google Scholar] [CrossRef]
  105. Chaves-Sanjuan, A.; Gnesutta, N.; Gobbini, A.; Martignago, D.; Bernardini, A.; Fornara, F.; Mantovani, R.; Nardini, M. Structural determinants for NF-Y subunit organization and NF-Y/DNA association in plants. Plant J. 2021, 105, 49–61. [Google Scholar] [CrossRef]
  106. Laloum, T.; De Mita, S.; Gamas, P.; Baudin, M.; Niebel, A. CCAAT-box binding transcription factors in plants: Y so many? Trends Plant Sci. 2013, 18, 157–166. [Google Scholar] [CrossRef]
  107. Calvenzani, V.; Testoni, B.; Gusmaroli, G.; Lorenzo, M.; Gnesutta, N.; Petroni, K.; Mantovani, R.; Tonelli, C. Interactions and CCAAT-binding of Arabidopsis thaliana NF-Y subunits. PLoS ONE 2012, 7, e42902. [Google Scholar] [CrossRef]
  108. Lu, L.; Wei, W.; Tao, J.J.; Lu, X.; Bian, X.H.; Hu, Y.; Cheng, T.; Yin, C.C.; Zhang, W.K.; Chen, S.Y.; et al. Nuclear factor Y subunit GmNFYA competes with GmHDA13 for interaction with GmFVE to positively regulate salt tolerance in soybean. Plant Biotechnol. J. 2021, 19, 2362–2379. [Google Scholar] [CrossRef]
  109. Yu, C.P.; Lin, J.J.; Li, W.H. Positional distribution of transcription factor binding sites in Arabidopsis thaliana. Sci. Rep. 2016, 6, 25164. [Google Scholar] [CrossRef]
  110. Mironova, V.V.; Omelyanchuk, N.A.; Wiebe, D.S.; Levitsky, V.G. Computational analysis of auxin responsive elements in the Arabidopsis thaliana L. genome. BMC Genom. 2014, 15, S4. [Google Scholar] [CrossRef]
  111. Solovyev, V.V.; Shahmuradov, I.A.; and Salamov, A.A. Identification of promoter regions and regulatory sites. In Computational Biology of Transcription Factor Binding (Methods in Molecular Biology); Ladunga, I., Ed.; Springer Science+Business Media, Humana Press: New York, NY, USA, 2010; Volume 674, pp. 57–83. [Google Scholar]
  112. Zhu, Z.; Wang, H.; Wang, Y.; Guan, S.; Wang, F.; Tang, J.; Zhang, R.; Xie, L.; Lu, Y. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation. J. Exp. Bot. 2015, 66, 3775–3789. [Google Scholar] [CrossRef]
  113. Xie, L.; Liu, S.; Zhang, Y.; Tian, W.; Xu, D.; Li, J.; Luo, X.; Li, L.; Bian, Y.; Li, F.; et al. Efficient proteome-wide identification of transcription factors targeting Glu-1: A case study for functional validation of TaB3-2A1 in wheat. Plant Biotechnol. J. 2023, 21, 1952–1965. [Google Scholar] [CrossRef]
  114. Ksouri, N.; Castro-Mondragón, J.A.; Montardit-Tarda, F.; van Helden, J.; Contreras-Moreira, B.; Gogorcena, Y. Tuning promoter boundaries improves regulatory motif discovery in nonmodel plants: The peach example. Plant Physiol. 2021, 185, 1242–1258. [Google Scholar] [CrossRef]
  115. Keilwagen, J.; Grau, J.; Paponov, I.A.; Posch, S.; Strickert, M.; Grosse, I. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference. PLoS Comput. Biol 2011, 7, e1001070, Erratum in PLoS Comput. Biol. 2011, 7. [Google Scholar] [CrossRef]
  116. Chen, Z.Y.; Guo, X.J.; Chen, Z.X.; Chen, W.Y.; Wang, J.R. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences. Biosci. Biotechnol. Biochem. 2017, 81, 1125–1135. [Google Scholar] [CrossRef]
  117. Jo, L.; Pelletier, J.M.; Hsu, S.W.; Baden, R.; Goldberg, R.B.; Harada, J.J. Combinatorial interactions of the LEC1 transcription factor specify diverse developmental programs during soybean seed development. Proc. Natl. Acad. Sci. USA 2020, 117, 1223–1232. [Google Scholar] [CrossRef]
  118. Li, J.; Xie, L.; Tian, X.; Liu, S.; Xu, D.; Jin, H.; Song, J.; Dong, Y.; Zhao, D.; Li, G.; et al. TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant J. 2021, 108, 829–840. [Google Scholar] [CrossRef]
  119. Rodriguez, K.; Do, A.; Senay-Aras, B.; Perales, M.; Alber, M.; Chen, W.; Reddy, G.V. Concentration-dependent transcriptional switching through a collective action of cis-elements. Sci. Adv. 2022, 8, eabo6157. [Google Scholar] [CrossRef]
  120. Chen, R.; Jiang, H.; Li, L.; Zhai, Q.; Qi, L.; Zhou, W.; Liu, X.; Li, H.; Zheng, W.; Sun, J.; et al. The Arabidopsis mediator subunit MED25 differentially regulates jasmonate and abscisic acid signaling through interacting with the MYC2 and ABI5 transcription factors. Plant Cell 2012, 24, 2898–2916. [Google Scholar] [CrossRef]
  121. Lai, Z.; Schluttenhofer, C.M.; Bhide, K.; Shreve, J.; Thimmapuram, J.; Lee, S.Y.; Yun, D.J.; Mengiste, T. MED18 interaction with distinct transcription factors regulates multiple plant functions. Nat. Commun. 2014, 5, 3064. [Google Scholar] [CrossRef] [PubMed]
  122. Weber, B.; Zicola, J.; Oka, R.; Stam, M. Plant Enhancers: A Call for Discovery. Trends Plant Sci. 2016, 21, 974–987. [Google Scholar] [CrossRef] [PubMed]
  123. Field Adelman, K. Evaluating Enhancer Function and Transcription. Annu. Rev. Biochem. 2020, 89, 213–234. [Google Scholar] [CrossRef]
  124. Louwers, M.; Bader, R.; Haring, M.; van Driel, R.; de Laat, W.; Stam, M. Tissue- and expression level-specific chromatin looping at maize b1 epialleles. Plant Cell 2009, 21, 832–842. [Google Scholar] [CrossRef]
  125. Zheng, L.; McMullen, M.D.; Bauer, E.; Schön, C.C.; Gierl, A.; Frey, M. Prolonged expression of the BX1 signature enzyme is associated with a recombination hotspot in the benzoxazinoid gene cluster in Zea mays. J. Exp. Bot. 2015, 66, 3917–3930. [Google Scholar] [CrossRef]
  126. Nagy, F.; Boutry, M.; Hsu, M.Y.; Wong, M.; Chua, N.H. The 5′-proximal region of the wheat Cab-1 gene contains a 268-bp enhancer-like sequence for phytochrome response. EMBO J. 1987, 6, 2537–2542. [Google Scholar] [CrossRef]
  127. Chua, Y.L.; Watson, L.A.; Gray, J.C. The transcriptional enhancer of the pea plastocyanin gene associates with the nuclear matrix and regulates gene expression through histone acetylation. Plant Cell 2003, 15, 1468–1479. [Google Scholar] [CrossRef]
  128. Jores, T.; Tonnies, J.; Dorrity, M.W.; Cuperus, J.T.; Fields, S.; Queitsch, C. Identification of Plant Enhancers and Their Constituent Elements by STARR-seq in Tobacco Leaves. Plant Cell 2020, 32, 2120–2131. [Google Scholar] [CrossRef]
  129. Zabidi, M.A.; Arnold, C.D.; Schernhuber, K.; Pagani, M.; Rath, M.; Frank, O.; Stark, A. Enhancer–core-promoter specificity separates developmental and housekeeping gene regulation. Nature 2015, 518, 556–559. [Google Scholar] [CrossRef]
  130. Iwafuchi-Doi, M.; Zaret, K.S. Pioneer transcription factors in cell reprogramming. Genes Dev. 2014, 28, 2679–2692. [Google Scholar] [CrossRef]
  131. Jin, R.; Klasfeld, S.; Zhu, Y.; Fernandez Garcia, M.; Xiao, J.; Han, S.K.; Konkol, A.; Wagner, D. LEAFY is a pioneer transcription factor and licenses cell reprogramming to floral fate. Nat. Commun. 2021, 12, 626. [Google Scholar] [CrossRef]
  132. Lai, X.; Blanc-Mathieu, R.; GrandVuillemin, L.; Huang, Y.; Stigliani, A.; Lucas, J.; Thévenon, E.; Loue-Manifel, J.; Turchi, L.; Daher, H.; et al. The LEAFY floral regulator displays pioneer transcription factor properties. Mol. Plant 2021, 14, 829–837. [Google Scholar] [CrossRef]
  133. Crocker, J.; Abe, N.; Rinaldi, L.; McGregor, A.P.; Frankel, N.; Wang, S.; Alsawadi, A.; Valenti, P.; Plaza, S.; Payre, F.; et al. Low affinity binding site clusters confer hox specificity and regulatory robustness. Cell 2015, 160, 191–203. [Google Scholar] [CrossRef]
  134. Ramos, A.I.; Barolo, S. Low-affinity transcription factor binding sites shape morphogen responses and enhancer evolution. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2013, 368, 20130018. [Google Scholar] [CrossRef]
  135. Martinez-Corral, R.; Park, M.; Biette, K.M.; Friedrich, D.; Scholes, C.; Khalil, A.S.; Gunawardena, J.; DePace, A.H. Transcriptional kinetic synergy: A complex landscape revealed by integrating modeling and synthetic biology. Cell Syst. 2023, 14, 324–339.e7. [Google Scholar] [CrossRef]
  136. Smith, G.D.; Ching, W.H.; Cornejo-Páramo, P.; Wong, E.S. Decoding enhancer complexity with machine learning and high-throughput discovery. Genome Biol. 2023, 24, 116. [Google Scholar] [CrossRef]
  137. Ramasamy, S.; Aljahani, A.; Karpinska, M.A.; Cao, T.B.N.; Velychko, T.; Cruz, J.N.; Lidschreiber, M.; Oudelaar, A.M. The Mediator complex regulates enhancer-promoter interactions. Nat. Struct. Mol. Biol. 2023, 30, 991–1000. [Google Scholar] [CrossRef]
  138. Guo, J.; Wei, L.; Chen, S.S.; Cai, X.W.; Su, Y.N.; Li, L.; Chen, S.; He, X.J. The CBP/p300 histone acetyltransferases function as plant-specific MEDIATOR subunits in Arabidopsis. J. Integr. Plant Biol. 2021, 63, 755–771. [Google Scholar] [CrossRef]
  139. Li, X.; Yang, R.; Chen, H. The Arabidopsis thaliana Mediator subunit MED8 regulates plant immunity to Botrytis Cinerea through interacting with the basic helix-loop-helix (bHLH) transcription factor FAMA. PLoS ONE 2018, 13, e0193458. [Google Scholar] [CrossRef]
  140. Hernández-García, J.; Serrano-Mislata, A.; Lozano-Quiles, M.; Úrbez, C.; Nohales, M.A.; Blanco-Touriñán, N.; Peng, H.; Ledesma-Amaro, R.; Blázquez, M.A. DELLA proteins recruit the Mediator complex subunit MED15 to coactivate transcription in land plants. Proc. Natl. Acad. Sci. USA 2024, 121, e2319163121. [Google Scholar] [CrossRef]
  141. Wang, S.P.; Tang, Z.; Chen, C.W.; Shimada, M.; Koche, R.P.; Wang, L.H.; Nakadai, T.; Chramiec, A.; Krivtsov, A.V.; Armstrong, S.A.; et al. A UTX-MLL4-p300 Transcriptional Regulatory Network Coordinately Shapes Active Enhancer Landscapes for Eliciting Transcription. Mol. Cell 2017, 67, 308–321.e6. [Google Scholar] [CrossRef] [PubMed]
  142. Haring, M.; Bader, R.; Louwers, M.; Schwabe, A.; van Driel, R.; Stam, M. The role of DNA methylation, nucleosome occupancy and histone modifications in paramutation. Plant J. 2010, 63, 366–378. [Google Scholar] [CrossRef] [PubMed]
  143. Yan, W.; Chen, D.; Schumacher, J.; Durantini, D.; Engelhorn, J.; Chen, M.; Carles, C.C.; Kaufmann, K. Dynamic control of enhancer activity drives stage-specific gene expression during flower morphogenesis. Nat. Commun. 2019, 10, 1705. [Google Scholar] [CrossRef]
  144. Creyghton, M.P.; Cheng, A.W.; Welstead, G.G.; Kooistra, T.; Carey, B.W.; Steine, E.J.; Hanna, J.; Lodato, M.A.; Frampton, G.M.; Sharp, P.A.; et al. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. USA 2010, 107, 21931–21936. [Google Scholar] [CrossRef]
  145. Kang, Y.; Kim, Y.W.; Kang, J.; Kim, A. Histone H3K4me1 and H3K27ac play roles in nucleosome eviction and eRNA transcription, respectively, at enhancers. FASEB J. 2021, 35, e21781. [Google Scholar] [CrossRef]
  146. Zhang, Y.; Tang, M.; Huang, M.; Xie, J.; Cheng, J.; Fu, Y.; Jiang, D.; Yu, X.; Li, B. Dynamic enhancer transcription associates with reprogramming of immune genes during pattern triggered immunity in Arabidopsis. BMC Biol. 2022, 20, 165. [Google Scholar] [CrossRef]
  147. Di Ruscio, A.; Ebralidze, A.K.; Benoukraf, T.; Amabile, G.; Goff, L.A.; Terragni, J.; Figueroa, M.E.; De Figueiredo Pontes, L.L.; Alberich-Jorda, M.; Zhang, P.; et al. DNMT1-interacting RNAs block gene-specific DNA methylation. Nature 2013, 503, 371–376. [Google Scholar] [CrossRef]
  148. Beltran, M.; Yates, C.M.; Skalska, L.; Dawson, M.; Reis, F.P.; Viiri, K.; Fisher, C.L.; Sibley, C.R.; Foster, B.M.; Bartke, T.; et al. The interaction of PRC2 with RNA or chromatin is mutually antagonistic. Genome Res. 2016, 26, 896–907. [Google Scholar] [CrossRef]
  149. Yang, J.; Chang, Y.; Qin, Y.; Chen, D.; Zhu, T.; Peng, K.; Wang, H.; Tang, N.; Li, X.; Wang, Y.; et al. A lamin-like protein OsNMCP1 regulates drought resistance and root growth through chromatin accessibility modulation by interacting with a chromatin remodeller OsSWI3C in rice. New Phytol. 2020, 227, 65–83. [Google Scholar] [CrossRef]
  150. Ray-Jones, H.; Spivakov, M. Transcriptional enhancers and their communication with gene promoters. Cell. Mol. Life Sci. 2021, 78, 6453–6485. [Google Scholar] [CrossRef]
  151. Uyehara, C.M.; Apostolou, E. 3D enhancer-promoter interactions and multi-connected hubs: Organizational principles and functional roles. Cell Rep. 2023, 42, 112068. [Google Scholar] [CrossRef]
  152. Que, Q.; Chilton, M.D.; de Fontes, C.M.; He, C.; Nuccio, M.; Zhu, T.; Wu, Y.; Chen, J.S.; Shi, L. Trait stacking in transgenic crops: Challenges and opportunities. GM Crops 2010, 1, 220–229. [Google Scholar] [CrossRef]
  153. Shehryar, K.; Khan, R.S.; Iqbal, A.; Hussain, S.A.; Imdad, S.; Bibi, A.; Hamayun, L.; Nakamura, I. Transgene Stacking as Effective Tool for Enhanced Disease Resistance in Plants. Mol. Biotechnol. 2020, 62, 1–7. [Google Scholar] [CrossRef] [PubMed]
  154. Collier, R.; Thomson, J.G.; Thilmony, R. A versatile and robust Agrobacterium-based gene stacking system generates high-quality transgenic Arabidopsis plants. Plant J. 2018, 95, 573–583. [Google Scholar] [CrossRef] [PubMed]
  155. Krichevsky, A.; Zaltsman, A.; King, L.; Citovsky, V. Expression of complete metabolic pathways in transgenic plants. Biotechnol. Genet. Eng. Rev. 2012, 28, 1–13. [Google Scholar] [CrossRef] [PubMed]
  156. Peremarti, A.; Twyman, R.M.; Gómez-Galera, S.; Naqvi, S.; Farré, G.; Sabalza, M.; Miralpeix, B.; Dashevskaya, S.; Yuan, D.; Ramessar, K.; et al. Promoter diversity in multigene transformation. Plant Mol. Biol. 2010, 73, 363–378. [Google Scholar] [CrossRef] [PubMed]
  157. Oliveira, P.H.; Prather, K.J.; Prazeres, D.M.F.; Monteiro, G.A. Analysis of DNA repeats in bacterial plasmids reveals the potential for recurrent instability events. Appl. Microbiol. Biotechnol. 2010, 87, 2157–2167. [Google Scholar] [CrossRef]
  158. Mall, T.; Gupta, M.; Dhadialla, T.S.; Rodrigo, S. Overview of Biotechnology-Derived Herbicide Tolerance and Insect Resistance Traits in Plant Agriculture. Methods Mol. Biol. 2019, 1864, 313–342. [Google Scholar] [CrossRef] [PubMed]
  159. Zhu, Q.; Yu, S.; Zeng, D.; Liu, H.; Wang, H.; Yang, Z.; Xie, X.; Shen, R.; Tan, J.; Li, H.; et al. Development of “Purple Endosperm Rice” by Engineering Anthocyanin Biosynthesis in the Endosperm with a High-Efficiency Transgene Stacking System. Mol. Plant. 2017, 10, 918–929. [Google Scholar] [CrossRef] [PubMed]
  160. Zhu, Q.; Liu, Y.G. TransGene Stacking II Vector System for Plant Metabolic Engineering and Synthetic Biology. Methods Mol. Biol. 2021, 2238, 19–35. [Google Scholar] [CrossRef] [PubMed]
  161. Chang, Y.J.; Kim, B.R.; Kim, S.U. Metabolic flux analysis of diterpene biosynthesis pathway in rice. Biotechnol. Lett. 2005, 27, 1375–1380. [Google Scholar] [CrossRef]
  162. Yoo, H.J.; Chung, M.Y.; Lee, H.A.; Lee, S.B.; Grandillo, S.; Giovannoni, J.J.; Lee, J.M. Natural overexpression of CAROTENOID CLEAVAGE DIOXYGENASE 4 in tomato alters carotenoid flux. Plant Physiol. 2023, 192, 1289–1306. [Google Scholar] [CrossRef]
  163. Manickavasagam, M.; Ganapathi, A.; Anbazhagan, V.R.; Sudhakar, B.; Selvaraj, N.; Vasudevan, A.; Kasthurirengan, S. Agrobacterium-mediated genetic transformation and development of herbicide-resistant sugarcane (Saccharum species hybrids) using axillary buds. Plant Cell Rep. 2004, 23, 134–143. [Google Scholar] [CrossRef] [PubMed]
  164. Wu, Y.; Wang, Y.; Li, J.; Li, W.; Zhang, L.; Li, Y.; Li, X.; Li, J.; Zhu, L.; Wu, G. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods. Sci. Rep. 2014, 4, 7358. [Google Scholar] [CrossRef]
  165. Betts, S.D.; Basu, S.; Bolar, J.; Booth, R.; Chang, S.; Cigan, A.M.; Farrell, J.; Gao, H.; Harkins, K.; Kinney, A.; et al. Uniform Expression and Relatively Small Position Effects Characterize Sister Transformants in Maize and Soybean. Front. Plant Sci. 2019, 10, 1209. [Google Scholar] [CrossRef] [PubMed]
  166. Lohn, A.F.; Trtikova, M.; Chapela, I.; Van den Berg, J.; du Plessis, H.; Hilbeck, A. Transgene behavior in Zea mays L. crosses across different genetic backgrounds: Segregation patterns, cry1Ab transgene expression, insecticidal protein concentration and bioactivity against insect pests. PLoS ONE 2020, 15, e0238523. [Google Scholar] [CrossRef]
  167. Sun, T.; Zhu, Q.; Wei, Z.; Owens, L.A.; Fish, T.; Kim, H.; Thannhauser, T.W.; Cahoon, E.B.; Li, L. Multi-strategy engineering greatly enhances provitamin A carotenoid accumulation and stability in Arabidopsis seeds. aBIOTECH 2021, 2, 191–214. [Google Scholar] [CrossRef] [PubMed]
  168. Halpin, C. Gene stacking in transgenic plants--the challenge for 21st century plant biotechnology. Plant Biotechnol. J. 2005, 3, 141–155. [Google Scholar] [CrossRef] [PubMed]
  169. Spatola Rossi, T.; Fricker, M.; Kriechbaumer, V. Gene Stacking and Stoichiometric Expression of ER-Targeted Constructs Using “2A” Self-Cleaving Peptides. Methods Mol. Biol. 2024, 2772, 337–351. [Google Scholar] [CrossRef] [PubMed]
  170. Chung, S.M.; Frankman, E.L.; Tzfira, T. A versatile vector system for multiple gene expression in plants. Trends Plant Sci. 2005, 10, 357–361. [Google Scholar] [CrossRef] [PubMed]
  171. Nakagawa, T.; Kurose, T.; Hino, T.; Tanaka, K.; Kawamukai, M.; Niwa, Y.; Toyooka, K.; Matsuoka, K.; Jinbo, T.; Kimura, T. Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosci. Bioeng. 2007, 104, 34–41. [Google Scholar] [CrossRef]
  172. Wang, X.; Teng, C.; Wei, H.; Liu, S.; Xuan, H.; Peng, W.; Li, Q.; Hao, H.; Lyu, Q.; Lyu, S.; et al. Development of a set of novel binary expression vectors for plant gene function analysis and genetic transformation. Front. Plant Sci. 2023, 13, 1104905. [Google Scholar] [CrossRef]
  173. Kumar, S.; AlAbed, D.; Whitteck, J.T.; Chen, W.; Bennett, S.; Asberry, A.; Wang, X.; DeSloover, D.; Rangasamy, M.; Wright, T.R.; et al. A combinatorial bidirectional and bicistronic approach for coordinated multi-gene expression in corn. Plant Mol. Biol. 2015, 87, 341–353. [Google Scholar] [CrossRef] [PubMed]
  174. Yang, J.; Wang, X.; Hasi, A.; Wang, Z. Structural and Functional Analysis of a Bidirectional Promoter from Gossypium hirsutum in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 3291. [Google Scholar] [CrossRef] [PubMed]
  175. Arnaiz, A.; Martinez, M.; Gonzalez-Melendi, P.; Grbic, V.; Diaz, I.; Santamaria, M.E. Plant Defenses Against Pests Driven by a Bidirectional Promoter. Front. Plant Sci. 2019, 10, 930. [Google Scholar] [CrossRef] [PubMed]
  176. Sharma, P.; Kumar, V.; Singh, S.K.; Thakur, S.; Siwach, P.; Sreenivasulu, Y.; Srinivasan, R.; Bhat, S.R. Promoter Trapping and Deletion Analysis Show Arabidopsis thaliana APETALA2 Gene Promoter Is Bidirectional and Functions as a Pollen- and Ovule-Specific Promoter in the Reverse Orientation. Appl. Biochem. Biotechnol. 2017, 182, 1591–1604. [Google Scholar] [CrossRef] [PubMed]
  177. Vogl, T.; Kickenweiz, T.; Pitzer, J.; Sturmberger, L.; Weninger, A.; Biggs, B.W.; Köhler, E.M.; Baumschlager, A.; Fischer, J.E.; Hyden, P.; et al. Engineered bidirectional promoters enable rapid multi-gene co-expression optimization. Nat. Commun. 2018, 9, 3589, Erratum in Nat. Commun. 2018, 9, 4566. Erratum in Nat. Commun. 2021, 12, 1287. [Google Scholar] [CrossRef]
  178. Laxa, M.; Fromm, S. Co-expression and regulation of photo respiratory genes in Arabidopsis thaliana: A bioinformatic approach. Curr. Plant Biol. 2018, 14, 2–18. [Google Scholar] [CrossRef]
  179. Bhattacharyya, S.; Dey, N.; Maiti, I.B. Analysis of cis-sequence of subgenomic transcript promoter from the Figwort mosaic virus and comparison of promoter activity with the Cauliflower mosaic virus promoters in monocot and dicot cells. Virus Res. 2002, 90, 47–62. [Google Scholar] [CrossRef] [PubMed]
  180. Kakei, Y.; Masuda, H.; Nishizawa, N.K.; Hattori, H.; Aung, M.S. Elucidation of Novel cis-Regulatory Elements and Promoter Structures Involved in Iron Excess Response Mechanisms in Rice Using a Bioinformatics Approach. Front. Plant Sci. 2021, 12, 660303. [Google Scholar] [CrossRef] [PubMed]
  181. Sherpa, T.; Jha, D.K.; Kumari, K.; Chanwala, J.; Dey, N. Synthetic sub-genomic transcript promoter from Horseradish Latent Virus (HRLV). Planta 2023, 257, 40. [Google Scholar] [CrossRef] [PubMed]
  182. Acharya, S.; Sengupta, S.; Patro, S.; Purohit, S.; Samal, S.K.; Maiti, I.B.; Dey, N. Development of an intra-molecularly shuffled efficient chimeric plant promoter from plant infecting Mirabilis mosaic virus promoter sequence. J. Biotechnol. 2014, 169, 103–111. [Google Scholar] [CrossRef]
  183. Koschmann, J.; Machens, F.; Becker, M.; Niemeyer, J.; Schulze, J.; Bülow, L.; Stahl, D.J.; Hehl, R. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis. Plant Physiol. 2012, 160, 178–191. [Google Scholar] [CrossRef]
  184. Jameel, A.; Noman, M.; Liu, W.; Ahmad, N.; Wang, F.; Li, X.; Li, H. Tinkering Cis Motifs Jigsaw Puzzle Led to Root-Specific Drought-Inducible Novel Synthetic Promoters. Int. J. Mol. Sci. 2020, 21, 1357. [Google Scholar] [CrossRef] [PubMed]
  185. Jameel, A.; Ketehouli, T.; Wang, Y.; Wang, F.; Li, X.; Li, H. Detection and validation of cis-regulatory motifs in osmotic stress-inducible synthetic gene switches via computational and experimental approaches. Funct. Plant Biol. 2022, 49, 1043–1054. [Google Scholar] [CrossRef] [PubMed]
  186. Cai, Y.M.; Kallam, K.; Tidd, H.; Gendarini, G.; Salzman, A.; Patron, N.J. Rational design of minimal synthetic promoters for plants. Nucleic Acids Res. 2020, 48, 11845–11856. [Google Scholar] [CrossRef] [PubMed]
  187. Chow, C.N.; Lee, T.Y.; Hung, Y.C.; Li, G.Z.; Tseng, K.C.; Liu, Y.H.; Kuo, P.L.; Zheng, H.Q.; Chang, W.C. PlantPAN3.0: A new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Res. 2019, 47, D1155–D1163. [Google Scholar] [CrossRef] [PubMed]
  188. Kim, H.M.; Park, S.H.; Park, S.Y.; Ma, S.H.; Do, J.H.; Kim, A.Y.; Jeon, M.J.; Shim, J.S.; Joung, Y.H. Identification of essential element determining fruit-specific transcriptional activity in the tomato HISTIDINE DECARBOXYLASE A gene promoter. Plant Cell Rep. 2022, 41, 1721–1731. [Google Scholar] [CrossRef] [PubMed]
  189. Sultana, M.S.; Mazarei, M.; Millwood, R.J.; Liu, W.; Hewezi, T.; Stewart, C.N., Jr. Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max). Front. Plant Sci. 2022, 13, 988048. [Google Scholar] [CrossRef] [PubMed]
  190. Shokouhifar, F.; Bahrabadi, M.; Bagheri, A.; Mamarabadi, M. Transient expression analysis of synthetic promoters containing F and D cis-acting elements in response to Ascochyta rabiei and two plant defense hormones. AMB Express 2019, 9, 195. [Google Scholar] [CrossRef] [PubMed]
  191. Liang, Z.; Myers, Z.A.; Petrella, D.; Engelhorn, J.; Hartwig, T.; Springer, N.M. Mapping responsive genomic elements to heat stress in a maize diversity panel. Genome Biol. 2022, 23, 234. [Google Scholar] [CrossRef] [PubMed]
  192. Basu, D.; South, P.F. Design and Analysis of Native Photorespiration Gene Motifs of Promoter Untranslated Region Combinations Under Short Term Abiotic Stress Conditions. Front. Plant Sci. 2022, 13, 828729. [Google Scholar] [CrossRef]
  193. Cai, Z.; Guo, H.; Shen, S.; Yu, Q.; Wang, J.; Zhu, E.; Zhang, P.; Song, L.; Zhang, Y.; Zhang, K. Generation of the salicylic acid deficient Arabidopsis via a synthetic salicylic acid hydroxylase expression cassette. Plant Methods 2022, 18, 89. [Google Scholar] [CrossRef]
  194. Xu, H.; Wang, H.; Zhang, Y.; Yang, X.; Lv, S.; Hou, D.; Mo, C.; Wassie, M.; Yu, B.; Hu, T. A synthetic light-inducible photorespiratory bypass enhances photosynthesis to improve rice growth and grain yield. Plant Commun. 2023, 4, 100641. [Google Scholar] [CrossRef] [PubMed]
  195. Bhullar, S.; Chakravarthy, S.; Advani, S.; Datta, S.; Pental, D.; Burma, P.K. Strategies for development of functionally equivalent promoters with minimum sequence homology for transgene expression in plants: Cis-elements in a novel DNA context versus domain swapping. Plant Physiol. 2003, 132, 988–998. [Google Scholar] [CrossRef] [PubMed]
  196. Kar, S.; Bordiya, Y.; Rodriguez, N.; Kim, J.; Gardner, E.C.; Gollihar, J.D.; Sung, S.; Ellington, A.D. Orthogonal control of gene expression in plants using synthetic promoters and CRISPR-based transcription factors. Plant Methods 2022, 18, 42. [Google Scholar] [CrossRef] [PubMed]
  197. Danila, F.; Schreiber, T.; Ermakova, M.; Hua, L.; Vlad, D.; Lo, S.F.; Chen, Y.S.; Lambret-Frotte, J.; Hermanns, A.S.; Athmer, B.; et al. A single promoter-TALE system for tissue-specific and tuneable expression of multiple genes in rice. Plant Biotechnol. J. 2022, 20, 1786–1806. [Google Scholar] [CrossRef]
  198. Schreiber, T.; Tissier, A. Generation of dTALEs and Libraries of Synthetic TALE-Activated Promoters for Engineering of Gene Regulatory Networks in Plants. Methods Mol. Biol. 2017, 1629, 185–204. [Google Scholar] [CrossRef] [PubMed]
  199. Kallam, K.; Moreno-Giménez, E.; Mateos-Fernández, R.; Tansley, C.; Gianoglio, S.; Orzaez, D.; Patron, N. Tunable control of insect pheromone biosynthesis in Nicotiana benthamiana. Plant Biotechnol. J. 2023, 21, 1440–1453. [Google Scholar] [CrossRef] [PubMed]
  200. Garcia-Perez, E.; Diego-Martin, B.; Quijano-Rubio, A.; Moreno-Giménez, E.; Selma, S.; Orzaez, D.; Vazquez-Vilar, M. A copper switch for inducing CRISPR/Cas9-based transcriptional activation tightly regulates gene expression in Nicotiana benthamiana. BMC Biotechnol. 2022, 22, 12. [Google Scholar] [CrossRef] [PubMed]
  201. Brückner, K.; Schäfer, P.; Weber, E.; Grützner, R.; Marillonnet, S.; Tissier, A. A library of synthetic transcription activator-like effector-activated promoters for coordinated orthogonal gene expression in plants. Plant J. 2015, 82, 707–716. [Google Scholar] [CrossRef]
  202. Lee, J.E.; Neumann, M.; Duro, D.I.; Schmid, M. CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants. PLoS ONE 2019, 14, e0222778. [Google Scholar] [CrossRef]
  203. Moreno-Giménez, E.; Selma, S.; Calvache, C.; Orzáez, D. GB_SynP: A Modular dCas9-Regulated Synthetic Promoter Collection for Fine-Tuned Recombinant Gene Expression in Plants. ACS Synth. Biol. 2022, 11, 3037–3048, Erratum in ACS Synth. Biol. 2022, 11, 4226. [Google Scholar] [CrossRef]
  204. Mohamed, H.; Gould, D. PCR Assembly of Synthetic Promoters. Methods Mol. Biol. 2017, 1651, 147–156. [Google Scholar] [CrossRef]
  205. Mohamed, H.; Chernajovsky, Y.; Gould, D. Assembly PCR synthesis of optimally designed, compact, multi-responsive promoters suited to gene therapy application. Sci. Rep. 2016, 6, 29388. [Google Scholar] [CrossRef]
  206. Fernandez-Moreno, J.P.; Yaschenko, A.E.; Neubauer, M.; Marchi, A.J.; Zhao, C.; Ascencio-Ibanez, J.T.; Alonso, J.M.; Stepanova, A.N. A rapid and scalable approach to build synthetic repetitive hormone-responsive promoters. Plant Biotechnol. J. 2024, 20, 165. [Google Scholar] [CrossRef] [PubMed]
  207. Song, H.; Yang, Y.; Li, H.; Du, J.; Hu, Z.; Chen, Y.; Yang, N.; Mei, M.; Xiong, Z.; Tang, K.; et al. Determination of Nucleotide Sequences within Promoter Regions Affecting Promoter Compatibility between Zymomonas mobilis and Escherichia coli. ACS Synth. Biol. 2022, 11, 2811–2819. [Google Scholar] [CrossRef] [PubMed]
  208. Acharya, S.; Ranjan, R.; Pattanaik, S.; Maiti, I.B.; Dey, N. Efficient chimeric plant promoters derived from plant infecting viral promoter sequences. Planta 2014, 239, 381–396. [Google Scholar] [CrossRef] [PubMed]
  209. Ranjan, R.; Dey, N. Development of vascular tissue and stress inducible hybrid-synthetic promoters through dof-1 motifs rearrangement. Cell Biochem. Biophys 2012, 63, 235–245. [Google Scholar] [CrossRef] [PubMed]
  210. Efremova, L.N.; Strelnikova, S.R.; Gazizova, G.R.; Minkina, E.A.; Komakhin, R.A. A Synthetic Strong and Constitutive Promoter Derived from the Stellaria media pro-SmAMP1 and pro-SmAMP2 Promoters for Effective Transgene Expression in Plants. Genes 2020, 11, 1407. [Google Scholar] [CrossRef] [PubMed]
  211. Li, M.; Xie, C.; Song, B.; Ou, Y.; Lin, Y.; Liu, X.; Zhang, H.; Liu, J. Construction of efficient, tuber-specific, and cold-inducible promoters in potato. Plant Sci. 2015, 235, 14–24. [Google Scholar] [CrossRef] [PubMed]
  212. Zhang, N.; McHale, L.K.; Finer, J.J. Changes to the core and flanking sequences of G-box elements lead to increases and decreases in gene expression in both native and synthetic soybean promoters. Plant Biotechnol. J. 2019, 17, 724–735. [Google Scholar] [CrossRef] [PubMed]
  213. Zhao, M.; Yuan, Z.; Wu, L.; Zhou, S.; Deng, Y. Precise Prediction of Promoter Strength Based on a De Novo Synthetic Promoter Library Coupled with Machine Learning. ACS Synth. Biol. 2022, 11, 92–102. [Google Scholar] [CrossRef]
  214. Huttanus, H.M.; Triola, E.H.; Velasquez-Guzman, J.C.; Shin, S.M.; Granja-Travez, R.S.; Singh, A.; Dale, T.; Jha, R.K. Targeted mutagenesis and high-throughput screening of diversified gene and promoter libraries for isolating gain-of-function mutations. Front. Bioeng. Biotechnol. 2023, 11, 1202388. [Google Scholar] [CrossRef]
  215. Yang, Y.; Lee, J.H.; Poindexter, M.R.; Shao, Y.; Liu, W.; Lenaghan, S.C.; Ahkami, A.H.; Blumwald, E.; Stewart, C.N., Jr. Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements. Plant Biotechnol. J. 2021, 19, 1354–1369. [Google Scholar] [CrossRef]
  216. Yang, Y.; Tagaloguin, P.; Chaffin, T.A.; Shao, Y.; Mazarei, M.; Millwood, R.J.; Stewart, C.N., Jr. Drought stress-inducible synthetic promoters designed for poplar are functional in rice. Plant Cell Rep. 2024, 43, 69. [Google Scholar] [CrossRef] [PubMed]
  217. Yang, Y.; Shao, Y.; Chaffin, T.A.; Lee, J.H.; Poindexter, M.R.; Ahkami, A.H.; Blumwald, E.; Stewart, C.N., Jr. Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba). Front. Plant Sci. 2022, 13, 1011939. [Google Scholar] [CrossRef]
  218. Li, J.; Wang, K.; Li, L.; Li, Y.; Zhang, Y.; Liu, Z.; Ye, X.; Xia, X.; He, Z.; Cao, S. Dissecting conserved cis-regulatory modules of Glu-1 promoters which confer the highly active endosperm-specific expression via stable wheat transformation. Crop J. 2019, 7, 8–18. [Google Scholar] [CrossRef]
  219. Waclawovsky, A.J.; Freitas, R.L.; Rocha, C.S.; Contim, L.A.; Fontes, E.P. Combinatorial regulation modules on GmSBP2 promoter: A distal cis-regulatory domain confines the SBP2 promoter activity to the vascular tissue in vegetative organs. Biochim. Biophys. Acta 2006, 1759, 89–98. [Google Scholar] [CrossRef]
  220. Freitas, R.L.; Carvalho, C.M.; Fietto, L.G.; Loureiro, M.E.; Almeida, A.M.; Fontes, E.P. Distinct repressing modules on the distal region of the SBP2 promoter contribute to its vascular tissue-specific expression in different vegetative organs. Plant Mol. Biol. 2007, 65, 603–614. [Google Scholar] [CrossRef] [PubMed]
  221. Zhou, A.; Kirkpatrick, L.D.; Ornelas, I.J.; Washington, L.J.; Hummel, N.F.C.; Gee, C.W.; Tang, S.N.; Barnum, C.R.; Scheller, H.V.; Shih, P.M. A Suite of Constitutive Promoters for Tuning Gene Expression in Plants. ACS Synth. Biol. 2023, 12, 1533–1545. [Google Scholar] [CrossRef] [PubMed]
  222. Deb, D.; Dey, N. Synthetic Salicylic acid inducible recombinant promoter for translational research. J. Biotechnol. 2019, 297, 9–18. [Google Scholar] [CrossRef] [PubMed]
  223. Sepasi, M.; Iranbakhsh, A.; Saadatmand, S.; Ebadi, M.; Oraghi Ardebili, Z. Silicon nanoparticles (SiNPs) stimulated secondary metabolism and mitigated toxicity of salinity stress in basil (Ocimum basilicum) by modulating gene expression: A sustainable approach for crop protection. Environ. Sci. Pollut. Res. Int. 2024, 31, 16485–16496. [Google Scholar] [CrossRef]
  224. Murthy, H.N.; Joseph, K.S.; Paek, K.Y.; Park, S.Y. Production of specialized metabolites in plant cell and organo-cultures: The role of gamma radiation in eliciting secondary metabolism. Int. J. Radiat. Biol. 2024, 7, 1–11. [Google Scholar] [CrossRef]
  225. Zhou, Y.; Liu, L.; Huang, W.; Yuan, M.; Zhou, F.; Li, X.; Lin, Y. Overexpression of OsSWEET5 in rice causes growth retardation and precocious senescence. PLoS ONE 2014, 9, e94210. [Google Scholar] [CrossRef] [PubMed]
  226. Uy, A.L.T.; Yamamoto, A.; Matsuda, M.; Arae, T.; Hasunuma, T.; Demura, T.; Ohtani, M. The Carbon Flow Shifts from Primary to Secondary Metabolism during Xylem Vessel Cell Differentiation in Arabidopsis thaliana. Plant Cell Physiol. 2023, 64, 1563–1575. [Google Scholar] [CrossRef]
  227. Cun, Z.; Zhang, J.Y.; Hong, J.; Yang, J.; Gao, L.L.; Hao, B.; Chen, J.W. Integrated metabolome and transcriptome analysis reveals the regulatory mechanism of low nitrogen-driven biosynthesis of saponins and flavonoids in Panax notoginseng. Gene 2024, 901, 148163. [Google Scholar] [CrossRef]
  228. Gupta, D.; Ranjan, R. In silico characterization of synthetic promoters designed from mirabilis mosaic virus and rice tungro bacilliform virus. Virusdisease 2020, 31, 369–373. [Google Scholar] [CrossRef] [PubMed]
  229. Gupta, D.; Dey, N.; Leelavathi, S.; Ranjan, R. Development of efficient synthetic promoters derived from pararetrovirus suitable for translational research. Planta 2021, 253, 42. [Google Scholar] [CrossRef]
  230. Patro, S.; Kumar, D.; Ranjan, R.; Maiti, I.B.; Dey, N. The development of efficient plant promoters for transgene expression employing plant virus promoters. Mol. Plant. 2012, 5, 941–944. [Google Scholar] [CrossRef] [PubMed]
  231. Khadanga, B.; Chanwala, J.; Sandeep, I.S.; Dey, N. Synthetic Promoters from Strawberry Vein Banding Virus (SVBV) and Dahlia Mosaic Virus (DaMV). Mol. Biotechnol. 2021, 63, 792–806. [Google Scholar] [CrossRef] [PubMed]
  232. Sethi, L.; Deb, D.; Khadanga, B.; Dey, N. Synthetic promoters from blueberry red ringspot virus (BRRV). Planta 2021, 253, 121. [Google Scholar] [CrossRef] [PubMed]
  233. Wu, R.; Duan, L.; Pruneda-Paz, J.L.; Oh, D.H.; Pound, M.; Kay, S.; Dinneny, J.R. The 6xABRE Synthetic Promoter Enables the Spatiotemporal Analysis of ABA-Mediated Transcriptional Regulation. Plant Physiol. 2018, 177, 1650–1665. [Google Scholar] [CrossRef]
  234. Persad, R.; Reuter, D.N.; Dice, L.T.; Nguyen, M.A.; Rigoulot, S.B.; Layton, J.S.; Schmid, M.J.; Poindexter, M.R.; Occhialini, A.; Stewart, C.N., Jr.; et al. The Q-System as a Synthetic Transcriptional Regulator in Plants. Front. Plant Sci. 2020, 11, 245. [Google Scholar] [CrossRef]
  235. Persad-Russell, R.; Mazarei, M.; Schimel, T.M.; Howe, L.; Schmid, M.J.; Kakeshpour, T.; Barnes, C.N.; Brabazon, H.; Seaberry, E.M.; Reuter, D.N.; et al. Specific Bacterial Pathogen Phytosensing Is Enabled by a Synthetic Promoter-Transcription Factor System in Potato. Front. Plant Sci. 2022, 13, 873480. [Google Scholar] [CrossRef] [PubMed]
  236. Bai, J.; Wang, X.; Wu, H.; Ling, F.; Zhao, Y.; Lin, Y.; Wang, R. Comprehensive construction strategy of bidirectional green tissue-specific synthetic promoters. Plant Biotechnol. J. 2020, 18, 668–678. [Google Scholar] [CrossRef] [PubMed]
  237. In, S.; Lee, H.A.; Woo, J.; Park, E.; Choi, D. Molecular Characterization of a Pathogen-Inducible Bidirectional Promoter from Hot Pepper (Capsicum annuum). Mol. Plant Microbe Interact. 2020, 33, 1330–1339. [Google Scholar] [CrossRef] [PubMed]
  238. Liu, X.; Ma, X.; Wang, H.; Li, S.; Yang, W.; Nugroho, R.D.; Luo, L.; Zhou, X.; Tang, C.; Fan, Y.; et al. Metabolic engineering of astaxanthin-rich maize and its use in the production of biofortified eggs. Plant Biotechnol. J. 2021, 19, 1812–1823. [Google Scholar] [CrossRef] [PubMed]
  239. Shantharaj, D.; Minsavage, G.V.; Orbović, V.; Moore, G.A.; Holmes, D.R.; Römer, P.; Horvath, D.M.; Lahaye, T.; Jones, J.B. A promoter trap in transgenic citrus mediates recognition of a broad spectrum of Xanthomonas citri pv. citri TALEs, including in planta-evolved derivatives. Plant Biotechnol. J. 2023, 21, 2019–2032. [Google Scholar] [CrossRef] [PubMed]
  240. López-Salmerón, V.; Schürholz, A.K.; Li, Z.; Schlamp, T.; Wenzl, C.; Lohmann, J.U.; Greb, T.; Wolf, S. Inducible, Cell Type-Specific Expression in Arabidopsis thaliana Through LhGR-Mediated Trans-Activation. J. Vis. Exp. 2019, 146, e59394. [Google Scholar] [CrossRef] [PubMed]
  241. Moore, B.M.; Lee, Y.S.; Wang, P.; Azodi, C.; Grotewold, E.; Shiu, S.H. Modeling temporal and hormonal regulation of plant transcriptional response to wounding. Plant Cell 2022, 34, 867–888. [Google Scholar] [CrossRef] [PubMed]
  242. Zrimec, J.; Fu, X.; Muhammad, A.S.; Skrekas, C.; Jauniskis, V.; Speicher, N.K.; Börlin, C.S.; Verendel, V.; Chehreghani, M.H.; Dubhashi, D.; et al. Controlling gene expression with deep generative design of regulatory DNA. Nat. Commun. 2022, 13, 5099. [Google Scholar] [CrossRef] [PubMed]
  243. Yang, W.; Li, D.; Huang, R. EVMP: Enhancing machine learning models for synthetic promoter strength prediction by Extended Vision Mutant Priority framework. Front. Microbiol. 2023, 14, 1215609. [Google Scholar] [CrossRef]
  244. Zhang, S.Y.; Zhao, B.G.; Shen, Z.; Mei, Y.C.; Li, G.; Dong, F.Q.; Zhang, J.; Chao, Q.; Wang, B.C. Integrating ATAC-seq and RNA-seq to identify differentially expressed genes with chromatin-accessible changes during photosynthetic establishment in Populus leaves. Plant Mol. Biol. 2023, 113, 59–74. [Google Scholar] [CrossRef]
  245. Sartor, R.C.; Noshay, J.; Springer, N.M.; Briggs, S.P. Identification of the expressome by machine learning on omics data. Proc. Natl. Acad. Sci. USA 2019, 116, 18119–18125. [Google Scholar] [CrossRef]
  246. N’Diaye, A.; Byrns, B.; Cory, A.T.; Nilsen, K.T.; Walkowiak, S.; Sharpe, A.; Robinson, S.J.; Pozniak, C.J. Machine learning analyses of methylation profiles uncovers tissue-specific gene expression patterns in wheat. Plant Genome 2020, 13, e20027. [Google Scholar] [CrossRef] [PubMed]
  247. Li, Z.; Jiang, H.; Kong, L.; Chen, Y.; Lang, K.; Fan, X.; Zhang, L.; Pian, C. Deep6mA: A deep learning framework for exploring similar patterns in DNA N6-methyladenine sites across different species. PLoS Comput. Biol. 2021, 17, e1008767. [Google Scholar] [CrossRef] [PubMed]
  248. Li, Y.; Zhu, Y.; Liu, Y.; Shu, Y.; Meng, F.; Lu, Y.; Liu, B.; Bai, X.; Guo, D. Cis-regulatory element based gene finding: An application in Arabidopsis thaliana. Genome Inform. 2008, 21, 177–187. [Google Scholar] [PubMed]
  249. Mishra, H.; Singh, N.; Misra, K.; Lahiri, T. An ANN-GA model based promoter prediction in Arabidopsis thaliana using tilling microarray data. Bioinformation 2011, 6, 240–243. [Google Scholar] [CrossRef] [PubMed]
  250. Hesami, M.; Alizadeh, M.; Naderi, R.; Tohidfar, M. Forecasting and optimizing Agrobacterium-mediated genetic transformation via ensemble model- fruit fly optimization algorithm: A data mining approach using chrysanthemum databases. PLoS ONE 2020, 15, e0239901. [Google Scholar] [CrossRef]
  251. de Boer, C.G.; Taipale, J. Hold out the genome: A roadmap to solving the cis-regulatory code. Nature 2024, 625, 41–50. [Google Scholar] [CrossRef] [PubMed]
  252. Washburn, J.D.; Mejia-Guerra, M.K.; Ramstein, G.; Kremling, K.A.; Valluru, R.; Buckler, E.S.; Wang, H. Evolutionarily informed deep learning methods for predicting relative transcript abundance from DNA sequence. Proc. Natl. Acad. Sci. USA 2019, 116, 5542–5549. [Google Scholar] [CrossRef] [PubMed]
  253. Rigoulot, S.B.; Barco, B.; Zhang, Y.; Zhang, C.; Meier, K.A.; Moore, M.; Fabish, J.; Whinna, R.; Park, J.; Seaberry, E.M.; et al. Automated, High-Throughput Protoplast Transfection for Gene Editing and Transgene Expression Studies. Methods Mol. Biol. 2023, 2653, 129–149. [Google Scholar] [CrossRef]
  254. Rigoulot, S.B.; Park, J.; Fabish, J.; Seaberry, E.M.; Parrish, A.; Meier, K.A.; Whinna, R.; Dong, S. Enabling High-throughput Transgene Expression Studies Using Automated Liquid Handling for Etiolated Maize Leaf Protoplasts. J. Vis. Exp. 2024, 204, e65989. [Google Scholar] [CrossRef]
  255. Rigoulot, S.B.; Schimel, T.M.; Lee, J.H.; Sears, R.G.; Brabazon, H.; Layton, J.S.; Li, L.; Meier, K.A.; Poindexter, M.R.; Schmid, M.J.; et al. Imaging of multiple fluorescent proteins in canopies enables synthetic biology in plants. Plant Biotechnol. J. 2021, 19, 830–843. [Google Scholar] [CrossRef] [PubMed]
  256. Yasmeen, E.; Wang, J.; Riaz, M.; Zhang, L.; Zuo, K. Designing artificial synthetic promoters for accurate, smart, and versatile gene expression in plants. Plant Commun. 2023, 4, 100558. [Google Scholar] [CrossRef] [PubMed]
  257. Brooks, E.G.; Elorriaga, E.; Liu, Y.; Duduit, J.R.; Yuan, G.; Tsai, C.J.; Tuskan, G.A.; Ranney, T.G.; Yang, X.; Liu, W. Plant Promoters and Terminators for High-Precision Bioengineering. Biodes Res. 2023, 5, 0013. [Google Scholar] [CrossRef] [PubMed]
  258. Cazier, A.; Blazeck, J. Advances in promoter engineering: Novel applications and predefined transcriptional control. Biotechnol. J. 2021, 16, e2100239. [Google Scholar] [CrossRef] [PubMed]
  259. Khan, A.; Nasim, N.; Pudhuvai, B.; Koul, B.; Upadhyay, S.K.; Sethi, L.; Dey, N. Plant Synthetic Promoters: Advancement and Prospective. Agriculture 2023, 13, 298. [Google Scholar] [CrossRef]
  260. Liu, W.; Stewart, C.N., Jr. Plant synthetic promoters and transcription factors. Curr. Opin. Biotechnol. 2016, 37, 36–44, Erratum in Curr. Opin. Biotechnol. 2016, 38, 203. [Google Scholar] [CrossRef] [PubMed]
  261. Ali, S.; Kim, W.C. A Fruitful Decade Using Synthetic Promoters in the Improvement of Transgenic Plants. Front. Plant Sci. 2019, 10, 1433. [Google Scholar] [CrossRef] [PubMed]
  262. Yang, E.J.Y.; Nemhauser, J.L. Building a pipeline to identify and engineer constitutive and repressible promoters. Quant. Plant Biol. 2023, 4, e12. [Google Scholar] [CrossRef]
  263. Morey, K.J.; Antunes, M.S.; Albrecht, K.D.; Bowen, T.A.; Troupe, J.F.; Havens, K.L.; Medford, J.I. Developing a synthetic signal transduction system in plants. Methods Enzymol. 2011, 497, 581–602. [Google Scholar] [CrossRef]
  264. Miyashita, E.; Komatsu, K.R.; and Saito, H. Large-scale analysis of RNA-protein interactions for functional RNA motif discovery using FOREST. Methods Mol. Biol. 2022, 2509, 279–290. [Google Scholar]
Figure 1. Structure of the plant core, proximal, entire promoter, and enhancer. Localization of representative cis-active motifs is provided together with corresponding trans-factors.
Figure 1. Structure of the plant core, proximal, entire promoter, and enhancer. Localization of representative cis-active motifs is provided together with corresponding trans-factors.
Applsci 14 04877 g001
Figure 2. Structure of an orthogonal trans-factor. NLS—nuclear localization signal, TAD—trans-activating domain, containing plant- or virus-derived elements, and DBD—DNA-binding domain not existing in plants and originating from the yeast of bacteria.
Figure 2. Structure of an orthogonal trans-factor. NLS—nuclear localization signal, TAD—trans-activating domain, containing plant- or virus-derived elements, and DBD—DNA-binding domain not existing in plants and originating from the yeast of bacteria.
Applsci 14 04877 g002
Figure 3. Synthetic trans-factor (STF) positively regulates the orthogonal expression system.
Figure 3. Synthetic trans-factor (STF) positively regulates the orthogonal expression system.
Applsci 14 04877 g003
Figure 4. Synthetic trans-factors that can negatively regulate the orthogonal expression system are produced by combining the yeast DBD from Gal4 with the SRDX repression domain. Alternatively, an STF containing only NLS and DBD could recognize the DNA sequence downstream of the core promoter to create a steric hindrance, protecting against RNA polymerase II preinitiation complex formation.
Figure 4. Synthetic trans-factors that can negatively regulate the orthogonal expression system are produced by combining the yeast DBD from Gal4 with the SRDX repression domain. Alternatively, an STF containing only NLS and DBD could recognize the DNA sequence downstream of the core promoter to create a steric hindrance, protecting against RNA polymerase II preinitiation complex formation.
Applsci 14 04877 g004
Figure 5. Structure of synthetic promoters recognized by transcription activator-like effectors (TALEs). The 19-base-long degenerate sequence is followed by the 18-base-long TALE-site, a TATAbox, a 43-base-long degenerate sequence, and the reporter gene. The presence of the 43-base-long degenerate sequence is consistent with the observation that TALE’s site localization, approximately within −55 or −40, is optimal to confer TALE-mediated inducibility.
Figure 5. Structure of synthetic promoters recognized by transcription activator-like effectors (TALEs). The 19-base-long degenerate sequence is followed by the 18-base-long TALE-site, a TATAbox, a 43-base-long degenerate sequence, and the reporter gene. The presence of the 43-base-long degenerate sequence is consistent with the observation that TALE’s site localization, approximately within −55 or −40, is optimal to confer TALE-mediated inducibility.
Applsci 14 04877 g005
Figure 6. The first generation of dCas9-dependent artificial trans-factors (ATFs). The deactivated form of the Cas9 protein (dCas9) is fused to the transcriptional activator domains VP64, ERF2, or EDLL to create ATFs. The ATF upregulates the expression of reporter genes via specific guide RNA (gRNA).
Figure 6. The first generation of dCas9-dependent artificial trans-factors (ATFs). The deactivated form of the Cas9 protein (dCas9) is fused to the transcriptional activator domains VP64, ERF2, or EDLL to create ATFs. The ATF upregulates the expression of reporter genes via specific guide RNA (gRNA).
Applsci 14 04877 g006
Figure 7. The second generation of dCas9-dependent artificial trans-factors (ATFs) contains the modified gRNA with two aptamer loops to allow the attachment of the viral MS2 protein. The MS2 protein is bound by activators (VPR) or other components acting as repressors or epigenetic regulators; this can increase the scope of regulatory functions compared to the first generation of dCas9-dependent artificial trans-factors (ATFs).
Figure 7. The second generation of dCas9-dependent artificial trans-factors (ATFs) contains the modified gRNA with two aptamer loops to allow the attachment of the viral MS2 protein. The MS2 protein is bound by activators (VPR) or other components acting as repressors or epigenetic regulators; this can increase the scope of regulatory functions compared to the first generation of dCas9-dependent artificial trans-factors (ATFs).
Applsci 14 04877 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Szymczyk, P.; Majewska, M. Plant Synthetic Promoters. Appl. Sci. 2024, 14, 4877. https://doi.org/10.3390/app14114877

AMA Style

Szymczyk P, Majewska M. Plant Synthetic Promoters. Applied Sciences. 2024; 14(11):4877. https://doi.org/10.3390/app14114877

Chicago/Turabian Style

Szymczyk, Piotr, and Małgorzata Majewska. 2024. "Plant Synthetic Promoters" Applied Sciences 14, no. 11: 4877. https://doi.org/10.3390/app14114877

APA Style

Szymczyk, P., & Majewska, M. (2024). Plant Synthetic Promoters. Applied Sciences, 14(11), 4877. https://doi.org/10.3390/app14114877

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop