Next Article in Journal
A Brief Survey on Deep Learning-Based Temporal Knowledge Graph Completion
Previous Article in Journal
An Experimental Validation-Based Study of Airport Pavement Icing Mechanisms in Saline Environments and the Development of a Simplified Prediction Model
Previous Article in Special Issue
The Effect of Reducing Fat and Salt on the Quality and Shelf Life of Pork Sausages Containing Brown Seaweeds (Sea Spaghetti and Irish Wakame)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 14
Issue 19
10.3390/app14198870
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Performance, Meat Quality and Gene Expression of Grazing Lambs Supplemented with Macadamia Oil and Vitamin E

by
Paulo C. G. Dias Junior
1,
Isabela J. dos Santos
1,
Sarita B. Gallo
2,
Tharcilla I. R. C. Alvarenga
3,*,
Flavio A. P. Alvarenga
3,
Adriana M. Garcia
4,
Idalmo G. Pereira
5,
Nadja G. Alves
1 and
Iraides F. Furusho-Garcia
1
1
Department of Animal Science, Federal University of Lavras, Lavras 37200-900, Minas Gerais, Brazil
2
Faculty of Animal Science and Food Engineering, University of São Paulo, Pirassununga 13635-900, São Paulo, Brazil
3
Armidale Livestock Industries Centre, NSW Department of Primary Industries, JSF Barker Building, UNE Campus, Armidale, NSW 2351, Australia
4
Department of Veterinary Medicine, Federal University of Lavras, Lavras 37200-900, Minas Gerais, Brazil
5
Department of Animal Science, Federal University of Minas Gerais, Belo Horizonte 30130-100, Minas Gerais, Brazil
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(19), 8870; https://doi.org/10.3390/app14198870
Submission received: 13 August 2024 / Revised: 17 September 2024 / Accepted: 26 September 2024 / Published: 2 October 2024
(This article belongs to the Special Issue Quality and Safety of Fresh and Processed Meat: The Impact of Factors from Farm to Fork)
Browse Figure
Versions Notes

Abstract

:
Macadamia oil has high concentrations of oleic and palmitoleic fatty acids, which can increase tissue sensitivity to insulin, improving glucose absorption efficiency, and reducing lipogenesis through gene modulation. The objective of this study was to evaluate the effects of macadamia oil associated with vitamin E supplementation on performance, blood parameters, meat quality and sensory characteristics, meat fatty acid profile, and expression of genes associated with lipid metabolism in grazing lambs. The experimental treatments were control diet (Control), Control + 0.1% of body weight of macadamia oil (MO), MO + 745 IU of vitamin E/dry matter (MOVE). Macadamia oil improved feed efficiency, reflecting a lower dry matter intake, as the average daily weight gain did not differ from Control. Meat quality parameters were not affected by macadamia oil or vitamin E supplementation. Supplementation with macadamia oil improved meat appearance, flavor, and overall liking. Supplementation with macadamia oil provided a higher proportion of C18:3 n3 and a lower proportion of CLA. The expression of SREBP-1c, PPAR-α, SCD1, and ELOVL6 genes were not modified with the supplementation of macadamia oil and vitamin E. In conclusion, supplementation with macadamia oil improves feed efficiency and meat quality; and the inclusion of 745 IU of vitamin E/kg of dry matter for grazing lambs reduces 36% of lipid oxidation of the meat.

1. Introduction

Lipids have multidirectional effects on the body, and this fact has contributed to the interest in evaluating alternative lipid sources as ingredients of ruminant diet. The quality of a lipid source is directly associated with its fatty acid profile. Palmitoleic and oleic acids, the main fatty acids present in macadamia oil [1], are highlighted in this study for their effects on energy metabolism. A previous study showed no difference in insulin and glucose levels when feedlot lambs received diets containing macadamia oil as a source of palmitoleic and oleic, in the proportion of 0.1% of live weight [2]. However, when sheep were supplemented with palmitoleic and oleic acids, increased insulin sensitivity was observed, which improved the efficiency of glucose uptake by tissues [3]. The same effect was observed on insulin sensitivity in humans and mice [4]. The discrepancies observed between the findings of Dias Junior et al. [2] and Duckett, Volpi-Lagreca, Alende, & Long [5] highlight the need for further research aimed at understanding the effects of palmitoleic and oleic acid supplementation in ruminant feed, since the changes in energy metabolism may favor the use of the energy present in the diet and lead to increased animal performance.
Palmitoleic and oleic acids supplementation has also been linked to reduced body fat deposition in cattle [6,7], sheep [3], mice, and humans [4], which has been associated with the effect of fatty acids in modulating the expression of genes involved in lipogenesis [3,4,5]. Supplementation with macadamia oil for lambs in a feedlot system has been shown to favor the expression of the gene responsible for the synthesis of the enzyme stearoyl-CoA desaturase (SCD1) [2]. The same authors related this result to a significant increase in linolenic acid (C18:3 n3) in the meat. In turn, palmitoleic and oleic acids supplementation for sheep has also been related to increased polyunsaturated fatty acids (PUFA) in meat, including eicosapentaenoic acid (EPA, C20: 5 n3) and docosapentaenoic acid (DPA, C22: 5 n3) [3], the main long-chain fatty acids in a human diet [8,9]. On the other hand, lipid oxidation is more prominent in products with greater content of PUFAS, with detrimental effects on shelf life, as well as nutritional and sensory quality [10]. Vitamin E has been widely used as a supplementation to overcome oxidation due long-chain fatty acids in meat [2,11].
From a sensory point of view of the meat, Dias Junior et al. [2] reported that supplementation with macadamia oil for lambs improved the flavor and tenderness, providing better sensory acceptability of feedlot lamb meat. This is extremely positive since meat from feedlot lambs is often characterized by its pronounced flavor [12].
In view of the promising results of macadamia oil supplementation for finishing lambs, receiving diets with a high inclusion concentrate on performance and qualitative and quantitative aspects of the meat. In this study, it is hypothesized that supplementation with macadamia nut oil for lambs on a pasture system can improve performance without compromising nutritional, sensory, and meat quality parameters. It is worth mentioning that this is the first study associating macadamia oil supplementation to a diet with high forage inclusion. The results obtained in this research will guide future studies in identifying whether the diet can alter the results already highlighted in the literature for supplementation with palmitoleic and oleic sources in livestock feeding systems.
Thus, this study aimed to evaluate the effect of macadamia oil as a source of palmitoleic and oleic acids associated with vitamin E, in the form of supplements for lambs grazing Tifton-85 (Cynodon spp.), on performance, carcass characteristics, blood parameters, meat quality, fatty acid profile of the meat, and expression of genes related to lipid metabolism in muscle tissue.

2. Materials and Methods

The experiment was implemented in the Sheep Sector of the Animal Science Department and Meat Science Laboratory at the Federal University of Lavras (UFLA, Brazil). The experiment was carried out from February to April 2017 and showed an average precipitation of 110.33 mm, a maximum temperature of 29 °C, and an average temperature of 22.4 °C, at Lavras city, Brazil (21°13′38′′ S, wet subtropical mesothermal Cwa from dry winter—INMET).

2.1. Animals, Experimental Treatments, and Management

Thirty male lambs (½ Santa Inês × ½ Dorper breed) at 68 ± 13 days (mean ± SD) of age and of average body weight (BW) of 22.56 ± 2.72 kg (mean ± SD) were used. After weaning, the lambs underwent 15 days of adaptation on a Tifton-85 pasture under their respective experimental supplements, and then started the experimental evaluation for a period of 60 days. The lambs were placed in a grazing experimental area and the treatments consisted of three different supplements. The control group (n = 10) received a base supplement/concentrate consisting of soybean meal (867 g/kg DM), ground corn (99 g/kg DM), mineral premix (28 g/kg DM), and dicalcium phosphate (6 g/kg DM). The MO group (n = 10) received the same concentrate as the control group, supplemented with 0.1% of the lambs’ live weight in macadamia oil. The MOVE group (n = 10) received the same concentrate as the MO group, with 745 IU of Vitamin E in the dry matter (DM) (Table 1). Data provided for Control treatment have been used in another context of analysis [13]. Base supplements were offered daily in the proportion of 1.6% of BW with the aim of promoting weight gain in the lambs. The proportion of fatty acid in relation to the total ether extract of macadamia oil was: C14:0 (1.95%), C16:0 (3.19%), C16:1 c9 (22.78%), C18:0 (11.98%), C18:1 c9 (40.16%), C18:2 n6 (7.62%), and C18:3 n3 (0.60%). The amount of macadamia oil in the supplement was adjusted every two weeks according to the BW of the lambs. The oil was weighed daily according to the established amount for each animal in individual bottles using an analytical balance (Sartorius BA11OS, Göttingen, Germany). Subsequently, the oil was manually mixed with the amount of concentrate offered on a particular day to each animal. Vitamin E was homogenized within the concentrate in a 300 kg vertical mixer (Incomagri 300P, Itapira, São Paulo, Brazil).
Tifton-85 (Cynodon spp.) pasture comprising a total area of 9000 m2 was equally subdivided into five paddocks with fresh water and a rest area with shade (a polyethylene fabric of 20 m2 was used to provide 80% shade). A fixed stocking rate with a grazing cycle of 35 days (7 days of grazing and 28 days of rest) was applied. The lambs were managed daily from 7 a.m. to 6 p.m. in the pasture. From 6 p.m. to 7 a.m., the lambs were taken to a covered shed which contained thirty individual pens measuring 1.3 m2 each and provided with a feeder, water trough, and woodchip bedding; this was where the lambs individually received the experimental supplements. Every morning the remnants of the supplements were collected, weighed, and individually sampled for 60 days to determine supplement intake. Pasture samples of Tifton-85 (Cynodon spp.) were taken manually, simulating the grazing technique described by Johnson [15]. The sampling (400 g forage) was performed in the morning on days 1, 3, and 7 in each paddock [16]. The Tifton-85 (Cynodon spp.) pasture composition in the present study contained: 31.0% of DM; 12.6% of CP; 1.4% of EE; 74.7% of NDF; and 7.2% of ash (Table 2).
The BW of the lambs was recorded fortnightly to determine the average daily gain (ADG) and the subsequent adjustment to the amount of supplement and macadamia oil to be offered in the diet. At the beginning of the experiment, all animals were dewormed with 5% Levamisole Hydrochloride (Ripercol®L Solution, Zoetis Veterinary Products Industry Ltd., Campinas, São Paulo, Brazil) at a dosage of 1 mL/10 kg of BW. The lambs were then individually monitored every 15 days by counting the number of eggs per gram of feces [17]. Lambs that had a count above 500 were dewormed.
Detailed methodology for estimation of forage intake is briefly described in the work of Dias Junior et al. [2]. An external marker (titanium dioxide—TiO2) was used from day 18 to day 30 to determine forage intake [18,19]. Forage intake evaluation was undertaken after seven days of adaptation, with five days of feces and feeding samples. During the evaluation of forage intake, 2 g capsules of TiO2 were fed daily to the lambs via the esophagus at 7:00 a.m. and 6:00 p.m. Fecal TiO2 concentration was assessed as per the work of Myers et al. [20].
Dry matter (DM), ether extract (EE) [21], ash [22], neutral detergent fiber (NDF) [23], and metabolizable energy [14] were determined according to the standard methods described. Indigestible neutral detergent fiber (NDFi) intake was assessed using the method described by [24], with additional reference to methodologies by [25,26,27] for validation and quality control.

2.2. Blood Biochemical Parameters

On the 58th day of the experiment, blood samples were collected from the jugular vein in the morning, before the lambs were released to graze. The blood samples were drawn into 10 mL vacutainer tubes containing sodium fluoride + EDTA and promptly placed on ice to inhibit further metabolic activity of red blood cells, specifically the conversion of glucose to lactate. Roughly 30 min after the blood collection, the samples underwent centrifugation at 1500× g and room temperature for 10 min. The resulting plasma was then transferred into 1.5 mL Eppendorf tubes and frozen at −20 °C for subsequent analysis. Biochemical analysis of the blood was conducted in duplicate using colorimetry in a spectrophotometer reader designed for 96-well plates (Multiskan GO, Thermo Scientific, USA). Commercial kits were utilized for quantifying cholesterol (K083-3, Bioclin Cholesterol Monoreagent, Belo Horizonte, Brazil), triglycerides (K117-3, Bioclin Triglycerides Monoreagent, Belo Horizonte, Brazil), glucose (K082-3, Bioclin Glucose Monoreagent, Belo Horizonte, Brazil), and insulin (EIA-4739, DRG® ELISA D-35039, © DRG Instruments, Germany).

2.3. Slaughter and Carcass Sampling

Lambs were weighed, transported to a commercial abattoir (132 km from experimental unit) and slaughtered in a single day after a 16-h fast with free access to fresh water. Prior to slaughter, lambs were weighed to determine slaughter weight (SW). Stunning via cerebral concussion using a captive dart gun, followed by bleeding by severing the jugular veins was applied, followed by skinning, evisceration, and removal of the head and limbs according to the guidelines of the Federal Inspection Service for Humanitarian Slaughter in accordance with Normative Instruction No. 3 of the Ministry of Agriculture, Livestock, and Supply.
Hot carcass weight (HCW) was recorded and a sample of 5 g of Longissimus lumborum muscle (LL) was collected from the right side of the carcass (between the 12th and 13th ribs), placed in cryotubes, frozen in liquid nitrogen for transport, and later stored in an ultra-freezer at −80 °C for gene expression analysis.
The initial carcass pH was measured (LL muscle of the right side of the carcass between the 12th and 13th ribs) 10 min after bleeding using a TESTO-205 pH meter (Testo, Campinas, Brazil). The pH meter was calibrated to pH 7.0 and 4.0 using standard buffers (Testo buffers, Campinas, Brazil) stored at room temperature.
Cold carcass weight (CCW) was recorded after 24 h stored at 4 °C and final pH (post-rigor) was measured again. Subcutaneous fat thickness was determined in the longissimus muscle (left side between the 12th and 13th ribs) in mm using a digital caliper (Battery, model SR44). After deboning, both longissimus muscles (left and right) were collected, wrapped in aluminum foil, vacuum packed, and immediately stored at −20 °C in a freezer.

2.4. Meat Quality

The Longissimus lumborum muscle was divided into six steaks (2.5 cm thick), labeled, vacuum packed, and stored at −20 °C until further analysis was undertaken. Steaks were divided in the anterior–posterior direction for each analysis, with three steaks allocated for thaw loss, meat color, water holding capacity, cooking loss, and shear force; one steak allocated for lipid oxidation analysis; one steak allocated for crude protein, ether extract and ash; and one steak allocated for fatty acid analysis. To determine thawing loss, three steaks were weighed, thawed at 2 °C for 12 h, and weighed again. Meat color was measured after blooming for 30 min after removal of vacuum packaging using Minolta CR700 Chroma Meter equipment (Konica Minolta, Osaka, Japan), illuminant A, and a standard 10° observer. L* (lightness), a* (redness), and b* (yellowness) were measured, with three measurements per steak and the average of nine readings used to determine meat color parameters.
Water holding capacity (WHC) was determined, as described by Hamm [28], with slight modifications [2], and expressed as the area of pressed meat divided by exudate area around the meat [29]. Cooking loss was determined from the average values of three steaks (same used for meat color and WHC analysis). Cooking set up [30] and shear force analysis were performed as previously described [2]. Meat composition was obtained from a 100 g sample of longissimus muscle, which was previously trimmed to remove connective tissue and external fat. Subsequently, the samples were processed in a multiprocessor (Philips RI7630, Itapevi, Brazil) until a homogeneous mass was obtained. The meat composition was determined by near-infrared spectroscopy (method: 2007-04; AOAC [31]) using a FoodScanTM device (FOSS, Hillerod, Denmark) to measure the amount of total collagen, protein, fat, moisture, and ash.

2.5. Sensory Analysis

The Longissimus muscle (right side) was thawed, trimmed, and 1% of its weight was salted. The entire muscle was cooked and prepared for sensory analysis as previously described using the methodology by Abreu et al. [32]. Briefly, 55 untrained testers (25 men and 30 women, aged between 18 and 60 years) were instructed in the procedure for the acceptance test and the completion of the questionnaire. Sensory evaluation was conducted on a single day, and samples were randomly presented to the testers in a monodic order (one sample at a time), with water passed between samples to remove residual taste from the samples [33]. Sensory attributes of appearance, flavor, tenderness, and overall liking were rated using a nine-point hedonic scale: 1—extremely disliked; 2—really disliked; 3—moderately disliked; 4—slightly disliked; 5—neither liked nor disliked; 6—slightly liked; 7—moderately liked; 8—really liked; and 9—extremely liked [33].

2.6. Lipid Oxidation, Fatty Acids, and Enzyme Activity

Meat samples were used to evaluate lipid oxidation through thiobarbituric acid reactive substances (TBARS) analysis [34]. Total lipids were extracted [35] and methylation performed [36] to determine a fatty acids profile. The transmethylated samples were analyzed [37] in a gas chromatograph (Focus CG-Finnigan) with a flame ionization detector and capillary column CP-Sill 88 (100 m × 0.25 mm × 0.20 µm; Supelco Inc., Bellefonte, PA, USA). The percentage of fatty acid in total lipids (fatty acids methyl ether—FAME) was obtained by the equation: FAME = (individual area of FA) × 100/total area of FA. Enzymatic activities were assessed to determine Δ9-desaturase and elongase enzymes [38,39], overall desaturase [40] and elongase indices, and atherogenicity and thrombogenicity indices [41], as previously described [2].

2.7. Gene Expression Analysis

RNA extraction and gene expression of transcription factor of steroid-binding proteins-1c (SREBP-1c), α peroxisome proliferator-activated receptor (PPAR-α), stearoyl-CoA desaturase (SCD1), and elongase 6 (ELOVL6) were studied and performed as described previously [2]. Table 3 describes information of primers for real-time PCR (RT-qPCR), commercially synthesized (Invitrogen, Carlsbad, CA, USA). Data is presented as relative expressions [42] with threshold cycle values corrected for the amplification efficiency of each primer pair.

2.8. Statistical Analysis

All statistical analysis, except meat sensory data, was performed using the GLM procedure of SAS (SAS Version 9.1, SAS Institute, Cary, NC, USA). Experimental diet was used as a fixed effect. Initial weight was covariate for blood parameters, performance, meat quality, and fatty acid profile. Meat sensory analysis was undertaken in a randomized block design (each panel member as one block and block effect considered as random). To verify the effect of the experimental diets (fixed effect) on acceptability, the MIXED procedure of SAS was used, considering the observation of each panel member as a repeated measure. T-test was applied at a significance level of p < 0.05.

3. Results

3.1. Performance

Lambs supplemented with macadamia oil, with or without the inclusion of vitamin E in the diet, had higher feed efficiency (p = 0.0007) and lower dry matter intake (DMI) (p = 0.0239) compared to the Control treatment (Table 4). The ADG and slaughter weight was similar among all treatments (p > 0.05). Lambs on the Control treatment had an increase in forage intake of 17% compared to MO and MOVE treatments (p = 0.0077), whereas no difference between treatments was observed for supplement intake (p = 0.1242). Higher ether extract intake was observed when lambs were supplemented with macadamia oil (p < 0.0001), however, higher ether extract intake did not alter metabolizable energy intake (p = 0.3404). The inclusion of macadamia oil in the diet increased the intake of c9 C16:1, C18:0, c9 C18:1, and C18:2 n6, and decreased the intake of C18:3 n3 fatty acids compared to lambs grazing under the Control treatment (p < 0.0001; Table 4).

3.2. Blood Parameters

The inclusion of macadamia oil and vitamin E in the supplementing of grazing lambs did not affect the serum levels of cholesterol, triglycerides, glucose, and insulin (p > 0.05, Table 5).

3.3. Carcass Characteristics

For carcass characteristics, the inclusion of macadamia oil and vitamin E in the supplement of grazing lambs did not affect hot carcass weight, cold carcass weight, and hot and cold carcass yield (p > 0.05). Lambs supplemented with macadamia oil, with or without vitamin E, had on average 0.20 mm thicker subcutaneous fat compared to lambs under the Control treatment (p = 0.0403; Table 6).

3.4. Meat Quality, Chemical Composition, and Sensory Analysis

No difference was observed between treatments (p > 0.05) for pre-rigor and post-rigor pH measures of the meat (Table 7). The parameters associated with meat color, lightness (L*), redness (a*), and yellowness (b*) did not differ among all treatments (p > 0.05). Thawing loss, cooking loss, water holding capacity, and shear force did not differ among all treatments (p > 0.05). TBARS (mg malonaldehyde/kg of meat) values were lower when grazing lambs received a supplement containing macadamia oil and vitamin E (MOVE) (p = 0.0040, Table 7). The parameters associated with meat composition (g/100 g of muscle), total collagen, protein, fat, moisture, and ash did not differ among all treatments (p > 0.05, Table 7).
Lambs supplemented only with macadamia oil (MO) had a higher score for overall liking compared to Control and MOVE treatments (p = 0.0004, Table 7). There was a higher score (p < 0.05) for the appearance and flavor of the meat when the lambs received only macadamia oil (MO), however no difference was observed for meat tenderness (p = 0.1535, Table 7).

3.5. Fatty Acid Profile and Enzymatic Activity

The results of the fatty acids profile of the meat (% FAME) are presented in Table 8. There was no difference among all treatments for the proportion of the main hypercholesterolemic fatty acids C12:0, C14:0, and C16:0 (p > 0.05), which contributed to the lack of effect on the atherogenicity and thrombogenicity indices (p > 0.05). The proportion of the branched-chain fatty acids iso-C13:0, anteiso-C13:0, iso-C14:0, iso-C15:0, anteiso-C15:0, iso-C16:0, and iso-C17:0 did not differ among all treatments (p > 0.05). Supplementation with macadamia oil (MO and MOVE) increased the proportion of C18:0 and C18:3 n3 in the meat (p < 0.05). On the other hand, there was a decrease in the proportion of C18:2 n6 and CLA (p < 0.05) when macadamia oil (MO and MOVE) was added in the diet. The ratio of C20:5 n3 (EPA), C22:5 n3 (DPA), and C22:6 n3 (DHA) did not differ among all treatments (p > 0.05). The sum of saturated, monounsaturated, and polyunsaturated fatty acids, as well as the n6:n3 ratio, did not differ among all treatments (p > 0.05). The indices associated with the enzymatic activity of enzymes desaturase and elongase (∆9-14, ∆9-16, ∆9-18, ∆9-overall, and elongase; Table 8) were not modified with the use of macadamia oil (MO) and the inclusion of vitamin E (MOVE) in the supplement of grazing lambs.

3.6. Gene Expression

The results associated with gene expression are presented in Figure 1. The inclusion of macadamia oil and vitamin E in the supplement of grazing lambs did not affect the expression of the genes SREBP-1c (p = 0.6372), PPAR-α (p = 0.8214), SCD1 (p = 0.7276), or ELOVL6 (p = 0.5107).

4. Discussion

Blood parameters were not influenced by the inclusion of macadamia oil or vitamin E in the supplement of the lambs and are in accordance with values reported by Kaneko et al. [43] for cholesterol, triglycerides, glucose, and insulin in lambs. Cholesterol content in blood plasma is often used to evaluate changes in lipid metabolism when fats are added to ruminant diet, up to 6% of DM [44]. In addition, palmitoleic and oleic fatty acids are associated with improving tissue sensitivity to insulin [3,4], which could reflect to lower plasma glucose and insulin levels for lambs on MO and MOVE treatments. However, Duckett et al. [5] observed moderate and negative correlations between plasma insulin and c9 C16 levels in lamb supplemented with fish oil and enriched with n7 fatty acid (ProvinalTM; Tersus Pharmaceuticals).
A reduction in DMI observed when lambs received MO and MOVE treatments is evidenced by a greater DMI of forage for lambs under Control (17% difference), given the intake of the supplement was the same among all treatments. A lower DMI observed for the MO and MOVE treatments can be justified by a higher ether extract intake, provided by the inclusion of macadamia oil in the diet (Table 1). Lipids have 2.25 times more energy than other nutrients [45], which contributes to a greater energy density in the diet and higher energy intake per unit of dry matter; this is in agreement with a similar intake of metabolizable energy among all treatments in the present study. Deng et al. [46] emphasized that energy intake in finishing lambs is a determinant of the average daily gain, this observation justifies the similarity of ADG and SW of lambs in the current study, as energy intake was similar among all treatments. Thus, the increase of 23% in feed efficiency in lambs under MO and MOVE treatments is associated with a lower DMI.
The absence of effect on the assessed parameters of carcass characteristics may be associated with a similar SW of the lambs among all treatments given that weight at slaughter highly influences carcass characteristics [47]. However, a greater subcutaneous fat thickness was observed in lambs raised under MO and MOVE treatments. Given that palmitoleic and oleic fatty acids have an antilipogenic effect [3,4], and energy intake did not vary among all treatments, a thicker subcutaneous fat is explained by a higher intake of ether extract when lambs were under MO and MOVE treatments. Emery [48] reported that the use of palmitic in the diet of lambs reflects the direct use of long-chain fatty acids in the metabolic pathways of fat synthesis. Thus, the increase in the supply of long-chain fatty acids enhanced by the inclusion of macadamia oil in the diet explains the increase in subcutaneous fat thickness of the lambs raised under MO and MOVE treatments.
As expected, the pH values obtained in the present study in both pre-rigor and post-rigor assessment were not affected by the inclusion of macadamia oil or vitamin E in the supplement, and the results are consistent with other studies that evaluated pH in lamb meat [2,49]. Meat color (L*, a*, and b*) was not influenced by the dietary treatments and corroborates with the results reported in the literature for lambs finished on pasture [50,51,52,53]. The parameters associated with water activity in meat (thawing loss, cooking loss, and water holding capacity) were not affected by the inclusion of macadamia oil or vitamin E in the supplement, which is in accordance with the results obtained for the pH of the meat. Final pH values of the meat are associated with the isoelectric point of proteins, which is decisive on the bond between proteins and water in meat. Thus, when the charges between protein and water cancel out, there is a reduction in the amount of water retained, thereby favoring a greater amount of free water [54].
The lack of effect of the treatments for shear force values on the meat may be associated with the age of the animals (145 days at slaughter). Shear force values increase with age but do not differ for 4- to 8-month-old lambs [55]. A similar pattern is also reported by Bouton et al. [56] for 8- to 10-month-old lambs. Also, age at slaughter is a determinant of collagen solubility, which decreases with age and can interfere with meat tenderness and shear resistance [57].
For sensory parameters, the meat of lambs supplemented with MO received higher scores (7.33) for overall liking. This is justified by the highest scores given by the tasters for appearance and flavor. Dias Junior et al. [2] reported that supplementation with macadamia oil improved the flavor without changing the appearance of the meat from feedlot lambs. Appearance and flavor are critical in determining acceptance or refusal of a product at the time of consumption [58]. Arshad et al. [59] reported that meat flavor can be modified by the fatty acid profile of intramuscular fat. However, the results obtained in this study do not support the inference of alteration in meat flavor. It is important to mention that there was moderate acceptance for all attributes when lambs were under MO treatment. According to the study by Costa et al. [60], the moderate acceptance of lamb meat in sensory analysis studies can be interpreted as an indication that the tasters would consume meat and recommend it.
The inclusion of 745 IU/kg of DM of vitamin E in the supplement of the lambs reduced the meat lipid oxidation index, evaluated using the TBARS method. This result corroborates with the work of Ripoll et al. [61], which found lower values of malonaldehyde/kg in lamb meat when supplemented with vitamin E. Vitamin E supplementation increases α-tocopherol deposition in cell membranes, providing greater protection to PUFAs against oxidative degradation [11,62]. The best oxidative stability directly reflects on the quality of exposed meat in retail, which is assessed by color stability and the preservation of PUFAs, and which reflects the better nutritional value of the meat [63].
A higher proportion of C18:0 in the meat was observed when macadamia oil was used. This result may be associated with greater stimulation of the biohydrogenation process, as the inclusion of lipids and the proportion of unsaturated fatty acids in the supplement was higher in MO and MOVE treatments (Table 1). Another point to be considered is that the fatty acids present in macadamia oil were offered in the non-esterified form, which possibly contributed to a higher availability of fatty acids to be biohydrogenated without the need of hydrolyzing [64,65]. The biohydrogenation process may also have been potentialized due to the bacterial profile in the rumen, which, due to the inclusion of forage, favors the prevalence of Gram-positive bacteria. Stewart [66] points out that Butyribrio fibrisolvens bacteria are found in a large proportion of forage-based diets and are crucial to fiber digestion and the biohydrogenation process [67].
A higher proportion of C18:0 also supports the results found for the proportion of C18:3 n3 in the longissimus muscle of lambs under MO and MOVE treatments. In the current study, the main source of C18:3 n3 was from the pasture, which contains linolenic acid in the form of galactolipids, which are hydrolyzed and then biohydrogenated in the rumen. Thus, the form in which fatty acids were available in the feeding sources (pasture and macadamia oil) may justify a higher rate of biohydrogenation in the fatty acids present in the oil, especially c9 C18:1 and c9 C16:1, thereby contributing to a greater escape of C18:3 n3 from the pasture into the small intestine. The level of food processing and the amount of fatty acids present in the diet are strongly associated with the fatty acid profile that arrives in the intestine and is consequently deposited in the tissue [68,69].
A higher biohydrogenation process in lambs supplemented on MO and MOVE treatments also explains the results observed for conjugated linoleic acid (CLA) deposition, which was 14.63% higher in the meat of lambs from the Control treatment. The intensity at which fatty acids in the diet are biohydrogenated in the rumen is drastically reflected in the proportion of CLA in meat and milk [45]. In addition, according to Palmquist et al. [70], the endogenous conversion rate of stearic acid (t11 C18:1) in c9t11 C18:2 is approximately 87% as a result of the action of the enzyme Δ9-desaturase. In the present study, neither the desaturation index nor the expression of the SCD1 gene differed among all treatments, which indicates that the amount of CLA found in the meat of lambs under MO and MOVE treatments was highly influenced by the biohydrogenation process.
The inclusion of macadamia oil and vitamin E in the supplement of grazing lambs conferred a higher proportion of c9 C16:1 in the meat; however, these results are not supported by the outcomes of the expression of the SCD1 gene and the activity index of the enzyme Δ9-desaturase. SCD1 gene expression did not respond to the increase in c9 C16:1 in the meat from lambs under MOVE treatment, which is explained by the fact that a higher expression of a gene does not necessarily correlate to higher protein concentration or enzyme activity, as numerous processes can occur between transcription and translation events [71]. As in the current study, an increased expression of SCD gene expression is associated with a lower concentration of oleic acid in the diet [72]. Besides, Ladeira et al. [73] observed in cattle that weight gain was negatively correlated with SCD1 gene expression. Thus, a similar ADG of the lambs, independent of the treatment provided, is in agreement with the results found for the expression of SCD1.
The recommended atherogenicity index for lamb is below 1.00 to reduce the influence of diet on the incidence of coronary heart disease [41]. The mean value of the atherogenicity index among all treatments in our experiment was 0.56. According to Scollan et al. [74], values below 1.00 for this index reflect to a greater amount of antiatherogenic fatty acids in lamb meat. For the thrombogenicity index, the recommended value for lamb is 1.33 [41]. In the present work, lambs from MO and MOVE treatments had an average thrombogenicity of 1.41, while lambs from the Control treatment had a 3.1% reduction from the maximum allowed (1.33). An increase in thrombogenicity index in lambs from MO and MOVE treatments may be justified by an increase in the proportion of fatty acid C18:0 in the meat, which was 12.27% higher when compared to lambs from the Control treatment.
In the current study, the mean n6:n3 ratio was 5.13 and was not influenced by the inclusion of macadamia oil or vitamin E in the diet of the lambs. Boughalmi & Araba [50] described that acceptable values for the benefit of human health of the n6:n3 ratio are around 4:1, which is below the observed average. However, for Russo [75], a ratio of up to 10:1 is not harmful to human health. In the current study, a higher ratio of n6:n3 may have been associated with animal genetics. Madruga et al. [76] reported that Dorper lambs tend to deposit higher concentrations of saturated fatty acids at a younger age and, consequently, reduce the amount of PUFAs that make up the phospholipids of the membrane. Some studies that evaluated the fatty acid profile in the Longissimus muscle of Dorper × Santa Inês crossbred lambs reported a high n6:n3 ratio of 12.64 [77], 9.43 [78] and 7.23 [79], respectively.
The results obtained for gene expression in the muscle are in agreement with the increase in the supply of long-chain fatty acids via the inclusion of macadamia oil in the diet of the lambs (Figure 1), where an absence of dietary effect on the expression of transcription factor SREBP-1c can be observed. The SREBP-1c transcription factor is a determinant in the transcription process of enzymes involved in lipogenesis [80,81], which is consistent with the results observed for the expression of SCD1 and ELOVL6 enzymes. The SCD1 and ELOVL6 enzymes have their activity increased when the de novo synthesis process is active in the tissues [81]. The activation of these genes occurs in response to a higher concentration of insulin [4], a parameter that, in the current study, was not altered by the inclusion of macadamia oil in the diet. Another result in the current study that corroborates with the hypothesis that fatty acids from the lipid source were used directly in fat deposition is the increase of 14% in the amount of intramuscular fat in lambs under MO and MOVE treatments compared to Control.

5. Conclusions

Supplementation with macadamia oil as a source of palmitoleic and oleic fatty acids improves feed efficiency and meat sensory characteristics (appearance, flavor and overall liking) of grazing lambs. The form of the fatty acids that were available in the feeding sources (pasture and macadamia oil) justifies a higher rate of biohydrogenation on the fatty acids present in the oil, especially c9 C18:1 and c9 C16:1, contributing to a greater escape of C18:3 n3 from the pasture into the small intestine. Thus, MO treatment may have played a protective role on C18:3 n3 FA. The inclusion of 745 IU of vitamin E/kg of DM with macadamia oil contributes to a reduction of 36% of meat lipid oxidation of finishing lambs under a grazing system.

Author Contributions

Conceptualization, P.C.G.D.J. and I.F.F.-G.; Methodology, P.C.G.D.J., A.M.G., N.G.A. and I.F.F.-G.; Validation, P.C.G.D.J. and I.F.F.-G.; Formal Analysis, P.C.G.D.J., I.G.P. and I.F.F.-G.; Investigation, P.C.G.D.J., I.J.d.S. and I.F.F.-G.; Resources, A.M.G., N.G.A. and I.F.F.-G.; Data Curation, P.C.G.D.J.; Writing—Original Draft Preparation, P.C.G.D.J.; Writing—Review & Editing, P.C.G.D.J., I.J.d.S., S.B.G., T.I.R.C.A., F.A.P.A., A.M.G., N.G.A., I.G.P. and I.F.F.-G.; Visualization, S.B.G.; Supervision, I.F.F.-G.; Project Administration, I.F.F.-G.; Funding Acquisition, I.F.F.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CNPq—National Council for Scientific and Technological Development (Brazil), grant number 459789/2014-7.

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee from Federal University of Lavras (protocol code 063/16). The sensory study protocol was approved by the Ethics Committee in Research with Human Beings of UFLA (protocol code 2.984.593. CAAE No. 99920918.7.0000.5148).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the last author on request.

Acknowledgments

The authors would like to thank the research team from GAO (Grupo de Apoio à Ovinocaprinocultura, UFLA/Brazil) for their support in the data collection of performance, carcass, and meat quality parameters of this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Navarro, S.L.B.; Rodrigues, C.E.C. Macadamia oil extraction methods and uses for the defatted meal byproduct. Trends Food Sci. Technol. 2016, 54, 148–154. [Google Scholar] [CrossRef]
  2. Dias Junior, P.C.G.; dos Santos, I.J.; do Nascimento, F.L.; Paternina, E.A.S.; Alves, B.A.; Pereira, I.G.; Ramos, A.L.S.; Alvarenga, T.I.R.C.; Furusho-Garcia, I.F. Macadamia oil and vitamin E for lambs: Performance, blood parameters, meat quality, fatty acid profile and gene expression. Anim. Feed Sci. Technol. 2022, 293, 115475. [Google Scholar] [CrossRef]
  3. Duckett, S.K.; Volpi-Lagreca, G.; Alende, M.; Long, N.M. Palmitoleic acid reduces intramuscular lipid and restores insulin sensitivity in obese sheep. Diabet. Metab. Synd. Obes. 2014, 7, 553–563. [Google Scholar] [CrossRef]
  4. Souza, C.O.; Vannice, G.K.; Rosa Neto, J.C.; Calder, P.C. Is palmitoleic acid a plausible nonpharmacological strategy to prevent or control chronic metabolic and inflammatory disorders? Mol. Nutr. Food Res. 2018, 62, 1700504. [Google Scholar] [CrossRef]
  5. Duckett, S.K.; Furusho-Garcia, I.F.; Rico, J.E.; McFadden, J.W. Flaxseed oil or n-7 fatty acid-enhanced fish oil supplementation alters fatty acid composition, plasma insulin and serum ceramide concentrations, and gene expression in lambs. Lipids 2019, 54, 389–399. [Google Scholar] [CrossRef]
  6. Burns, T.A.; Duckett, S.K.; Pratt, S.L.; Jenkins, T.C. Supplemental palmitoleic (C16:1 cis-9) acid reduces lipogenesis and desaturation in bovine adipocyte cultures. J. Anim. Sci. 2012, 90, 3433–3441. [Google Scholar] [CrossRef]
  7. Burns, T.A.; Kadegowda, A.K.G.; Duckett, S.K.; Pratt, S.L.; Jenkins, T.C. Palmitoleic (16:1 cis-9) and cis-vaccenic (18:1 cis-11) acid alter lipogenesis in bovine adipocyte cultures. Lipids 2012, 47, 1143–1153. [Google Scholar] [CrossRef]
  8. Alvarenga, T.I.R.C.; Chen, Y.; Furusho-Garcia, I.F.; Perez, J.R.O.; Hopkins, D.L. Manipulation of omega-3 PUFAs in lamb: Phenotypic and genotypic views. Compr. Rev. Food Sci. Food Saf. 2015, 14, 189–204. [Google Scholar] [CrossRef]
  9. Chikwanha, O.C.; Vahmani, P.; Muchenje, V.; Dugan, M.E.R.; Mapiye, C. Nutritional enhancement of sheep meat fatty acid profile for human health and wellbeing. Food Res. Int. 2018, 104, 25–38. [Google Scholar] [CrossRef]
  10. Ponnampalam, E.N.; Norng, S.; Burnett, V.F.; Dunshea, F.R.; Jacobs, J.L.; Hopkins, D.L. The Synergism of Biochemical Components Controlling Lipid Oxidation in Lamb Muscle. Lipids 2014, 49, 757–766. [Google Scholar] [CrossRef]
  11. Bellés, M.; del Mar Campo, M.; Roncalés, P.; Beltrán, J.A. Supranutritional doses of vitamin E to improve lamb meat quality. Meat Sci. 2019, 149, 14–23. [Google Scholar] [CrossRef]
  12. Sañudo, C.; Enser, M.E.; Campo, M.M.; Nute, G.R.; María, G.; Sierra, I.; Wood, J.D. Fatty acid composition and sensory characteristics of lamb carcasses from Britain and Spain. Meat Sci. 2000, 54, 339–346. [Google Scholar] [CrossRef]
  13. Santos, I.J.; Dias Junior, P.C.G.; Alvarenga, T.I.R.C.; Pereira, I.G.; Gallo, S.B.; Alvarenga, F.A.P.; Furusho-Garcia, I.F. Impact of feeding systems on performance, blood parameters, carcass traits, meat quality and gene expressions of lambs. Agriculture 2024, 14, 957. [Google Scholar] [CrossRef]
  14. Cannas, A.; Tedeschi, L.O.; Fox, D.G.; Pell, A.N.; Van Soest, P.J. A mechanistic model for predicting the nutrient requirements and feed biological values for sheep. J. Anim. Sci. 2004, 82, 149–169. [Google Scholar] [CrossRef]
  15. Johnson, A.D. Sample Preparation and Chemical Analysis. Commonw. Bur. Pastures Field Crops Bull. 1978, 52, 96–102. [Google Scholar]
  16. Cândido, M.J.D.; Alexandrino, E.; Gomide, C.A.M.; Gomide, J.A.; Pereira, W.E. Rest period, forage nutritive value and steer performance on Panicum maximum cv. Mombaça pasture under intermittent stocking. Rev. Bras. Zootec. 2005, 34, 1459–1467. [Google Scholar] [CrossRef]
  17. Gordon, H.M.; Whitlock, H.V. A new technique for counting trematode eggs in sheep faeces. J. Sci. Ind. Res. 1939, 12, 50–52. [Google Scholar] [CrossRef]
  18. Williams, C.H.; David, D.J.; Iismaa, O. The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry. J. Agric. Sci. 1962, 59, 381–385. [Google Scholar] [CrossRef]
  19. Silva, D.J.; Queiroz, A.C. Análise de Alimentos: Métodos Químicos e Biológicos; Universidade Federal de Viçosa: Viçosa, Brazil, 2002. [Google Scholar]
  20. Myers, W.D.; Ludden, P.A.; Nayigihugu, V.; Hess, B.W. Technical Note: A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 2004, 82, 179–183. [Google Scholar] [CrossRef]
  21. AOAC International. Official Methods of Analysis, 15th ed.; AOAC International: Arlington, VA, USA, 1990. [Google Scholar]
  22. AOAC International. Official Methods of Analysis, 19th ed.; AOAC International: Gaithersburg, MD, USA, 2012. [Google Scholar]
  23. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
  24. Valente, T.N.P.; Detmann, E.; Queiroz, A.C.; Valadares Filho, S.C.; Gomes, D.I.; Figueiras, J.F. Evaluation of Ruminal Degradation Profiles of Forages Using Bags Made From. Rev. Bras. Zootec. 2011, 57, 2565–2573. [Google Scholar] [CrossRef]
  25. Casali, A.O.; Detmann, E.; Valadares Filho, S.C.; Pereira, J.C.; Henriques, L.T.; de Freitas, S.G.; Paulino, M.F. Influência do tempo de incubação e do tamanho de partículas sobre os teores de compostos indigestíveis em alimentos e fezes bovinas obtidos por procedimentos in situ. Rev. Bras. Zootec. 2008, 37, 335–342. [Google Scholar] [CrossRef]
  26. Alvarenga, F.A.P.; Furusho-Garcia, I.F.; Alvarenga, T.I.R.C.; Dias Junior, P.C.G.; Alves, F.A.N.; dos Santos, E.P.; Casagrande, D.R.; Teofilo, T.S.; Sales, L.A.; Almeida, A.K.; et al. Performance, fecal egg count and feeding behavior of lambs grazing elephant grass (Pennisetum purpureum Schum.) with increased levels of protein supplementation. Small Rumin. Res. 2022, 216, 106826. [Google Scholar] [CrossRef]
  27. Van Soest, P.J.; Robertson, J.B. Analysis of Forages and Fibrous Foods; Cornell University: New York, NY, USA, 1985. [Google Scholar]
  28. Hamm, R.; Deatherage, F.E. Changes in hydration, solubility and charges of muscle proteins during heating of meat. J. Food Sci. 1960, 25, 587–610. [Google Scholar] [CrossRef]
  29. Sales, L.A.; Rodrigues, L.M.; Silva, D.R.G.; Fontes, P.R.; Torres Filho, R.A.; Ramos, A.L.S.; Ramos, E.M. Effect of freezing/irradiation/thawing processes and subsequent aging on tenderness, color, and oxidative properties of beef. Meat Sci. 2020, 163, 108078. [Google Scholar] [CrossRef] [PubMed]
  30. Fabre, R.; Dalzotto, G.; Perlo, F.; Bonato, P.; Teira, G.; Tisocco, O. Cooking method effect on warner-bratzler shear force of different beef muscles. Meat Sci. 2018, 138, 10–14. [Google Scholar] [CrossRef]
  31. AOAC International. Official Methods of Analysis, 18th ed.; AOAC International: Gaithersburg, MD, USA, 2007. [Google Scholar]
  32. Abreu, K.S.F.; Vérasa, A.S.C.; Ferreira, M.A.; Madruga, M.S.; Maciel, M.I.S.; Félix, S.C.R.; Vasco, A.C.C.M.; Urbano, S.A. Quality of meat from sheep fed diets containing spineless cactus (Nopalea cochenillifera Salm Dyck). Meat Sci. 2018, 148, 229–235. [Google Scholar] [CrossRef] [PubMed]
  33. Massingue, A.A.; De Almeida Torres Filho, R.; Fontes, P.R.; De Lemos Souza Ramos, A.; Fontes, E.A.F.; Perez, J.R.O.; Ramos, E.M. Effect of mechanically deboned poultry meat content on technological properties and sensory characteristics of lamb and mutton sausages. Asian-Australas. J. Anim. Sci. 2018, 31, 576–584. [Google Scholar] [CrossRef] [PubMed]
  34. Tarladgis, B.G.; Watts, B.M.; Younathan, M.T.; Dugan, L. A distillation method for the quantitative determination of malonaldehyde in rancid foods. J. Am. Oil Chem. Soc. 1960, 37, 44–48. [Google Scholar] [CrossRef]
  35. Folch, J.; Lees, M.; Stanley, G.H.S. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
  36. Hara, A.; Radin, N.S. Lipid extraction of tissues with a low toxicity solvent. Anal. Biochem. 1978, 90, 420–426. [Google Scholar] [CrossRef]
  37. Delmonte, P.; Fardin Kia, A.R.; Kramer, J.K.G.; Mossoba, M.M.; Sidisky, L.; Rader, J.I. Separation characteristics of fatty acid methyl esters using SLB-IL111, a new ionic liquid coated capillary gas chromatographic column. J. Chromatogr. A 2011, 1218, 545–554. [Google Scholar] [CrossRef]
  38. Malau-Aduli, A.E.O.; Siebert, B.D.; Bottema, C.D.K.; Pitchford, W.S. A comparison of the fatty acid composition of triacylglycerols in adipose tissue from Limousin and Jersey cattle. Aust. J. Agric. Res. 1997, 48, 715. [Google Scholar] [CrossRef]
  39. Kelsey, J.A.; Corl, B.A.; Collier, R.J.; Bauman, D.E. The effect of breed, parity, and stage of lactation on conjugated linoleic acid (CLA) in milk fat from dairy cows. J. Dairy Sci. 2003, 86, 2588–2597. [Google Scholar] [CrossRef] [PubMed]
  40. Archibeque, S.L.; Lunt, D.K.; Gilbert, C.D.; Tume, R.K.; Smith, S.B. Fatty acid indices of stearoyl-CoA desaturase do not reflect actual stearoyl-CoA desaturase enzyme activities in adipose tissues of beef steers finished with corn-, flaxseed-, or sorghum-based diets. J. Anim. Sci. 2005, 83, 1153–1166. [Google Scholar] [CrossRef] [PubMed]
  41. Ulbricht, T.L.V.; Southgate, D.A.T. Coronary heart disease: Seven dietary factors. Lancet 1991, 338, 985–992. [Google Scholar] [CrossRef] [PubMed]
  42. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  43. Kaneko, J.J.; Harvey, J.W.; Bruss, M.L. Clinical Biochemistry of Domestic Animals, 6th ed.; Academic Press: San Diego, CA, USA, 2008. [Google Scholar]
  44. Bianchi, A.E.; Macedo, V.P.; França, R.T.; Lopes, S.T.A.; Lopes, L.S.; Stefani, L.M.; Volpato, A.; Lima, H.L.; Paiano, D.; Machado, G.; et al. Effect of adding palm oil to the diet of dairy sheep on milk production and composition, function of liver and kidney, and the concentration of cholesterol, triglycerides and progesterone in blood serum. Small Rumin. Res. 2014, 117, 78–83. [Google Scholar] [CrossRef]
  45. Enjalbert, F.; Combes, S.; Zened, A.; Meynadier, A. Rumen microbiota and dietary fat: A mutual shaping. J. Appl. Microbiol. 2017, 123, 782–797. [Google Scholar] [CrossRef]
  46. Deng, K.D.; Diao, Q.Y.; Jiang, C.G.; Tu, Y.; Zhang, N.F.; Liu, J.; Ma, T.; Zhao, Y.G.; Xu, G.S. Energy requirements for maintenance and growth of Dorper crossbred ram lambs. Livest. Sci. 2012, 150, 102–110. [Google Scholar] [CrossRef]
  47. Kremer, R.; Barbato, G.; Castro, L.; Rista, L.; Rosés, L.; Herrera, V.; Neirotti, V. Effect of sire breed, year, sex and weight on carcass characteristics of lambs. Small Rumin. Res. 2004, 53, 117–124. [Google Scholar] [CrossRef]
  48. Emery, R.S. Deposition, secretion, transport and oxidation of fat in ruminants. J. Anim. Sci. 1979, 48, 1530–1537. [Google Scholar] [CrossRef]
  49. Kim, Y.H.B.; Warner, R.D.; Rosenvold, K. Influence of high pre-rigor temperature and fast pH fall on muscle proteins and meat quality: A review. Anim. Prod. Sci. 2014, 54, 375–395. [Google Scholar] [CrossRef]
  50. Boughalmi, A.; Araba, A. Effect of feeding management from grass to concentrate feed on growth, carcass characteristics, meat quality and fatty acid profile of Timahdite lamb breed. Small Rumin. Res. 2016, 144, 158–163. [Google Scholar] [CrossRef]
  51. Brito, G.F.; Ponnampalam, E.N.; Hopkins, D.L. The effect of extensive feeding systems on growth rate, carcass traits, and meat quality of finishing lambs. Compr. Rev. Food Sci. Food Saf. 2017, 16, 23–38. [Google Scholar] [CrossRef] [PubMed]
  52. Holman, B.W.B.; Van de Ven, R.J.; Mao, Y.; Coombs, C.E.O.; Hopkins, D.L. Using instrumental (CIE and reflectance) measures to predict consumers’ acceptance of beef colour. Meat Sci. 2017, 127, 57–62. [Google Scholar] [CrossRef] [PubMed]
  53. Priolo, A.; Micol, D.; Agabriel, J.; Prache, S.; Dransfield, E. Effect of grass or concentrate feeding systems on lamb carcass and meat quality. Meat Sci. 2002, 62, 179–185. [Google Scholar] [CrossRef] [PubMed]
  54. Hughes, J.M.; Oiseth, S.K.; Purslow, P.P.; Warner, R.D. A structural approach to understanding the interactions between colour, water-holding capacity and tenderness. Meat Sci. 2014, 98, 520–532. [Google Scholar] [CrossRef]
  55. Hopkins, D.L.; Stanley, D.F.; Martin, L.C.; Toohey, E.S.; Gilmour, A.R. Genotype and age effects on sheep meat production. 3. Meat quality. Aust. J. Exp. Agric. 2007, 47, 1155–1164. [Google Scholar] [CrossRef]
  56. Bouton, P.E.; Harris, P.V.; Ratcliff, D.; Roberts, D.W. Shear force measurements on cooked meat from sheep of various ages. J. Food Sci. 1978, 43, 1038–1039. [Google Scholar] [CrossRef]
  57. Payne, C.E.; Pannier, L.; Anderson, F.; Pethick, D.W.; Gardner, G.E. Lamb age has little impact on eating quality. Foods 2020, 9, 187. [Google Scholar] [CrossRef] [PubMed]
  58. Osório, J.C.S.; Osório, M.T.M.; Sañudo, C. Sensorial characteristics of sheep meat. Rev. Bras. Zootec. 2009, 38, 292–300. [Google Scholar] [CrossRef]
  59. Arshad, M.S.; Sohaib, M.; Ahmad, R.S.; Nadeem, M.T.; Imran, A.; Arshad, M.U.; Kwon, J.H.; Amjad, Z. Ruminant meat flavor influenced by different factors with special reference to fatty acids. Lipids Health Dis. 2018, 17, 223. [Google Scholar] [CrossRef] [PubMed]
  60. Costa, J.B.; Oliveira, R.L.; Silva, T.M.; Barbosa, A.M.; Borja, M.S.; de Pellegrini, C.B.; da Silva Oliveira, V.; Xavier Ribeiro, R.D.; Bezerra, L.R. Fatty acid, physicochemical composition and sensory attributes of meat from lambs fed diets containing licuri cake. PLoS ONE 2018, 13, e0206863. [Google Scholar] [CrossRef] [PubMed]
  61. Ripoll, G.; González-Calvo, L.; Molino, F.; Calvo, J.H.; Joy, M. Effects of finishing period length with vitamin E supplementation and alfalfa grazing on carcass color and the evolution of meat color and the lipid oxidation of light lambs. Meat Sci. 2013, 93, 906–913. [Google Scholar] [CrossRef] [PubMed]
  62. Bellés, M.; Leal, L.N.; Díaz, V.; Alonso, V.; Roncalés, P.; Beltrán, J.A. Effect of dietary vitamin E on physicochemical and fatty acid stability of fresh and thawed lamb. Food Chem. 2018, 239, 1–8. [Google Scholar] [CrossRef] [PubMed]
  63. De Lima Júnior, D.M.; Do Nascimento Rangel, A.H.; Urbano, S.A.; Moreno, G.M.B. Oxidação lipídica e qualidade da carne ovina. Acta Vet. Bras. 2013, 7, 14–28. [Google Scholar]
  64. Barletta, R.V.; Gandra, J.R.; Bettero, V.P.; Araújo, C.E.; Del Valle, T.A.; Almeida, G.F.; Ferreira de Jesus, E.; Mingoti, R.D.; Benevento, B.C.; Freitas Júnior, J.E.; et al. Ruminal biohydrogenation and abomasal flow of fatty acids in lactating cows: Oilseed provides ruminal protection for fatty acids. Anim. Feed Sci. Technol. 2016, 219, 111–121. [Google Scholar] [CrossRef]
  65. Jenkins, T.C. Lipid metabolism in the rumen. Rumenology 1993, 76, 103–126. [Google Scholar] [CrossRef]
  66. Stewart, C.S. Factors affecting the cellulolytic activity of rumen contents. Appl. Environ. Microbiol. 1977, 33, 497–502. [Google Scholar] [CrossRef] [PubMed]
  67. Lourenço, M.; Ramos-Morales, E.; Wallace, R.J. The role of microbes in rumen lipolysis and biohydrogenation and their manipulation. Animal 2010, 4, 1008–1023. [Google Scholar] [CrossRef]
  68. Ferreira, E.M.; Pires, A.V.; Susin, I.; Biehl, M.V.; Gentil, R.S.; Parente, M.O.M.; Polizel, D.M.; Vaz Di Mambro Ribeiro, C.; de Almeida, E. Nutrient digestibility and ruminal fatty acid metabolism in lambs supplemented with soybean oil partially replaced by fish oil blend. Anim. Feed Sci. Technol. 2016, 216, 30–39. [Google Scholar] [CrossRef]
  69. Parvar, R.; Ghoorchi, T.; Shargh, M.S. Influence of dietary oils on performance, blood metabolites, purine derivatives, cellulase activity and muscle fatty acid composition in fattening lambs. Small Rumin. Res. 2017, 150, 22–29. [Google Scholar] [CrossRef]
  70. Palmquist, D.L.; Saint-Pierre, N.; Mcclure, K.E. Tissue fatty acid profiles can be used to quantify endogenous rumenic acid synthesis in lambs. J. Nutr. 2004, 134, 2407–2414. [Google Scholar] [CrossRef]
  71. Scherrer, K. Primary transcripts: From the discovery of RNA processing to current concepts of gene expression—Review. Exp. Cell Res. 2018, 373, 1–33. [Google Scholar] [CrossRef] [PubMed]
  72. Alvarenga, T.I.R.C.; Chen, Y.; Lewandowski, P.; Ponnampalam, E.N.; Sadiq, S.; Clayton, E.H.; van de Ven, R.J.; Perez, J.R.O.; Hopkins, D.L. The expression of genes encoding enzymes regulating fat metabolism is affected by maternal nutrition when lambs are fed algae high in omega-3. Livest. Sci. 2016, 187, 53–60. [Google Scholar] [CrossRef]
  73. Ladeira, M.M.; Neto, O.R.M.; Santarosa, L.C.; Chizzotti, M.L.; de Oliveira, D.M.; de Carvalho, J.R.R.; Alves, M.C.L. Desempenho, características de carcaça e expressão de genes em tourinhos alimentados com lipídeos e monensina. Pesqui. Agropecu. Bras. 2014, 49, 728–736. [Google Scholar] [CrossRef]
  74. Scollan, N.D.; Price, E.M.; Morgan, S.A.; Huws, S.A.; Shingfield, K.J. Can we improve the nutritional quality of meat? Proc. Nutr. Soc. 2017, 76, 603–618. [Google Scholar] [CrossRef] [PubMed]
  75. Russo, G.L. Dietary n-6 and n-3 polyunsaturated fatty acids: From biochemistry to clinical implications in cardiovascular prevention. Biochem. Pharmacol. 2009, 77, 937–946. [Google Scholar] [CrossRef] [PubMed]
  76. Madruga, M.S.; De Araújo, W.O.; De Sousa, W.H.; Cézar, M.F.; Galvão, M.D.S.; Cunha, M.D.G.G. Effect of genotype and sex on chemical composition and fatty acid profile of sheep meat (Efeito do genótipo e do sexo sobre a composição química e o perfil de ácidos graxos da carne de cordeiros). Rev. Bras. Zootec. 2006, 35, 1838–1844. [Google Scholar] [CrossRef]
  77. Bezerra, L.S.; Barbosa, A.M.; Carvalho, G.G.P.; Simionato, J.I.; Freitas, J.E.; Araújo, M.L.G.M.L.; Pereira, L.; Silva, R.R.; Lacerda, E.C.Q.; Carvalho, B.M.A. Meat quality of lambs fed diets with peanut cake. Meat Sci. 2016, 121, 88–95. [Google Scholar] [CrossRef] [PubMed]
  78. Morgado, A.A.; Nunes, G.R.; Bôas, B.R.V.; Carvalho, P.B.J.; Rodrigues, P.H.M.; Susin, I.; Sucupira, M.C.A.; Pereira, A.S.C. Meat quality of lambs supplemented with intramuscular vitamin e. Pesqui. Vet. Bras. 2018, 38, 679–684. [Google Scholar] [CrossRef]
  79. Ricardo, H.A.; Fernandes, A.R.M.; Mendes, L.C.N.; Oliveira, M.A.G.; Protes, V.M.; Scatena, E.M.; Roça, R.O.; Athayde, N.B.; Girão, L.V.C.; Alves, L.G.C. Carcass traits and meat quality differences between a traditional and an intensive production model of market lambs in Brazil: Preliminary investigation. Small Rumin. Res. 2015, 130, 141–145. [Google Scholar] [CrossRef]
  80. Ladeira, M.M.; Schoonmaker, J.P.; Gionbelli, M.P.; Dias, J.C.O.; Gionbelli, T.R.S.; Carvalho, J.R.R.; Teixeira, P.D. Nutrigenomics and beef quality: A review about lipogenesis. Int. J. Mol. Sci. 2016, 17, 918. [Google Scholar] [CrossRef]
  81. Ladeira, M.M.; Schoonmaker, J.P.; Swanson, K.C.; Duckett, S.K.; Gionbelli, M.P.; Rodrigues, L.M.; Teixeira, P.D. Review: Nutrigenomics of marbling and fatty acid profile in ruminant meat. Animal 2018, 12, s282–s294. [Google Scholar] [CrossRef]
Applsci 14 08870 g001
Figure 1. Gene expression in the Longissimus lumborum muscle of grazing lambs supplemented with macadamia oil and vitamin E. Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. SEM: standard error of the mean.
Figure 1. Gene expression in the Longissimus lumborum muscle of grazing lambs supplemented with macadamia oil and vitamin E. Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. SEM: standard error of the mean.
Applsci 14 08870 g001
Table 1. Ingredients, nutritional composition, and fatty acid profile of the base supplement.
Table 1. Ingredients, nutritional composition, and fatty acid profile of the base supplement.
Ingredientsg/kg DM
Soybean meal 1867
Ground corn 299
Mineral premix 328
Dicalcium phosphate6
Chemical Compositiong/kg DM
    Dry matter952
    Crude protein420
    Ether extract20
    Neutral detergent fiber130
    Ash50
    Metabolizable energy 4, Mcal/kg2.92
Fatty Acids%
    C16:020.45
    c9 C16:10.10
    C18:03.43
    c9 C18:126.19
    C18:2 n641.51
    C18:3 n30.24
1 Soyben meal composition: DM: 95.7%; CP: 44.8%; EE: 1.5%; NDF: 14.4%; Ash: 6.2%. 2 Ground corn composition: DM: 95.2%; CP: 8.2; EE: 4.1%; NDF: 8.6; Ash: 1.9%. 3 Composition per kg of mineral premix: Ca 191 g, P 40 g, S 30 g, Mg 4.000 mg, Mn 550 mg, Zn 2.065 mg, Cu 20 mg, Co 70 mg, I 37 mg, Se 9 mg, Vitamin A 150,000 UI, Vitamin E 1000 UI. 4 Metabolizable energy: Estimated using the Small Ruminant Nutrition System (SRNS) [14]. The SRNS uses the following equation ME = DE × 0.90 (ME is metabolizable energy and DE is digestible energy).
Table 2. Chemical composition of Tifton-85 (Cynodon spp.) pasture.
Table 2. Chemical composition of Tifton-85 (Cynodon spp.) pasture.
Chemical Composition% DM
Dry matter31.0
Crude protein12.6
Ether extract1.4
Neutral detergent fiber74.7
Ash7.2
Fatty Acids%
  C16:015.47
  c9 C16:11.14
  C18:01.74
  c9 C18:1 2.23
  C18:2 n615.39
  C18:3 n341.97
Table 3. Sequence (5′ and 3′) and efficiencies of the primers used in real-time quantitative PCR.
Table 3. Sequence (5′ and 3′) and efficiencies of the primers used in real-time quantitative PCR.
SymbolForward (F) and Reverse (R)Access NumberAmplificon (bp)R2Efficiency
SREBP1F CTGCTATGCAGGCAGCACKF360085.2990.991.94
R GGTTGATGGGCAGCTTGT
PPARαF GAAGACCAACAACAATCCGCCXM_0121757742130.991.94
R AAGTCCAAGCTTGCAAACCC
SCD1F CGACGTGGCTTTTTCTTCTCNM_001009254.11240.991.94
R GATGAAGCACAACAGCAGGA
ELOVL6F AGTGGATGCAGGAAAACTGGXM_012179510.2890.991.94
R AAGGGTCAGAGACCAGAGCA
β-actinF GGACCTGACGGACTACCTCATGJN033788.11360.991.96
R GGCCATCTCCTGCTCGAAGT
SREBP1: Sterol regulatory element-binding transcription factor 1. PPARα: Receptor activated by alpha-type peroxisomal proliferators. SCD1: Stearoyl-CoA desaturase (Δ-9-desaturase). ELOVL6: Fatty acid elongase 6. β-actin: Beta-actin. R2: Coefficient of determination.
Table 4. Effect of macadamia oil and vitamin E supplementation on grazing lambs’ growth performance and carcass characteristics.
Table 4. Effect of macadamia oil and vitamin E supplementation on grazing lambs’ growth performance and carcass characteristics.
ParameterExperimental DietsSEMp-Value 1
ControlMOMOVE
Dry matter intake, g/day878.18 a809.42 b807.22 b17.560.0239
Suplement intake, g/day344.40350.32354.410.0030.1242
Pasture intake, g/day533.78 a459.10 b453.14 b17.990.0077
Matabolizable energy intake, Mcal/kg1.922.001.980.040.2786
Ether extract intake, g/day16.36 a42.93 b42.94 b0.900.0001
c9 C16:1 intake, g/day0.10 b6.35 a6.37 a0.170.0001
C18:0 intake, g/day0.28 b3.77 a3.78 a0.090.0001
c9 C18:1 intake, g/day1.84 b13.08 a13.00 a0.310.0001
C18:2 n6 intake, g/day5.34 b7.45 a7.44 a0.130.0001
C18:3 n3 intake, g/day3.28 a2.79 b2.70 b0.080.0001
Average daily gain, g/day118.27136.44129.775.220.1737
Slaughter weight, kg32.6332.1632.740.890.8887
Feed efficiency0.13 b0.17 a0.17 a0.0070.0007
Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. Feed efficiency = Average daily gain (g/day)/Dry matter intake (g/day). SEM: standard error of the mean. 1 Averages with different letters on the lines differ at the 5% level by the t-test.
Table 5. Effect of macadamia oil and vitamin E supplementation on blood biochemical parameters of grazing lambs.
Table 5. Effect of macadamia oil and vitamin E supplementation on blood biochemical parameters of grazing lambs.
ParameterExperimental DietsSEMp-Value 1
ControlMOMOVE
Cholesterol, mg/dL148.33158.60159.116.000.3617
Triglycerides, mg/dL62.5863.6060.342.070.5424
Glucose, mg/dL66.8772.7369.411.920.1142
Insulin, mg/dL60.0466.3964.634.390.5712
Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. SEM: standard error of the mean. 1 Averages with different letters on the lines differ at the 5% level by the t-test.
Table 6. Effect of macadamia oil and vitamin E supplementation on grazing lambs’ growth performance and carcass characteristics.
Table 6. Effect of macadamia oil and vitamin E supplementation on grazing lambs’ growth performance and carcass characteristics.
ParameterExperimental DietsSEMp-Value 1
ControlMOMOVE
Hot carcass weight, kg15.6815.5215.340.710.9452
Cold carcass weight, kg15.2115.0414.880.710.9453
Hot carcass yield, %48.0548.2446.730.870.1843
Cold carcass yield, %46.6146.7245.300.840.2053
Subcutaneous fat thickness, mm1.67 b1.85 a1.89 a0.060.0403
Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. Feed efficiency = Average daily gain (g/day)/Dry matter intake (g/day). SEM: standard error of the mean. 1 Averages with different letters on the lines differ at the 5% level by the t-test.
Table 7. Effect of macadamia oil and vitamin E supplementation on meat quality of grazing lambs.
Table 7. Effect of macadamia oil and vitamin E supplementation on meat quality of grazing lambs.
ParameterExperimental DietsSEMp-Value 1
ControlMOMOVE
Meat pH (pre-rigor)6.956.796.820.080.3444
Meat pH (post-rigor)5.735.745.650.070.5903
Color
  Lightness (L*)41.2842.0742.290.860.6827
  Redness (a*)14.7814.7714.350.460.7603
  Yellowness (b*)10.6610.3310.270.420.7857
Thawing loss, %5.225.205.320.340.9619
Cooking loss, %14.2813.1813.751.060.7675
Shear force, Newtons32.9533.3431.671.470.7198
Water holding capacity, %1515170.010.5245
TBARS 20.49 b0.51 b0.32 a0.040.0040
Chemical composition, g/100 g
  Total colagen0.630.530.680.050.2126
  Protein21.6021.5521.480.170.8996
  Fat1.832.102.080.150.3619
  Moisture74.6074.9674.270.360.4278
  Ash1.621.381.970.220.2153
Sensory characteristics
  Appearance5.85 b6.69 a5.94 b0.230.0041
  Flavor6.85 b7.44 a6.45 b0.210.0005
  Tenderness7.057.186.690.200.1535
  Overall liking6.73 b7.33 a6.30 b0.200.0004
Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. 1 Averages with different letters on the lines differ at the 5% level by the t-test. 2 mg of malonaldehyde/kg of meat.
Table 8. Effect of macadamia oil and vitamin E supplementation on fatty acid composition (% of total fatty acid methyl esters) of the Longissimus lumborum muscle of grazing lambs.
Table 8. Effect of macadamia oil and vitamin E supplementation on fatty acid composition (% of total fatty acid methyl esters) of the Longissimus lumborum muscle of grazing lambs.
Fatty AcidExperimental DietsSEMp-Value 1
ControlMOMOVE
Saturated fatty acids
  C10:00.150.110.130.010.2075
  C12:00.220.210.210.030.9708
  C14:02.692.122.460.250.2626
  C16:020.5721.3021.750.640.4329
  C17:01.131.060.980.050.1902
  C18:016.22 b18.98 a17.45 ab0.680.0268
Branched chain fatty acids
  C13:0 iso0.00330.00340.00330.00070.9962
  C13:0 anteiso0.00290.00320.00260.00040.6233
  C14:0 iso0.0430.0370.0460.0060.5678
  C15:0 iso0.180.150.160.020.4245
  C15:0 anteiso0.230.220.230.020.9797
  C16:0 iso0.150.140.130.010.3629
  C17:0 iso0.450.400.420.030.2000
Monounsaturated fatty acids
  c9 C16:11.95 b1.90 b2.28 a0.100.0433
  c9 C18:134.9235.5134.500.960.7676
  c11 C18:11.611.751.620.060.2625
  t11 C18:13.584.203.660.230.1420
Polyunsaturated fatty acids
  C18:2 n67.65 a5.27 b5.75 b0.700.0493
  C18:3 n30.11 b0.17 a0.15 a0.005<0.0001
  C20:4 n63.502.992.550.420.3087
  C20:5 n3 (EPA)0.350.270.310.040.5021
  C22:5 n3 (DPA)0.660.530.540.100.5844
  C22:6 n3 (DHA)0.220.180.150.020.0701
  c9t11 C18:2 (CLA)0.82 a0.66 b0.76 ab0.040.0354
Sums and indices
Σ Saturated 41.7343.9543.701.230.3710
Σ Monounsaturated40.0840.2439.961.050.9837
Σ Polyunsaturated8.6410.3710.400.940.3300
Σ n63.612.832.810.500.4393
Σ n30.640.570460.060.1860
n6:n35.425.154.830.340.4909
Atherogenicity 20.580.560.560.020.8718
Thrombogenicity 31.291.421.410.060.3380
∆ 9—14 44.213.804.260.270.4656
∆ 9—16 58.647.967.450.700.5011
∆ 9—18 668.2365.5765.770.970.1074
∆ 9—overall 748.6847.1247.120.930.3961
Elongase 869.1669.6969.110.680.8051
Control: control diet. MO: Control + macadamia oil. MOVE: MO + vitamin E. SEM: standard error of the mean. 1 Averages with different letters on the lines differ at the 5% level by the t-test. 2 Atherogenicity index = [C12:0 + 4(14:0) + C16:0]/ΣSFA + ΣPUFA). 3 Thrombogenicity index = [C12:0 + C16:0 + C18:0]/(0.5 × MUFA) + (0.5 × n6) + (3 × n3) + (n3/n6). 4 C14 index: ∆ 9—14 = 100 [(C14:1cis9)/(C14:1ci9 + C14:0)]. 5 C16 index: ∆ 9—16 = 100 [(C16:1cis9)/(C16:1cis9 + C16:0)]. 6 C18 index: ∆ 9—18 = 100 [(C18:1cis9)/(C18:1cis9 + C18:0)]. 7 Overall desaturase index: ∆ 9—overall = 100 [(C14:1+ C16:1+ C18:1)/(C14:1+ C16:1+ C18:1+ C14:0+ C16:0+ C18:0)]. 8 Elongase = 100 [(C18:1cis9 + C18:0)/(C16:1cis9 + C16:0+ C18:1cis9 + C18:0)].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dias Junior, P.C.G.; dos Santos, I.J.; Gallo, S.B.; Alvarenga, T.I.R.C.; Alvarenga, F.A.P.; Garcia, A.M.; Pereira, I.G.; Alves, N.G.; Furusho-Garcia, I.F. Performance, Meat Quality and Gene Expression of Grazing Lambs Supplemented with Macadamia Oil and Vitamin E. Appl. Sci. 2024, 14, 8870. https://doi.org/10.3390/app14198870

AMA Style

Dias Junior PCG, dos Santos IJ, Gallo SB, Alvarenga TIRC, Alvarenga FAP, Garcia AM, Pereira IG, Alves NG, Furusho-Garcia IF. Performance, Meat Quality and Gene Expression of Grazing Lambs Supplemented with Macadamia Oil and Vitamin E. Applied Sciences. 2024; 14(19):8870. https://doi.org/10.3390/app14198870

Chicago/Turabian Style

Dias Junior, Paulo C. G., Isabela J. dos Santos, Sarita B. Gallo, Tharcilla I. R. C. Alvarenga, Flavio A. P. Alvarenga, Adriana M. Garcia, Idalmo G. Pereira, Nadja G. Alves, and Iraides F. Furusho-Garcia. 2024. "Performance, Meat Quality and Gene Expression of Grazing Lambs Supplemented with Macadamia Oil and Vitamin E" Applied Sciences 14, no. 19: 8870. https://doi.org/10.3390/app14198870

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop