First Description of the Occurrence of Slow Bee Paralysis Virus-1 and Deformed Wing Virus B in Apis mellifera ligustica Honeybee in Italy

Abstract

Among the causes of bee colony death, viruses are among the number of pathogens that can contribute to the ill health of a colony. This study focuses on two of the several honeybee viruses, Slow Bee Paralysis Virus-1 (SBPV-1) and Deformed Wing Virus B (DWV-B), both belonging to the Iflavirus genus. To date, there is limited information available on the presence of these viruses in Italy. For this research project (IZS LT 04/19 RC), funded by the Ministry of Health, the presence and positivity of several honeybee viruses were evaluated in Italy using molecular methods. Convenience sampling was used, and these samples were analyzed for the two viruses and/or other main honeybee viruses, using specific PCR protocols and Sanger sequencing when necessary. A statistical analysis was conducted to study the independence between the viruses. Our data demonstrate for the first time the presence of SBPV-1 in Italian territory with a rather low number in most of the regions investigated, except for Emilia-Romagna and Lazio where it was detected more frequently, while DWV-B was detected at a higher level in all the regions investigated.

1. Introduction

Viruses are one of the principal causes of bee colonies dying, with consequences for both the ecosystem and the economy. Relevant for the dissemination of viruses is the association between these pathogens and bee parasites, like Varroa destructor and Aethina tumida, and virus spillover among different species of the Apoidea family. Slow Bee Paralysis Virus-1 (SBPV-1) and Deformed Wing Virus B (DWV-B) viruses with a marked tropism for the nervous system are included in the latter case [1]. Like most honeybee viruses, both belong to the order Picornavirales, family Iflaviridae and consist of a single positive-stranded RNA genome [2,3].

In particular, SBPV-1 belongs to the Iflavirus genus and was first reported in 1974 in England [4]. It is frequently detected in the bumblebee species with a high prevalence, in particular in Bombus terrestri and Bombus pascuorum [5,6,7]. Unlike the honeybees, in these species, the virus is asymptomatic and can express its pathogenicity which is influenced by environmental stress conditions to which the host is exposed [8]. The major vector of SBPV-1 in honeybees is Varroa destructor, which transports the virus directly into the target organs through the hemolymph. The virus persists as a subclinical infection at the following sites: hypopharyngeal, mandibular and salivary glands, brain, fat tissue, and head [2].

Like SBPV-1, the DWV-B virus belongs to the Iflavirus genus. It has a widespread distribution and represents the most frequently Varroa-associated virus infection in the Apis mellifera species. Of this virus, three main variants were identified. In particular, DWV-A discovered in Japan in 1982, DWV-B known as Varroa destructor virus-1, and DWV-C, identified in the Netherlands in 2004 [9,10]. Recently, another variant, DWV-D, was discovered in a honeybee sample from Egypt, of note is that it was collected back in the 70s [11]. The signs of DWV virus infection are associated with the presence of the Varroa mite; the honeybees present deformed wings, a shorter than normal abdomen, discoloration of the cuticle, and behavioral changes such as aggressiveness and learning difficulties.

To date, there is limited information available on the presence of these viruses in Italy. A research project, IZS LT 04/19 RC, funded by the Ministry of Health and conducted nationwide in Italy, started with a bee health monitoring study on a voluntary basis and aimed also to evaluate the presence and level of positivity of honeybee viruses, with particular attention paid to SBPV-1 and DWV-B, using molecular methods. In addition to this research project, samples from another research study, again funded by the Ministry of Health, IZS LT 07/13 RC, and titled “Feasibility study to reduce the prevalence of reportable bee diseases by implementing good beekeeping practices” were also included for the analyses of SBPV-1 and DWV-B.

In Italy, these two viruses have, to date, never been detected, except for DWV-B in a study conducted in northern Italy in 2021 [12], while Paxton et al. also demonstrated that DWV-B in Europe has now been by replaced DWV-A [10].

Furthermore, the presence of a possible association was also investigated between these two viruses and other viruses that have tropism for the nervous system, such as ABPV and DWV, just for the samples collected within the IZS LT 07/13 RC, as the sampling size of the IZS LT 04/19 RC was reduced.

The results of this study can help beekeepers to improve their knowledge of health status and the management of their hives by rapid molecular diagnosis. Moreover, knowledge on virus dissemination can lead to better control of the environmental impact, restricting the possibility of transmission among Apoidea species.

2. Materials and Methods

2.1. Sample Collection

A convenience sampling was carried out with the collection of 130 samples (22 hive debris and 108 foraging bees) from 2020 to 2022, following bee die-off events in different Italian regions during a bee health monitoring study, conducted on a voluntary basis (IZS LT 04/19 RC) (

Table 1. Hive debris and foraging bee samples collected in Italian regions from both research projects.

Region	IZS LT 04/19 RC		IZS LT 07/13 RC		Total
	Hive Debris	Foraging Bees	Hive Debris	Foraging Bees
Lazio	2	99	0	39
Toscana	0	9	0	47
Emilia-Romagna	20	0	0	37
Calabria	0	0	0	97
Campania	0	0	0	58
Lombardia	0	0	0	37
Trentino Alto Adige	0	0	0	46
Total	22	108	0	361	491

). Of these 130 samples, 123 were analyzed for SBPV-1 and 32 for DWV-B.

An additional set of 361 samples consisting of foraging bees from different regions (Table 1) collected from a bee-die-off that occurred from 2016 to 2018 were included within the framework of the research project IZS LT 07/13 RC “Feasibility study to reduce the prevalence of reportable bee diseases by implementing good beekeeping practices”. Of these samples, all were tested for SBPV-1, 307 for DWV-B, and for other viruses as following: 322 for ABPV, 322 for DWV (for all variants), and 314 for CBPV.

All the samples were stored at −80 °C until analysis.

2.2. RNA Extraction and cDNA Synthesis

RNA extraction was carried out using the automated nucleic acid purification instrument ZINEXTS and MagPurix Viral/Pathogen Nucleic Acid Extraction Kit B (ZINEXTS). Before nucleic acid extraction, 1 g of each debris sample was homogenized in 10 mL of phosphate buffer solution (PBS) 1× for two hours at 37 °C on a rocking platform, while the samples of foraging bees, each composed of 20 individuals, were homogenized manually in 20 mL of PBS 1×. Then, 2 mL from the whole homogenate was centrifuged and 200 µL of the supernatant was used for the RNA extraction. cDNA synthesis from 20 µL of RNA was performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions, in the Gene Amp^® PCR System 9700 (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) with a thermal cycling profile of 10 min at 25 °C and 45 min at 37 °C.

2.3. Real-Time PCR

For DWV-B, DWV, ABPV, and CBPV, specific real-time PCR protocols were performed using the TaqMan Universal PCR Master Mix kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) in a final volume of 25 µL, including 5 μL of the cDNA. The primers and probes used and their final concentrations are shown in

Table 2. List of primers and probes used for virus detection (DWV-B, DWV, ABPV, CBPV).

Virus.	TARGET GENE	Primer and Probe	Sequence (5′-3′)	Ref.	Final Concentration (µM)
DWV-B	VP3	F-VDV1_4218	GGTCTGAAGCGAAAATAG	[13]	1.2
		R-VDV1_4290	CTAGCATATCCATGATTATAAAC		1.2
		Probe VDV1_4266	FAMCCTTGTCCAGTAGATACAGCATCACATAMRA		0.4
DWV	gp1	DWV Forward	ATGGGTTTGATTCG/AATATCTTGGAA	[14]	0.9
		DWV Reverse	GATGTTCCG/AGGTGGCTTTAATGA		0.9
		DWV Probe	FAMACTAGTGCTGGTTTTCCTTTGTCMGB-NFQ		0.25
ABPV	gp1	APV-1Forward	GCCCAGACAAGCGCAGTACT	[14]	0.9
		APV-1Reverse	AGCACGGAAAACGCGTCTT		0.9
		ABPV-1 Probe	FAMTCCCCGATAGCRACCGAMGB NFQ		0.25
CBPV	RdRP ORF 3	CBPV Forward	CGCAAGTACGCCTTGATAAAGAAC	[15]	0.3
		CBPV Reverse	ACTACTAGAAACTCGTCGCTTCG		0.3
		CBPV Probe	FAMTCAAGAACGAGACCACCGCCAAGTTC-TAMRA		0.3

, together with the references. The real-time PCR was carried out on a QuantStudio^TM 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). Negative and positive controls were included in each PCR reaction. Positive controls for each experiment were designed for the target region and synthesized by Eurofins genomics. All data was analyzed using the QuantStudio^TM 7 Flex Sequence Detection System SDS software package v1.3 (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA).

2.4. RT-PCR SBPV-1

For SBPV-1 detection, the primers described by Roberts 2017 [14] (Primer SBPV-1 Fw: 5′-GATTTGCGGAATCGTAATATTGTTTG-3′; Primer SBPV-1 Rv: 5′-ACCAGTTAGTACACTCCTGGTAACTTCG-3′), targeting a region of RNA-dependent RNA polymerase (RdRP), were used. PCR was performed using AmpliTaq Gold^® DNA Polymerase kit (Applied Biosystems, Thermo Fisher Scientific). The master mix, in a final volume of 50 μL, included 5 μL cDNA and a final concentration of 1× Buffer, 3 mM MgCl2, 0.4 μM for each primer, 0.2 µM dNTPs, and 3 U AmpliTaq Gold^® DNA Polymerase. The amplification was carried out using a Verity™ 96-Well Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). The thermal cycling profile consisted of an initial step at 94 °C for 10 min, followed by 40 cycles consisting of denaturation at 95 °C for 1 min, annealing at 58 °C for 1 min, extension at 72 °C for 1 min, and a final elongation step at 72 °C for 10 min. Negative and positive controls were included in each PCR. The SBPV-1 PCR products (900 bp or 380 bp depending on the circulating strains) [2] were visualized by capillary electrophoresis on a QIAxcel advanced instrument (QIAGEN, Hilden, Germany) and some were confirmed by Sanger sequencing using the kit BigDye terminator Cycle Sequencing Reading Reaction Mix V 3.1 (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA USA). The nucleotide sequences obtained were analyzed using Basic Local Alignment, Search Tool (BLAST) by comparing them to sequences from reference strains of different SBPV virus present in the NCBI GenBank (http://www.ncbi.nlm.nih.gov/, accessed on 22 September 2022).

2.5. Statistical Analysis

To evaluate the presence of a relationship between viruses in honeybee samples collected during the IZS LT 07/13 RC, an independence analysis (nonassociation between viruses) was conducted using Fisher’s test. The analysis was carried out using R Studio 4.0.1 [16].

3. Results

For the IZS LT 07/13 RC samples, 86 of the 361 foraging bee samples analyzed were positive for SBPV-1 (23.8%); 286 of the 307 samples tested positive for DWV-B (91.08%); 295 samples out of 322 were found positive for ABPV (93.95%), 31/314 for CBPV (9.87%) and 258/322 positive for DWV (82.17%).

Emilia-Romagna (22/37 samples) and Lazio (22/39 samples) are the Italian regions that showed the highest presence of SBPV-1 in foraging bees, while in the Lombardia Region, only 2 positive samples were found out of the 37 tested (Figure 1).

Regarding the SBPV-1, 33 samples showed a PCR product of 380 bp, 27 samples of 900 bp, and in 33 samples, both amplicons were detected. Sequencing analysis was possible only for those samples that showed a strong signal when visualizing by capillary electrophoresis. Four positive samples from Lazio had a 900 bp PCR product, as well as three 380 bp positive samples from Emilia-Romagna were confirmed by Sanger sequencing, and the sequences showed a percentage of identity greater than 98% with the sequence of Slow Bee Paralysis Virus strain PP, accession number KY243931, isolated in United Kingdom.

Regarding DWV-B, all the samples from the Lazio (39) and Calabria (75) regions were found positive, while in the other regions, the percentage of positive samples was above 70% (Figure 1).

DWV was detected in all Italian regions investigated, and it was present in all samples from the Lazio (39) and Campania (58) regions. In the remaining regions, the percentage of positive samples was between 56.8% in Emilia-Romagna and 93.5% in Trentino (Figure 1).

ABPV was detected in all regions and was present in all samples from Trentino (46) and Emilia-Romagna (37), while in the remaining regions, the percentage of positive samples was between 43.1% in Campania and 97.3% in Lombardia (Figure 1).

Compared to the other viruses, the level of positivity of CBPV was very low and was not detected in Emilia-Romagna, whereas in the other regions, it was between 2.13% (Toscana) and 21.65% (Calabria).

In addition, in the voluntary bee health monitoring study (IZS LT 04/19 RC), only 1 sample (foraging bee) from the Lazio region of the 123 analyzed was positive for SBPV (0.81%), also confirmed by Sanger sequencing.

For DWV-B, 18 of the 32 samples analyzed were positive (56.25%): 7 from Lazio (only foraging bees), 1 from Toscana, and 10 (only hive debris) from Emilia-Romagna, respectively.

The presence of a possible association between SBPV-1 and DWV-B was evaluated in samples collected within the IZS LT07/13 RC. The positivity levels of these viruses were also compared with those of ABPV and DWV and with ABPV, respectively.

The ABPV and DWV viruses were chosen for the independence study as they exhibit marked tropism for the nervous system and are not necessarily found in association [17]. No statistical evidence of association between the viruses was found (all p values > 0.05) (

Table 3. Contingency table of ABPV and SBPV-1 in foraging bee samples.

Absence/Presence	ABPV+	ABPV−	TOT
SBPV-1+	69	1	70
SBPV-1−	245	7	252
TOT	314	8	322

,

Table 4. Contingency table of DWV and SBPV-1 in foraging bee samples.

Absence/Presence	DWV+	DWV−	TOT
SBPV-1+	67	19	86
SBPV-1−	238	37	275
TOT	305	56	361

and

Table 5. Contingency table of ABPV and DWV-B in foraging bee samples.

Absence/Presence	ABPV+	ABPV−	TOT
DWV-B+	233	1	234
DWV-B−	26	0	26
TOT	259	1	260

). The independence study between SBPV-1 and DWV-B showed that there is a possible association between these two viruses given a p value of 0.0085 (

Table 6. Contingency table of SBPV-1 and DWV-B in foraging bee samples.

Absence/Presence	DWV-B+	DWV-B−	TOT
SBPV-1+	69	1	70
SBPV-1−	217	27	244
TOT	286	28	327

).

4. Discussion

Our data demonstrate the presence of SBPV-1 in Italian territory with a rather low level of positivity in most of the regions investigated, except for the Lazio and Emilia-Romagna regions, respectively, where positivity ranged from 56.40% to 59.46%. SBPV-1 was detected by molecular analysis in foraging bee samples and for seven of these the positivity was confirmed by Sanger sequencing of the amplification products.

As reported, SBPV-1 shows higher prevalence and higher pathogenicity in bumblebees [7] than in honeybees; indeed, the Bombus species represents the ancestral host of this virus, whereas in Apis mellifera, the virus has subsequently adapted, maintaining a lower viral load than the primary species. This “species-jump” could have resulted in recombination events with loss of genomic portions within the same genome of SBPV-1 [2]. Maybe this can explain the presence of two different amplicons, 900 bp and/or 380 bp, as was observed in our positive samples.

The SBPV-1 lower positivity was already described by De Miranda et al. (2010) [2]. They demonstrated through a study involving five European countries that the prevalence of SBPV was less than 2%, with positive samples found only in some colonies in England and Switzerland, with varying degrees of Varroa infestation. In our study, a further explanation of the low positivity of this virus is that the samples analyzed came from die-offs caused by the simultaneous presence of other viruses (ABPV, DWV). This reduces the survival rate of the colony, leading to rapid death and ultimately decreasing the possibility of detecting SBPV-1, meaning that this virus could be usually present as a subclinical infection with a low viral load and therefore is not detected by molecular analysis. Indeed, in literature [2], it is considered a rarely detected virus, and until 2010, it was associated with colony mortality only in Britain.

The independence study between SBPV-1 and ABPV, as well as with DWV, did not show statistically significant associations among these viruses that share the same tropism for the nervous system [17]. This result is likely due to the small number of SBPV-1 and ABPV or SBPV-1 and DWV positive samples detected compared to the total number of samples. Although a possible association could be found between SBPV-1 and DWV-B, this should be confirmed by further studies employing random sampling.

For DWV-B, our data showed a strong presence of this virus in all Italian regions investigated, and no statistically significant association between DWV-B and ABPV viruses was found. It can be assumed that this result is due to the difficulty in obtaining samples quickly in cases of die-offs, which could lead to the degradation of the nucleic acid.

The fact that DWV-B replicates very quickly in Varroa destructor [7,18,19] has probably contributed to the wide dissemination of this virus in the country [10], confirming the worldwide trends reported in the recent literature [10,19]. Also, Paxton et al. in 2022 highlighted how the variant DWV-B is widely spreading and replacing DWV-A [11]. In fact, DWV can generate different variants of the same strain within the infected family, and this phenomenon is known as “quasispecies” [11].

The increased presence and virulence of DWV-B has also been associated with massive winter colony die-offs leading to severe losses to the economy and beekeepers [20]. Due to the fact that DWV-B in Apis mellifera can be either asymptomatic or symptomatic, relative to the viral load, making its identification more difficult [21], it is crucial to realize an effective control program of colonies.

5. Conclusions

The aim of this study was to evaluate the presence and positivity level of SBPV-1 and DWV-B in different Italian regions, confirming for the first time the presence of SBPV-1 in Italy and with a rather high positivity level in the Emilia-Romagna and Lazio regions. Regarding DWV-B, the results demonstrate a high presence of this virus in all regions investigated. A good knowledge base on the dissemination of these viruses is also important to protect other pollinators, such as Bombus spp., that is, the ancestral host of SBPV-1. The circulation of these viruses, in addition to that of Varroa destructor, is favored by the practice of nomadism, which involves the transfer of bee colonies among beekeepers, even from one territory to another or from one region to another region. For this reason, it is crucial to correctly manage Varroa infestation and apply good beekeeping practices to avoid the spread of viruses, or more broadly, pathogens.

In conclusion, the uncontrolled spread inter- and intraspecies [22] of these pathogens, especially through Varroa but not only, together with the poor management of apiaries, is responsible, in the long term, for progressive damage to Apoidea, such as Apis mellifera, essential for the functioning of the entire ecosystem. It is, therefore, fundamental to apply good beekeeping practices to prevent and control the spread of these pathogens and contribute to maintaining healthy and strong colonies.

Furthermore, it is necessary to develop molecular protocols not only for a rapid diagnosis of these viruses, characterized by frequent recombination processes, but also to detect those that are still under investigated to characterize them through sequencing, while also using next generation sequencing (NGS) techniques.