Next Article in Journal
The Implementation of IoT Sensors in Fog Collector Towers and Flowmeters for the Control of Water Collection and Distribution
Previous Article in Journal
Radar-Based Target Tracking Using Deep Learning Approaches with Unscented Kalman Filter
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 14
Issue 18
10.3390/app14188333
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Long-Term Monitoring and Management of Genetically Modified Canola in Natural Environments: A 15-Year Study

by
Hye Song Lim
1,2,†,
Wonkyun Choi
1,†,
Young Jun Jung
1,
A-Mi Yoon
1,3,
Donghyeon Noh
1,4,
Jeong Hwan Lee
3,
Chul Min Kim
2,* and
Jung Ro Lee
1,*
1
National Institute of Ecology, 1210 Geumgang-ro, Maseo-myeon, Seocheon-gun 33657, Republic of Korea
2
Department of Horticulture Industry, Wonkwang University, Iksan-si 54538, Republic of Korea
3
Division of Life Sciences, Jeonbuk National University, Jeonju-si 54896, Republic of Korea
4
Division of Applied Life Science (BK21 Four), Gyeongsang National University, Jinju-si 52828, Republic of Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Appl. Sci. 2024, 14(18), 8333; https://doi.org/10.3390/app14188333
Submission received: 22 August 2024 / Revised: 13 September 2024 / Accepted: 14 September 2024 / Published: 16 September 2024
(This article belongs to the Section Environmental Sciences)
Browse Figures
Versions Notes

Abstract

:
The unintentional release of living modified organisms (LMOs) into natural environments poses potential ecological risks, particularly in terms of gene flow and biodiversity loss. Since 2009, the Ministry of Environment (MOE) in South Korea has conducted an extensive monitoring project to detect and manage LMOs, with a primary focus on LM canola. This study evaluates the outcomes of the LMO monitoring project over the past 15 years (2009–2023), analyzing the distribution, persistence, and management of LM canola across various environments. Our findings reveal that LM canola predominantly proliferates along roadsides, with occasional occurrences at festival and planting sites. Out of 10,571 monitored sites, 4326 suspicious samples were collected, with a significant increase observed in 2017, underscoring the ongoing risk of accidental releases. This study highlights the critical role of specific environments in the spread of LM canola, and assesses the effectiveness of post-management strategies in controlling these populations. The National Institute of Ecology (NIE) has developed and implemented advanced monitoring protocols and post-management systems tailored to the characteristics of the monitoring sites and the nature of the LMOs. These efforts have been effective in controlling the spread of LM canola, thereby helping to preserve the biodiversity of South Korea’s natural environments. In conclusion, the proactive and adaptive strategies employed by the NIE are essential for mitigating the ecological risks associated with LMOs. Our study emphasizes the importance of on-going vigilance and the continuous refinement of monitoring and management practices to safeguard biodiversity and ecosystems.

1. Introduction

Since the approval of the first living modified (LM) tomato in 1996, the cultivation of LM crops has expanded significantly worldwide. The advantages of LM crops include their ability to overcome biological challenges such as pests, weeds, and diseases. This leads to increased crop yields and quality, a reduced need for chemical pesticides, and enhanced resistance to environmental stresses. By 2020, LM crops were planted across 185.6 million hectares (Mhas), with a significant increase in cultivation in developing countries [1,2,3]. Major LM crops, including canola, soybean, maize, and cotton, now account for 47.4% of the total global planting area for these four crops [1,4]. Specifically, the global cultivation area of LM canola reached 10.1 Mhas in 2019. These crops typically carry genes conferring herbicide resistance (e.g., cp4-epsps genes from Agrobacterium tumefaciens strain CP4, pat genes from Streptomyces viridochromogenes, bar genes from S. hygroscopicus, dmo genes from Stenotrophomonas maltophilia strain DI-6, and aad-12 genes from Delftia acidovorans) [5,6,7,8,9,10] and insect resistance (e.g., Cry toxin genes from Bacillus thuringiensis) to improve agricultural productivity and food security [11,12,13,14,15]. Most LM canola varieties have been developed for herbicide resistance to improve weed control in cropping systems. However, insect pests, such as flea beetles (Phyllotreta cruciferae and Phyllotreta striolata), cutworms (family Noctuidae), and Eumylabris (Mylabris sibirica), continue to reduce crop yields by feeding on canola leaves and seeds in many countries [16]. Despite the benefits, the adoption of LM crops has raised concerns regarding potential environmental risks, particularly gene flow from LM crops to non-LM varieties or wild relatives [17,18,19]. In response to these risks, the Cartagena Protocol on Biosafety was adopted in 2000 to regulate LMOs resulting from modern biotechnology [20,21,22]. South Korea ratified this protocol in October 2007, with the Enforcement Decree of the Transboundary Movement of Living Modified Organisms Act (LMO Act) coming into force in January 2008 [23,24].
Since the implementation of the LMO Act, South Korea has seen a steady increase in the importation of LM crops, rising from 8527 million tons in 2008 to 10,282 million tons in 2023 [25]. The unintentional release of LMOs into natural environments during transportation and utilization presents a significant regulatory challenge, particularly given the complexity of maintaining environmental biodiversity [26].
Rapeseed (Brassica napus L.), commonly known as canola, is the second most important oilseed crop globally, following soybean [27,28]. B. napus (AACC, 2n = 38) is an amphidiploid species in the Brassicaceae family, formed by the hybridization of B. rapa (AA, 2n = 20) and B. oleracea (CC, 2n = 18) [29]. Brassica species are important in agriculture, and these genetic relations are discovered by U’s triangle [30,31]. Many species within the Brassicaceae family are used as vegetable crops. Leaf mustard (Brassica juncea) is widely cultivated, while wild leaf mustard (Brassica juncea L. Czern.) grows across South Korea, including in fields, along riversides, and by roadsides [32,33]. Brassica napus is primarily grown as a landscape crop for spring flower festivals [34]. Moreover, canola is a self-pollinating crop, but its pollen can be transported by wind and insects [35,36]. Most canola pollen travels less than 10 m, but pollen is transferred 1.5 km by wind and 4 km by insects such as honeybees [37]. Additionally, canola is pollen-mediated, outcrossing ranges from 12% to 55% [38,39]. The hybridization rate between canola and B. juncea was reported to be 3% [40,41], and it was reported that hybrids between B. napus and B. juncea have the potential to produce viable seeds [41,42].
The unintentional release of LM canola into natural environments raises significant concerns due to its potential for gene flow and seed dispersal. Consequently, comprehensive monitoring and post-management efforts are essential. Since 2009, the Ministry of Environment (MOE) in South Korea has led an extensive monitoring project aimed at detecting and managing the unintentional release of LMOs, with a particular focus on LM canola. This crop’s ability to establish in non-agricultural areas through self-pollination and seed dispersal mechanisms poses a risk to both agricultural systems and natural ecosystems.
This study evaluates the outcomes of the LMO monitoring project over the past 15 years, with a focus on the distribution, persistence, and management of LM canola in South Korea. By analyzing data from various monitoring sites, we aim to identify high-risk areas and assess the effectiveness of current post-management strategies. Our findings underscore the importance of sustained and adaptive monitoring systems in mitigating the ecological risks associated with LMOs. This research offers critical insights to inform policy and management practices, ensuring the continued protection of South Korea’s natural ecosystems from the unintended consequences of LMO release.

2. Materials and Methods

2.1. LMO Monitoring for LM Canola in Natural Environments

In 2008, the LMO Act came into effect in South Korea, leading to the initiation of a nationwide survey in 2009 to monitor the unintentional release of LM canola. The monitoring sites were strategically selected based on the proximity to food and feed factory locations, and the transportation routes from import harbors. The monitoring was conducted during the growing season of canola, and suspicious Brassica samples were collected within a 100-m radius of the monitoring site. Field photos, environmental data, and GPS co-ordinates (using a Garmin Montana 680, Garmin Inc., Olathe, KS, USA) were recorded for each area where suspicious samples were found. At survey sites, each plant sample was collected individually in separate paper bags to prevent contamination. The leaves were then divided for immunochemical testing, drying, and PCR analysis. If there were LMO suspicious plants, we sampled 10 individual plants from each quadrat within a 100-m radius, using a randomized selection method to ensure the sample accurately represented the plant population at each site. A 100-m radius was estimated from a central point at each site using Google Maps and GPS co-ordinates. An immunochemical test (Envirologix Inc., Portland, ME, USA) was performed on-site at the survey locations. The leaf samples were then dried with silica gel and stored at 4 °C. Each collected sample underwent LMO identification through PCR analysis and sequencing [43,44].

2.2. Identification of Collected LM Canola Samples

An immunochemical strip kit (Envirologix Inc., Portland, ME, USA) was utilized to analyze the monitoring samples, enabling the detection of CP4-EPSPS and PAT proteins, which confer tolerance to glyphosate and glufosinate herbicides. The collected samples were processed as follows: an extraction buffer was added to the ground sample tissue, and the testing strip was inserted into the extract [44].
Event-specific PCR was conducted to identify the LMO gene cassette within the canola genome of the collected samples. Certified reference materials (CRMs) from the American Oil Chemists’ Society (Urbana, IL, USA) and the Institute for Reference Materials and Measurements (Geel, Belgium) were used as controls during the PCR analysis. Genomic DNA from leaf tissues was extracted using the Nucleic Acid Extraction kit (TIANLONG, Xi’an, China), following the manufacturer’s protocol. The primer set for the CruA gene was employed as a control in the PCR reactions. Specific PCR analysis, using primer sets for eight LM canola events, was performed to characterize the suspicious samples, as described in Table 1.
The PCR was conducted using the 2X Lamp Taq PCR Pre-Mix (Biofact Inc., Daejeon, Korea) in a 30 µL reaction volume, containing 50 ng of genomic DNA and 1 µL of each primer (10 pmol/µL). The PCR amplification was performed on the ProFlex PCR System (Applied Biosystems, Waltham, MA, USA) with the following program: initial denaturation at 95 °C for 5 min, followed by 33 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 30 s. A final extension was carried out at 72 °C for 7 min, followed by a hold at 4 °C [45]. The PCR products were electrophoresed on a 2.5% agarose gel and identified using the ChemiDoc XRS+ Imaging System (Bio-Rad, Hercules, CA, USA). Sequencing of the PCR products was performed by Biofact Inc. (Daejeon, Korea) to confirm event-specific amplification. The sequences were aligned using the BioEdit v7.2.6.0 program [46].
Table 1. Oligonucleotide primers were used in this study.
Table 1. Oligonucleotide primers were used in this study.
Target Event (Or Gene)Primer NameSequence (5′-3′)Product Size (bp)Reference
Topas 19/2Topas 19/2-FCGACCGGCGCTGATATATGA95[47]
Topas 19/2-RGTTGCGGTTCTGTCAGTTCC
Rf3Rf3-FAGCATTTAGCATGTACCATCAGACA267[48]
Rf3-RATCAATATCATTGCAACGGAAAAGGThis study
MON88302MON88302-FTCAGATTGTCGTTTCCCGCCTTCA304[49]
MON88302-RGTCTTTGCTTTTGGCTCTTACTTTTGCG[50]
Ms8Ms8-FCCAAATAGCCTCCCACCCTATA249[23]
Ms8-RGGAGGGTGTTTTTGGTTATC[51]
GT73GT73-FGCTTATACGAAGGCAAGAAAAGGA321[52]
GT73-RGAAGTTTCTCATCTAAGCCCCCATTTGThis study
DP-073496-4DP-073496-4-FGCTGGTCCAATTCAGATATGGT350This study
DP-073496-4-RCAAACCTCCATAGAGTTCAACATCTTAA[53]
T45T45-FCAAGCGTGTCGTGCTCCACCATGTT378[23]
T45-RGAACATAGATCGAGTCTCCCA[54]
MS11MS11-FCAAGATGGGAATTAACATCTACAAATTG535[55]
MS11-RGCAGCACTGCTACTGGTCAAThis study
Cru ACru A -FGTCAAGGCCAAGGACAACAG154This study
Cru A-RCCGTCGTTGTAGAACCATTGG[55]

2.3. Classification of LM Canola Collection Sites

After identifying LM canola samples through event-specific PCR analysis, the collection sites were re-surveyed to gather additional environmental information within a 100-m radius. Based on the collected data, the LM canola sites were classified into one of five categories: port, roadside, stockbreeding farm, feed factory, and other [43].

2.4. Post-Management of LM Canola Collection Site

Post-management activities were conducted based on LM canola monitoring data, including location and plant life cycle information, to prevent further proliferation of the LM canola. Additionally, the distribution status of the LM canola was mapped using ArcGIS ArcMap [56].

3. Results and Discussion

3.1. The LMO Monitoring Project for LM Canola

Since 2009, the MOE has conducted a comprehensive LMO monitoring project aimed at managing the unintentional release of LMOs into natural environments, as shown in Figure 1A. The project consists of four key steps: (i) selecting quadrat nationwide and conducting monitoring within a 100-m radius of each site, (ii) identifying LMOs through event-specific PCR and sequencing, (iii) classifying the LMO collection site, and (iv) conducting intensive surveys and post-management of the sites where LMOs were released. The NIE has been responsible for performing LMO monitoring, considering factors such as the growth period and the types of introduced genes in LM canola. Each year, NIE has analyzed and managed the factors contributing to the detection of LM canola.
Each year, the classification of LMO collection sites is used to develop post-management and survey strategies for the following year. Based on this information, we classified the collection sites into four categories: roadsides, stockbreeding farms, feed factories, and “other”, which includes festival sites. Figure 1B–E shows typical monitoring sites where LM canola is surveyed, along with the surrounding natural ecosystem, based on the detailed address.

3.2. Analysis of LM Canola Survey Data from 2009 to 2023

We analyzed the LM canola monitoring results from 2009 to 2023, focusing on the number of survey sites and the collection of suspicious samples. The initial number of LMO monitoring sites was 159 in 2009, 169 in 2010, and 177 in 2011 (Figure 2A), with a focus on natural environments along major transportation routes from harbors to feed and food factories. Based on the monitoring results from the first three years, the number of survey sites increased annually from 2012 onwards, with a temporary spike in 2017 due to a massive spill of LM canola nationwide. The survey sites continued to increase through 2023, reflecting the areas of LM canola re-collection and the monitoring results from the previous year. Over the 15-year period, a total of 10,571 survey sites were monitored, and 4326 suspicious canola samples were collected (Figure 2A). The number of monitoring sites significantly increased in 2012, leading to a temporary rise in suspicious samples, but the number of samples collected between 2009 and 2016 remained relatively consistent. However, since 2017, they have increased due to the intensive survey of LMO collection areas. The NIE increased the number of samples from 2021 due to concerns about gene flow from LMOs to related species in the natural environment. As a result, the number of suspicious samples gradually increased, and the number of samples collected in 2023 was approximately four times higher than in 2020. A total of 2403 suspicious samples were collected from 2021 to 2023, accounting for 55.5% of the suspicious LM canola samples collected over the 15 years.

3.3. Analysis of LM Canola Monitoring Results over Fifteen Years

A total of 4326 suspicious samples were initially tested for LMO proteins, such as CP4-EPSPS, PAT/bar, and PAT/pat, using an immunochemical strip kit. Based on these results, an event-specific PCR was conducted to identify the introduced LMO gene, event name, and manufacturer of each confirmed LMO sample. From 2009 to 2023, 441 LM canola samples were confirmed, including 437 GT73 event plants with the introduced CP4-EPSPS gene and 4 Topas 19/2 plants with the introduced bar gene. Over 15 years, LMOs were detected at 65 sites (Figure 2B). For eight years, LM canola was collected from eight sites: one in 2009, five in 2012, one in 2015, and one in 2016. From 2009 to 2016, the number of collected LM canola samples matched the number of collection sites. However, in 2017, the unintentional presence of LM canola seeds in imported non-LM canola led to a significant environmental release of LM canola, particularly in festival areas nationwide. As a result, the number of collection sites increased to 20, and the number of LM canola samples rose to 93. Following intensive investigation and post-management, the number of LM canola collection sites and LMO samples decreased between 2018 and 2020. In 2021, the number of LMO collection sites increased due to concerns about gene flow from LM canola, which led to the expansion of survey sites (Figure 2B).
Madsen reported that the viability of canola seeds could be maintained for at least five years in disturbed soils and up to 16 years in undisturbed soils at a depth of 20 cm [57]. Similar findings were reported in Korean soil [57]. This research suggests that LM canola may continue to be found at the same survey sites due to the presence of a canola seed bank. To effectively manage LM canola post-release, a re-survey was conducted at least four times a year, leading to a decrease in LM canola re-collection since 2017. Despite a decrease in LM canola samples since 2017 (Figure 2B), concerns about gene flow and the increasing number of monitoring sites led to a rise in collection samples from 42 in 2021 to 155 in 2022. Through post-management and the removal of suspicious LM canola, the total number of suspicious LM canola samples decreased to 74 in 2023. These data indicate that released LM canola may continue to grow at the same sites, underscoring the importance of site analysis and post-management.

3.4. Classification of LM Canola Collection Sites from 2009 to 2023

LMO monitoring determines the survey radius and intensive survey period for the following year based on the classification of LMO collection sites. It is essential to analyze the classification of these sites for effective post-management, considering factors such as seed dispersibility and the germination potential of the seed bank, depending on the environment where LM canola is collected. Thus, LM canola collection sites were analyzed annually for survey and post-management purposes.
As shown in Figure 3A, the LM canola population spread across the country, excluding Jeju Island. Collection sites were classified as roadside or stockbreeding farms if they were within 100 m of where canola was discovered growing in a natural environment. Festival and planting sites were classified as “other”, indicating that they did not fall into the four specific categories (roadside, stockbreeding farm, feed factory, and other areas). Over fifteen years, 441 LM canola collection areas were analyzed. Of these, 78.0% (344 sites) were roadside areas, 19.9% (88 sites) were classified as other areas, 1.4% (6 sites) were stockbreeding farms, and 0.7% (3 sites) were feed factories (Figure 3B). Further analysis indicated that LM canola was primarily released and grew in natural environments near roadsides and other areas (festival and planting sites) each year. These findings suggest that re-surveys and post-management efforts should focus on roadside areas.

3.5. Analysis of LM Canola Re-Collection Sites from 2014 to 2021

We investigated the unintentional release of LM canola in natural environments from 2009 to 2023 and analyzed LMO re-collection sites. Considering the natural habitats and seed dispersal characteristics of the Brassicaceae family, it is important to explore how many LM canola samples were re-collected at the same site over 15 years. Based on previous LM canola collection areas, re-survey sites were determined using a 1 km radius sample quadrat, identified through Google Maps. An intensive survey was then conducted at these sites as part of post-management efforts. From 2009 to 2023, the number of LM canola re-collection sites was analyzed by year (Table 2). Since 2017, as environmental releases of LM canola increased, re-collection has also risen annually. Intensive post-management of LM canola led to an increase in re-collected sites.
Figure 4 shows the nationwide re-collection of LM canola since 2009. These results indicate that resurveying for LM canola is mandatory for managing the environmental risks associated with Brassica species.

3.6. Post-Management System of LM Canola

Spring canola (Brassica campestris L.) seeds have been shown to survive in snow-covered fields, overwinter in no-till fields, and even persist with broken stems [58,59]. In Canada, wild canola plants were found in fields 4–5 years after canola cultivation, suggesting that if the seed bank remains viable, spontaneous germination is possible [57,59]. It has been reported that LM canola volunteers were observed in farmland or release areas for up to 8 years in France, more than 10 years in Sweden, and up to 15 years in Germany [60,61,62]. These observations suggest that canola seeds exhibit greater seed dormancy compared to other crops. Dormant seeds have a high potential to germinate into undesirable weeds at subsequent planting sites. Given that South Korea has a climate with average temperatures and rainfall similar to France and Germany, it is plausible that the seed dormancy of Brassica family crops in South Korea might also be comparable to that in these countries. Additionally, it has been reported that canola seeds in the soil seed bank degrade up to 95% within 3 to 9 years, and up to 99% within 5 to 17 years [60]. Therefore, post-management based on LM canola seed characteristics is crucial to prevent its re-collection.
During LM canola monitoring, if suspicious samples are found, a rapid preliminary LMO determination should be performed on-site using a strip test (Figure 5A). If the samples are confirmed as LM canola, individual canola plants should be sampled, and event-specific PCR should be conducted to confirm the event name. When re-surveying the LMO collection site for post-management, a 1 km radius of the monitoring site should be surveyed to check for related species such as mustard (B. juncea), cabbage (B. oleracea), and Chinese cabbage (B. rapa) (Figure 5B). Collected related species of the Brassicaceae family are subjected to event analysis similar to LM canola monitoring.
Even if no LM canola or gene-transferred species are found, the monitoring sites should be surveyed four times a year to ensure the absence of LMOs. If a small population of LM canola is found, its removal must be carried out following the management manual provided by relevant government agencies, as outlined by the LMO Act. In cases where LM canola growth is extensive, the monitoring results should be reported to the head of the relevant central administrative agency, and removal actions such as mowing and herbicide application may be necessary to control the settlement of LM canola. Over the past five years in South Korea, only GT73 LM canola, developed by Monsanto and containing the glyphosate-resistant gene CP4-EPSPS, has been discovered. The post-management for GT73 has involved hand weeding and applying herbicides like glufosinate in natural environments.
Given that canola includes both winter and spring varieties, which can be cultivated in winter, LM canola monitoring must be conducted throughout the year [63,64,65]. Over the past five years, a priority management site has been designated if LM canola is detected more than twice during monitoring [45]. Intensive surveys and the removal of LM canola and related Brassica species before they flower are critical for preventing gene transfer and seed dispersal. The NIE has continuously enhanced the annual LM canola monitoring and post-management systems over the past 15 years, effectively controlling the environmental release of LM canola and safeguarding the natural environment of South Korea.

4. Conclusions

Over the past 15 years, the systematic monitoring and management of LM canola by the Ministry of Environment (MOE) and the National Institute of Ecology (NIE) have been crucial in mitigating the risks associated with the unintentional release of LM canola into natural environments. This study analyzed extensive data collected from 2009 to 2023, providing significant insights into the distribution, persistence, and management of LM canola in South Korea. The data indicate that LM canola primarily proliferates in roadside areas, with occasional occurrences in other locations such as festivals and planting sites. The analysis of 441 collection sites over this period underscores the role of these specific environments in the spread and establishment of LM canola and related populations. Notably, the significant increase in suspicious LM canola samples since 2017 highlights the consequences of accidental releases. In 2017, the number of collected LM canola samples (93) increased by approximately 12 times compared to the total collected from 2009 to 2016 (8).
Our findings emphasize the necessity of a comprehensive post-management system for LM canola. The persistent re-collection of LM canola at the same sites suggests that seed banks can remain viable and germinate over several years, necessitating continuous monitoring and immediate action following environmental release. The approach, which includes on-site rapid detection, expanded survey radii, and appropriate physical or chemical control methods, has been instrumental in effectively managing LM canola populations.
The advanced LMO monitoring protocols and post-management strategies, informed by an analysis of collection site types and an understanding of LMO gene types, have successfully prevented the widespread proliferation of LM canola. This ongoing effort is critical for conserving the integrity of South Korea’s and Asia’s natural environments against the potential risks posed by LMOs.
In conclusion, our study demonstrates that the proactive and adaptive strategies employed by the NIE are vital for controlling the unintentional settlement of LM canola. Continued improvement and implementation of these post-management strategies will be essential for safeguarding ecological health and biodiversity in the face of ongoing challenges associated with LMOs.

Author Contributions

Conceptualization, H.S.L. and J.R.L.; methodology, H.S.L. and J.R.L.; validation, H.S.L. and J.R.L.; formal analysis, H.S.L., W.C., Y.J.J., A.-M.Y., D.N. and J.R.L.; investigation, H.S.L., W.C., Y.J.J., A.-M.Y., D.N. and J.R.L.; resources, H.S.L. and J.R.L.; data curation, H.S.L. and J.R.L.; writing—original draft preparation, H.S.L., W.C. and J.R.L.; writing—review and editing, C.M.K., J.H.L. and J.R.L.; visualization, H.S.L. and J.R.L.; supervision, J.R.L.; project administration, J.R.L.; funding acquisition, J.R.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by a grant from the National Institute of Ecology (NIE), funded by the Ministry of Environment (MOE) of the Republic of Korea (NIE-A-2024-06 and NIE-A-2024-07).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Brookes, G. Genetically Modified (GM) Crop Use 1996–2020: Environmental Impacts Associated with Pesticide Use Change. GM Crops Food 2022, 13, 262–289. [Google Scholar] [CrossRef] [PubMed]
  2. Stein, A.; Rodríguez-Cerezo, E. Low-Level Presence of New GM Crops: An Issue on the Rise for Countries Where They Lack Approval. AgBioForum 2010, 13, 173–182. Available online: https://publications.jrc.ec.europa.eu/repository/handle/JRC54768 (accessed on 19 August 2024).
  3. Pellegrino, E.; Bedini, S.; Nuti, M.; Ercoli, L. Impact of Genetically Engineered Maize on Agronomic, Environmental and Toxicological Traits: A Meta-Analysis of 21 Years of Field Data. Sci. Rep. 2018, 8, 3113. [Google Scholar] [CrossRef]
  4. Brookes, G. GM Crops: Global Socio-Economic and Environmental Impacts 1996–2020. 2022. Available online: https://pgeconomics.co.uk/pdf/Globalimpactbiotechcropsfinalreportoctober2022.pdf (accessed on 19 August 2024).
  5. Kim, J.-H.; Kim, E.-H.; Yea, M.-C.; Kim, H.-Y. Validation of A Multiplex PCR Detection Kit for Screening of Herbicide-Tolerant Genes in Genetically Modified Crops. J. Korean Soc. Appl. Biol. Chem. 2013, 56, 251–254. [Google Scholar] [CrossRef]
  6. Hussain, A.; Ding, X.; Alariqi, M.; Manghwar, H.; Hui, F.; Li, Y.; Cheng, J.; Wu, C.; Cao, J.; Jin, S. Herbicide Resistance: Another Hot Agronomic Trait for Plant Genome Editing. Plants 2021, 10, 621. [Google Scholar] [CrossRef]
  7. Christ, B.; Hochstrasser, R.; Guyer, L.; Francisco, R.; Aubry, S.; Hörtensteiner, S.; Weng, J.-K. Nonspecific Activities of the Major Herbicide-Resistance Gene BAR. Nat. Plants 2017, 3, 937–945. [Google Scholar] [CrossRef]
  8. Braxton, L.B.; Richburg, J.S.; York, A.C.; Culpepper, A.S.; Haygood, R.A.; Lovelace, M.L.; Perry, D.H.; Walton, L.C. Resistance of EnlistTM (AAD-12) Cotton to Glufosinate. Weed Technol. 2017, 31, 380–386. [Google Scholar] [CrossRef]
  9. Prakash, N.R.; Chaudhary, J.R.; Tripathi, A.; Joshi, N.; Padhan, B.K.; Yadav, S.; Kumar, S.; Kumar, R. Breeding for Herbicide Tolerance in Crops: A Review. Res. J. Biotechnol. 2020, 15, 154–162. Available online: https://worldresearchersassociations.com/Archives/RJBT/Vol(15)2020/April2020.aspx (accessed on 19 August 2024).
  10. Green, J.M.; Owen, M.D.K. Herbicide-Resistant Crops: Utilities and Limitations for Herbicide-Resistant Weed Management. J. Agric. Food Chem. 2011, 59, 5819–5829. [Google Scholar] [CrossRef]
  11. George, D.G. Engineering Insect-Resistant Crops: A Review. Afr. J. Biotechnol. 2013, 12. Available online: https://www.ajol.info/index.php/ajb/article/view/132064 (accessed on 19 August 2024).
  12. Pardo-López, L.; Muñoz-Garay, C.; Porta, H.; Rodríguez-Almazán, C.; Soberón, M.; Bravo, A. Strategies to Improve the Insecticidal Activity of Cry Toxins from Bacillus Thuringiensis. Peptides 2009, 30, 589–595. [Google Scholar] [CrossRef] [PubMed]
  13. Tabashnik, B.E.; Van Rensburg, J.B.J.; Carrière, Y. Field-Evolved Insect Resistance to Bt Crops: Definition, Theory, and Data. J. Econ. Entomol. 2009, 102, 2011–2025. [Google Scholar] [CrossRef] [PubMed]
  14. Estruch, J.J.; Warren, G.W.; Mullins, M.A.; Nye, G.J.; Craig, J.A.; Koziel, M.G. Vip3A, a Novel Bacillus Thuringiensis Vegetative Insecticidal Protein with a Wide Spectrum of Activities against Lepidopteran Insects. Proc. Natl. Acad. Sci. USA 1996, 93, 5389–5394. [Google Scholar] [CrossRef] [PubMed]
  15. Talakayala, A.; Katta, S.; Garladinne, M. Genetic Engineering of Crops for Insect Resistance: An Overview. J. Biosci. 2020, 45, 114. Available online: https://www.ias.ac.in/article/fulltext/jbsc/045//0114 (accessed on 19 August 2024). [CrossRef]
  16. Shen, C.-H.; Tang, M.; Li, X.-F.; Zhu, L.; Li, W.; Deng, P.; Zhai, Q.; Wu, G.; Yan, X.-H. Evaluation of Reference Genes for Quantitative Expression Analysis in Mylabris Sibirica (Coleoptera, Meloidae). Front. Physiol. 2024, 15, 1345836. [Google Scholar] [CrossRef]
  17. Knispel, A.L.; McLachlan, S.M.; Acker, R.C.V.; Friesen, L.F. Gene Flow and Multiple Herbicide Resistance in Escaped Canola Populations. Weed Sci. 2008, 56, 72–80. [Google Scholar] [CrossRef]
  18. Kawata, M.; Murakami, K.; Ishikawa, T. Dispersal and Persistence of Genetically Modified Oilseed Rape around Japanese Harbors. Environ. Sci. Pollut. Res. Int. 2009, 16, 120–126. [Google Scholar] [CrossRef]
  19. Andow, D.A.; Zwahlen, C. Assessing Environmental Risks of Transgenic Plants. Ecol. Lett. 2006, 9, 196–214. [Google Scholar] [CrossRef]
  20. Schütte, G.; Eckerstorfer, M.; Rastelli, V.; Reichenbecher, W.; Restrepo-Vassalli, S.; Ruohonen-Lehto, M.; Saucy, A.-G.W.; Mertens, M. Herbicide Resistance and Biodiversity: Agronomic and Environmental Aspects of Genetically Modified Herbicide-Resistant Plants. Environ. Sci. Eur. 2017, 29, 5. [Google Scholar] [CrossRef]
  21. Convention on Biological Diversity|JNCC–Adviser to Government on Nature Conservation. Available online: https://jncc.gov.uk/our-work/convention-on-biological-diversity/ (accessed on 19 August 2024).
  22. Unit, B. Handling, Transport, Packaging and Identification. Available online: https://bch.cbd.int/protocol/cpb_art18.shtml (accessed on 19 August 2024).
  23. Kim, I.R.; Lim, H.S.; Choi, W.; Kang, D.I.; Lee, S.Y.; Lee, J.R. Monitoring Living Modified Canola Using an Efficient Multiplex PCR Assay in Natural Environments in South Korea. Appl. Sci. 2020, 10, 7721. [Google Scholar] [CrossRef]
  24. Kim, E.-S. Technocratic Precautionary Principle: Korean Risk Governance of Genetically Modified Organisms. New Genet. Soc. 2014, 33, 204–224. [Google Scholar] [CrossRef]
  25. Korea Biosafety Cleaning House. Available online: https://www.biosafety.or.kr/ (accessed on 19 August 2024).
  26. Lim, Y.; Yook, M.J.; Zhang, C.J.; Nah, G.; Park, S.; Kim, D.S. Dormancy Associated Weedy Risk of the F1 Hybrid Resulted from Gene Flow from Oilseed Rape to Mustard. Weed Turfgrass Sci. 2015, 4, 35–43. [Google Scholar] [CrossRef]
  27. Liu, J.; Wu, Y.; Zhang, X.; Gill, R.A.; Hu, M.; Bai, Z.; Zhao, C.; Zhang, Y.; Liu, Y.; Hu, Q.; et al. Functional and Evolutionary Study of MLO Gene Family in the Regulation of Sclerotinia Stem Rot Resistance in Brassica Napus, L. Biotechnol. Biofuels Bioprod. 2023, 16, 86. [Google Scholar] [CrossRef] [PubMed]
  28. Friedt, W.; Tu, J.; Fu, T. Academic and Economic Importance of Brassica Napus Rapeseed. In The Brassica napus Genome; Liu, S., Snowdon, R., Chalhoub, B., Eds.; Springer International Publishing: Cham, Germany, 2018; pp. 1–20. ISBN 978-3-319-43694-4. [Google Scholar]
  29. Woodfield, H.K.; Harwood, J.L. Oilseed Crops: Linseed, Rapeseed, Soybean, and Sunflower. In Encyclopedia of Applied Plant Sciences, 2nd ed.; Thomas, B., Murray, B.G., Murphy, D.J., Eds.; Academic Press: Oxford, UK, 2017; pp. 34–38. ISBN 978-0-12-394808-3. [Google Scholar]
  30. Howell, E.C.; Kearsey, M.J.; Jones, G.H.; King, G.J.; Armstrong, S.J. A and C Genome Distinction and Chromosome Identification in Brassica Napus by Sequential Fluorescence in Situ Hybridization and Genomic in Situ Hybridization. Genetics 2008, 180, 1849–1857. [Google Scholar] [CrossRef] [PubMed]
  31. Tu, Y.-K.; Chen, H.-W.; Tseng, K.-Y.; Lin, Y.-C.; Kuo, B.-J. Morphological and Genetic Characteristics of F1 Hybrids Introgressed from Brassica Napus to B. Rapa in Taiwan. Bot. Stud. 2020, 61, 1. [Google Scholar] [CrossRef]
  32. Kwon, H.-Y.; Choi, S.-I.; Park, H.-I.; Choi, S.-H.; Sim, W.-S.; Yeo, J.-H.; Cho, J.-H.; Lee, O.-H. Comparative Analysis of the Nutritional Components and Antioxidant Activities of Different Brassica Juncea Cultivars. Foods 2020, 9, 840. [Google Scholar] [CrossRef] [PubMed]
  33. Ko, H.; Hur, O.; Kang, M.-J.; Ro, N.; Hyun, D.-Y.; Cho, G.-T.; Choi, Y.-M.; Gwag, J.; Baek, H.-J.; Kim, C.-Y. Collect. Charact. Leaf Mustard (Brassica Juncea) Korea Poster Board #429. 2012. Available online: https://cdn.ymaws.com/ashs.org/resource/resmgr/files/2012ashsfullconfprogram.pdf (accessed on 19 August 2024).
  34. Kwon, D.-E.; Kim, K.-S.; Hwang, E.-J.; Park, J.-C.; Lee, J.-E.; Lee, Y.-H. Changes in Growth and Productivity Characteristics by Sowing Date on Spring Sowing Rapeseed (Brassica napus L.) in Paddy Field of Southern Region of South Korea. Korean J. Crop Sci. 2021, 66, 80–86. [Google Scholar] [CrossRef]
  35. Amro, A.M. Pollinators and Pollination Effects on Three Canola (Brassica Napus, L.) Cultivars: A Case Study in Upper Egypt. J. King Saud Univ. Sci. 2021, 33, 101240. [Google Scholar] [CrossRef]
  36. Stewart, A. A Review of Brassica Species, Cross-Pollination and Implications for Pure Seed Production in New Zealand. 2002. Available online: https://www.agronomysociety.org.nz/uploads/94803/files/2002_9._Review_-_Brassica_cross-pollination.pdf (accessed on 19 August 2024).
  37. Salisbury, P.A. The Myths of Gene Transfer—A Canola Case Study. PlantProtection Q. 2000, 15, 2. Available online: https://caws.org.nz/PPQ131415/PPQ%2015-2%20pp071-76%20Salisbury.pdf (accessed on 19 August 2024).
  38. Légère, A. Risks and Consequences of Gene Flow from Herbicide-Resistant Crops: Canola (Brassica Napus L) as a Case Study. Pest Manag. Sci. 2005, 61, 292–300. [Google Scholar] [CrossRef]
  39. Damgaard, C.; Kjellsson, G. Gene Flow of Oilseed Rape (Brassica Napus) According to Isolation Distance and Buffer Zone. Agric. Ecosyst. Environ. 2005, 108, 291–301. [Google Scholar] [CrossRef]
  40. Aono, M.; Wakiyama, S.; Nagatsu, M.; Nakajima, N.; Tamaoki, M.; Kubo, A.; Saji, H. Detection of Feral Transgenic Oilseed Rape with Multiple-Herbicide Resistance in Japan. Env. Biosaf. Res 2006, 5, 77–87. [Google Scholar] [CrossRef] [PubMed]
  41. The Biology of Brassica Napus, L. (Canola). Department of Health and Ageing Office of the Gene Technology Regulator. Available online: https://bangladeshbiosafety.org/wp-content/uploads/2017/06/Biology_of_Canola_Au.pdf (accessed on 19 August 2024).
  42. Spontaneous Hybridization between Oilseed Rape (Brassica napus) and Weedy Relatives | International Society for Horticul-tural Science. Available online: http://www.actahort.org/books/407/407_23.htm (accessed on 19 August 2024).
  43. Lim, H.S.; Kim, I.R.; Lee, S.; Choi, W.; Yoon, A.-M.; Lee, J.R. Establishment and Application of a Monitoring Strategy for Living Modified Cotton in Natural Environments in South Korea. Appl. Sci. 2021, 11, 10259. [Google Scholar] [CrossRef]
  44. Kim, D.W.; Kim, I.R.; Lim, H.S.; Choi, W.; Lee, J.R. Development of a Multiplex PCR Assay to Monitor Living Modified Cottons in South Korea. Appl. Sci. 2019, 9, 2688. [Google Scholar] [CrossRef]
  45. Lim, H.S.; Yoon, A.-M.; Kim, I.R.; Choi, W.; Jung, Y.J.; Lee, S.; Lee, J.R. Effectiveness of a Priority Management Scheme of Living Modified Organism Re-Collection Areas in Natural Environments of South Korea. Appl. Sci. 2023, 13, 7185. [Google Scholar] [CrossRef]
  46. Hall, T. Bioedit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/ NT. Available online: https://www.semanticscholar.org/paper/BIOEDIT%3A-A-USER-FRIENDLY-BIOLOGICAL-SEQUENCE-EDITOR-Hall/0ae262d9cf78536754bc064e07113ab5e978f208 (accessed on 19 August 2024).
  47. Topas 19-2 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/1021/Topas%2019-2 (accessed on 19 August 2024).
  48. Rf3 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/22/Rf3 (accessed on 19 August 2024).
  49. MON 88302 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/1132/MON%2088302 (accessed on 19 August 2024).
  50. Seol, M.-A.; Jo, B.-H.; Choi, W.; Shin, S.Y.; Eum, S.-J.; Kim, I.R.; Song, H.-R.; Lee, J.R. Development of Detection Methods for Six Approved LM Crops in Korea. J. Plant Biotechnol. 2017, 44, 97–106. [Google Scholar] [CrossRef]
  51. Ms8 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/21/Ms8 (accessed on 19 August 2024).
  52. GT73 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/24/GT73 (accessed on 19 August 2024).
  53. Gmomethods | Eurl Gmff. Available online: https://gmo-crl.jrc.ec.europa.eu/gmomethods/entry?db=gmometh&nr=96&rq=ac%3aDP-073496-4 (accessed on 19 August 2024).
  54. Jo, B.-H.; Lee, J.; Choi, W.; Moon, J.; Shin, S.; Eum, S.J.; Seol, M.-A.; Kim, I.; Song, H.-R. Development of Multiplex PCR-Based Detection Method for Five Approved LM Canola Events in Korea. J. Plant Biotechnol. 2015, 42, 117–122. [Google Scholar] [CrossRef]
  55. Ms11 Documents | European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF). Available online: https://gmo-crl.jrc.ec.europa.eu/method-validation/details/all/2027/Ms11 (accessed on 19 August 2024).
  56. Kim, Y.-C.; Kim, A.; Lim, J.; Kim, T.-S.; Park, S.-G.; Kim, M.; Lee, J.-H.; Lee, J.R.; Lee, D.-H. Distribution and Management of Nutria (Myocastor Coypus) Populations in South Korea. Sustainability 2019, 11, 4169. [Google Scholar] [CrossRef]
  57. Umurzokov, M.; Jia, W.; Cho, K.M.; Khaitov, B.; Sohn, S.I.; Cho, J.W.; Park, K.W. Persistence, Viability and Emergence Rate of Canola (Brassica Napus L) in Korean Soil. WeedTurfgrass Sci. 2019, 8, 309–318. [Google Scholar] [CrossRef]
  58. Sparrow, S.D.; Knight, C.W.; Conn, J.S. Canola Seed Survival over Winter in the Field in Alaska. Can. J. Plant Sci. 1990, 70, 799–807. [Google Scholar] [CrossRef]
  59. Simard, M.-J.; Légère, A.; Pageau, D.; Lajeunesse, J.; Warwick, S. The Frequency and Persistence of Volunteer Canola (Brassica Napus) in Québec Cropping Systems. Weed Technol. 2002, 16, 433–439. [Google Scholar] [CrossRef]
  60. Belter, A. Long-Term Monitoring of Field Trial Sites with Genetically Modified Oilseed Rape (Brassica Napus, L.) in Saxony-Anhalt, Germany. Fifteen Years Persistence to Date but No Spatial Dispersion. Genes 2016, 7, 3. [Google Scholar] [CrossRef] [PubMed]
  61. Messéan, A.; Sausse, C.; Gasquez, J.; Darmency, H. Occurrence of Genetically Modified Oilseed Rape Seeds in the Harvest of Subsequent Conventional Oilseed Rape over Time. Eur. J. Agron. 2007, 27, 115–122. [Google Scholar] [CrossRef]
  62. D’Hertefeldt, T.; Jørgensen, R.B.; Pettersson, L.B. Long-Term Persistence of GM Oilseed Rape in the Seedbank. Biol. Lett. 2008, 4, 314–317. [Google Scholar] [CrossRef] [PubMed]
  63. Assefa, Y.; Prasad, P.V.V.; Foster, C.; Wright, Y.; Young, S.; Bradley, P.; Stamm, M.; Ciampitti, I.A. Major Management Factors Determining Spring and Winter Canola Yield in North America. Crop Sci. 2018, 58, 1–16. [Google Scholar] [CrossRef]
  64. Spring vs. Winter Canola Phenology across Australia: New Insights for WA Growers–GRDC. Available online: https://grdc.com.au/resources-and-publications/grdc-update-papers/tab-content/grdc-update-papers/2022/03/spring-vs-winter-canola-phenology-across-australia-new-insights-for-wa-growers (accessed on 19 August 2024).
  65. Fiebelkorn, D.; Rahman, M. Development of a Protocol for Frost-Tolerance Evaluation in Rapeseed/Canola (Brassica napus, L.). Crop J. 2016, 4, 147–152. [Google Scholar] [CrossRef]
Applsci 14 08333 g001
Figure 1. LMO monitoring project and typical monitoring sites. (A) Processing scheme for the LMO monitoring project in natural environments. Field images of suspected LM canola growing near (B) roadside, (C) stockbreeding farm, (D) feed factory, and (E) other areas, such as a festival site.
Figure 1. LMO monitoring project and typical monitoring sites. (A) Processing scheme for the LMO monitoring project in natural environments. Field images of suspected LM canola growing near (B) roadside, (C) stockbreeding farm, (D) feed factory, and (E) other areas, such as a festival site.
Applsci 14 08333 g001
Applsci 14 08333 g002
Figure 2. Survey results of LM canola monitoring from 2009 to 2023. (A) The number of LMO monitoring sites (circle) and collected suspicious samples (square) by year. (B) The number of LM canola collection sites (X-labeled) and collected LM canola samples (triangle) across nationwide LMO monitoring areas over fifteen years.
Figure 2. Survey results of LM canola monitoring from 2009 to 2023. (A) The number of LMO monitoring sites (circle) and collected suspicious samples (square) by year. (B) The number of LM canola collection sites (X-labeled) and collected LM canola samples (triangle) across nationwide LMO monitoring areas over fifteen years.
Applsci 14 08333 g002
Applsci 14 08333 g003
Figure 3. Classification of LM canola collection sites from 2009 to 2023. (A) Distribution of LM canola collection sites in South Korea for fifteen years. (B) Percentages of collection site types.
Figure 3. Classification of LM canola collection sites from 2009 to 2023. (A) Distribution of LM canola collection sites in South Korea for fifteen years. (B) Percentages of collection site types.
Applsci 14 08333 g003
Applsci 14 08333 g004
Figure 4. Distribution of LM canola re-collection sites in South Korea for fifteen years.
Figure 4. Distribution of LM canola re-collection sites in South Korea for fifteen years.
Applsci 14 08333 g004
Applsci 14 08333 g005
Figure 5. Monitoring and management of LM canola. (A) General LM canola monitoring process. (B) The post-management process for the fulfillment of LMO safety policy and research in South Korea (4 times per year).
Figure 5. Monitoring and management of LM canola. (A) General LM canola monitoring process. (B) The post-management process for the fulfillment of LMO safety policy and research in South Korea (4 times per year).
Applsci 14 08333 g005
Table 2. The number of LM canola re-collection sites and LM canola samples from 2009 to 2023.
Table 2. The number of LM canola re-collection sites and LM canola samples from 2009 to 2023.
200920102011201220132014201520162017201820192020202120222023Total
Re-collection sites a00010001041334724
LM canola b00010001028312376367243
a Number of LM canola re-collection sites. b Number of LM canola samples at LMO re-collection sites.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lim, H.S.; Choi, W.; Jung, Y.J.; Yoon, A.-M.; Noh, D.; Lee, J.H.; Kim, C.M.; Lee, J.R. Long-Term Monitoring and Management of Genetically Modified Canola in Natural Environments: A 15-Year Study. Appl. Sci. 2024, 14, 8333. https://doi.org/10.3390/app14188333

AMA Style

Lim HS, Choi W, Jung YJ, Yoon A-M, Noh D, Lee JH, Kim CM, Lee JR. Long-Term Monitoring and Management of Genetically Modified Canola in Natural Environments: A 15-Year Study. Applied Sciences. 2024; 14(18):8333. https://doi.org/10.3390/app14188333

Chicago/Turabian Style

Lim, Hye Song, Wonkyun Choi, Young Jun Jung, A-Mi Yoon, Donghyeon Noh, Jeong Hwan Lee, Chul Min Kim, and Jung Ro Lee. 2024. "Long-Term Monitoring and Management of Genetically Modified Canola in Natural Environments: A 15-Year Study" Applied Sciences 14, no. 18: 8333. https://doi.org/10.3390/app14188333

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop