Next Article in Journal
Advancing Copper Wire Technology: Graphene/Cu Composites for Superior Conductivity and Strength
Next Article in Special Issue
Seed Biotechnologies in Practicing Sustainable Agriculture: Insights and Achievements in the Decade 2014–2024
Previous Article in Journal
A Tour Recommendation System Considering Implicit and Dynamic Information
Previous Article in Special Issue
Transforming Wine By-Products into Energy: Evaluating Grape Pomace and Distillation Stillage for Biomass Pellet Production
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotypic, Genetic, and Metabolite Variability among Genotypes of Vicia sativa L.

by
Eleni Avramidou
1,
Efi Sarri
2,
Evgenia-Anna Papadopoulou
3,
Christos Petsoulas
4,
Evangelia Tigka
4,
Nikolaos Tourvas
5,
Emmanouil Pratsinakis
1,6,
Ioannis Ganopoulos
7,
Eleni Tani
2,
Konstantinos A. Aliferis
3,
Eleni M. Abraham
8,
Panagiotis Madesis
1,9 and
Dimitrios Vlachostergios
4,*
1
Institute of Applied Bioscience, Centre for Research and Technology Hellas (CERTH), 57001 Thermi, Greece
2
Laboratory of Plant Breeding and Biometry, Department of Crop Science, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece
3
Laboratory of Pesticide Science, Department of Crop Science, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece
4
Institute of Industrial and Forage Crops, Hellenic Agricultural Organization ELGO-DIMITRA, 41335 Larissa, Greece
5
Laboratory of Forest Genetics and Tree Breeding, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
6
Laboratory of Agronomy, School of Agriculture, Faculty of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
7
Institute of Plant Breeding and Genetic Resources, HAO-Demeter, 57001 Thermi, Greece
8
Faculty of Agriculture, Forestry and Natural Environment, School of Forestry and Natural Environment, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
9
School of Agricultural Sciences, Department of Agriculture Crop Production and Rural Environment, University of Thessaly, 38446 Volos, Greece
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(20), 9272; https://doi.org/10.3390/app14209272
Submission received: 18 June 2024 / Revised: 23 August 2024 / Accepted: 24 August 2024 / Published: 11 October 2024
(This article belongs to the Special Issue Advanced Plant Biotechnology in Sustainable Agriculture)

Abstract

:
Vicia sativa L., commonly known as the common vetch, is an annual, self-pollinating legume used primarily as fodder both by livestock and wildlife. Additionally, it contributes to environmental balance through nitrogen fixation and the improvement of soil properties. The phenotypic, genetic, and metabolite variability among four advanced lines (BK45, BK29, BK23, BK27) and two commercial varieties (M-6900, BI-65) of V. sativa were evaluated in order to be used for future breeding programs aimed at producing genetically improved varieties. BK45 was the most promising line due to its high genetic polymorphism, but also because it exhibited a significant amount of seed production and high seed quality based on its metabolomics profile. A stepwise multiple regression analysis (MRA) revealed a relationship between SCoT alleles, seed, and biomass yield. Additionally, several statistically significant marker bands linked to metabolites were found using the SCoT marker analysis. Hence, data assessed via MRA may be helpful in marker-assisted breeding programs. Finally, the two commercial varieties can be further exploited in breeding programs due to their high genetic diversity.

1. Introduction

The genus Vicia L. belongs to the Fabeae tribe of the Papilionoideae subfamily, which also includes Lathyrus, Lens, and Pisum [1]. This genus contains 162 to 210 annual or perennial species that are cultivated in Europe, Asia, North America, temperate South America, and tropical Africa; however, exact numbers are uncertain [2]. According to archaeological data [3,4], the Mediterranean basin is the principal center of origin and diversification [5].
The common vetch (Vicia sativa) is widely grown around the world because of its advantages in terms of economic value and ecological protection [6]. The common vetch is mostly cultivated as a winter forage legume due to its exceptional nutritional value and biochemical and antioxidant attributes [7,8]. It serves various purposes such as being utilized for green manure, pasture, silage, and hay. Its adaptability to a broad spectrum of climate and soil conditions makes it an ideal choice as an intercrop for cereals.
According to Huang et al. [9], the common vetch is mostly referred to as an inexpensive and abundant source of protein and minerals with high digestibility and high energy content for animal feed. Additionally, because the common vetch interacts symbiotically with rhizobia soil bacteria to fix atmospheric nitrogen, its production is ideal in sustainable agricultural systems as it uses fewer fertilizers and emits fewer pollutants, such as pollutant gases [10]. This contributes to enhancing soil properties [2,6,11,12]. According to FAO [13], the production of the common vetch is mostly concentrated in Ethiopia, the Russian Federation, and Spain. The annual production of the common vetch is more than 934.388 tons, and its cultivation area is 540.761 ha [13].
Genotypic diversity for various morphological and agronomical traits is a prerequisite in order to organize a breeding program and to develop improved varieties. Furthermore, morphological diversity among genotypes is primarily used by international organizations like the Community Plant Variety Office (CPVO) or the International Union for the Protection of New Varieties of Plants (UPOV) as the main criterion to distinguish different varieties and provide breeders rights. These organizations have produced specific textbooks for numerous plant species with guidelines for the specific traits that must be measured to better assess genotypic diversity (CPVO).
Genetic analyses and the identification of variability among populations as well as their metabolic profiles are crucial for the conservation of the species as well as for breeding efforts [14]. It has been recently revealed that metabolic markers for plant breeding can be found using focused metabolite analyses [15]. When metabolites are used to evaluate genetic diversity and when levels of a particular metabolite are associated with agronomic traits, they could play a crucial role in the selection process [16,17].
With the development of molecular marker technology, a variety of molecular markers have been used to evaluate genetic diversity in plant species. Examples include the amplified fragment length polymorphism (AFLP) marker in Taraxacum koksaghyz [18], single nucleotide polymorphism (SNP) marker in Miscanthus, Saccharum, and related grasses [19], inter-simple sequence repeat (ISSR) and simple sequence repeat (SSR) markers in Dactylis glomerata [20], and simple sequence repeat (SSR) marker in Medicago sativa [21] and in Siberian Elymus sibiricus [22]. The start codon targeted (SCoT) polymorphism marker is a relatively new marker system. The short-conserved area bordering the adenine–thymine–guanine (ATG) start codon in plant genes served as the basis for the development of these molecular markers [23,24]. The main advantage of SCoT molecular markers is that one primer is used for forward and reverse priming and is comparable to random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers. Additionally, SCoT markers in legume species have been found to be useful in identifying superior alleles and help in studying genetic relationships in Cicer arietinum [25], in Vicia faba [26,27,28], and in Phaseolus vulgaris [29]. Limited information is available about the genetic diversity of the common vetch’s germplasm. AFLPs were used for the evaluation of more than 20 Vicia species of Russian germplasm [30], SCoT molecular markers for the assessment of the genetic diversity of Vicia faba [6] and SSR [31] markers were used for the Chinese germplasm. Most of the research focuses on comparative studies for genetic diversity and phylogenetic relationships among Vicia species [5,21,32].
The development of new cultivars with a higher quality suitable for animal feed, forage, and plant breeding is under growing pressure. Quality characteristics can be linked to the high nutritional value (i.e., rich protein composition) of the legume/pulse seeds and their rich secondary metabolite content. To justify the benefits of legumes for animal feed, it is therefore extremely desirable to create standardized analytical procedures for showing their metabolism, such as metabolomic analyses [33]. Until now, reports on the metabolomic profile of V. sativa are mainly focused on its correlation to abiotic stress resistance [34,35] and have been carried out on specific developmental stages [35]. A recent study refers to the differentiation of species of the genus Vicia based on secondary metabolites [33]. To our knowledge, there are no studies exclusively on V. sativa varieties showing their differentiation based on the seed’s metabolomic profile.
Breeders always have crucial duties to complete, including the efficient use of germplasm resources and efficient conservation, both of which need a thorough understanding of the genetic variety present in germplasm arrays and the genetic linkages between genotypes [36]. In this respect, in the present study, four populations and two commercial Greek varieties were studied in terms of phenotypic variability, genetic diversity, and seed’s metabolomic profile. All the above data combined could offer a useful tool for the efficient use of the germplasm in breeding programs.

2. Materials and Methods

2.1. Phenotypic Data

Four populations provided by the company AGROLAND S.A. (Karditsa, Greece) (namely BK45, BK29, BK23, BK27) and two commercial varieties (Μ-6900 and ΒΙ-65) developed by the Institute of Industrial and Forage Crops (IIFC belongs to the Hellenic Agricultural Organization-DIMITRA) were used to record phenotypic data for 15 significant morphological traits (Table 1). A Randomized Complete Block Design with four replications was established in the central farm of the IIFC (latitude 39°30′ N, longitude 22°42′ E, elevation 77 m a.s.l.) for two growing seasons. Phenotypic traits were measured according to the process and the guidelines described in the technical protocol of the Community Plant Variety Office (CPVO-TP/032/1). Seed traits were observed in a stereoscope (Euromex Stereoblue) (Duiven, The Netherlands).

2.2. DNA Isolation and Markers Analysis

The same plant material was used for the study of genetic diversity. Twenty seeds per genotype were sown to pots in a controlled growth chamber with a photoperiod of 14/10 h light/dark. The temperature was between 20 and 27 °C, with a mean temperature of 23 °C. One gram of fresh young leaves of the above plant material (ten individuals per population) was ground with liquid nitrogen and stored in −20 °C. The procedure described by Doyle and Doyle [37] was used for the isolation of total genomic DNA. The amount of DNA was quantified using a UV-Vis Spectrophotometer (Q 5000, Quawell, Sunnyvale, CA, USA) and then the samples were diluted to a 20 ng/μL working concentration.
The PCR for the SCoT analysis was performed in a total volume of 20 μL containing 20 ng total genomic DNA, 1× PCR buffer, 1 μM of primer, 0.25 mM of DNTPs, and 1 U kapa Taq polymerase. A total number of 11 SCoT primers (Table 2) were selected due to their high polymorphic content and used for PCR amplification. Then, those SCoT markers were screened by using agarose gel electrophoresis in order to study intra- and inter-population diversity for V. sativa, and PCR amplifications were performed in a SureCycler 8800 (Agilent Technologies, Santa Clara, CA, USA) as follows: initial denaturation of 5 min at 94 °C followed by 40 cycles of 30 s at 94 °C, annealing at 50 °C for 90 s, and extension at 72 °C for 90 s; a 5 min step at 72 °C was programmed as a final extension.
Amplification products were separated by electrophoresis on 1.5% agarose gel and stained with ethidium bromide. Gel images were obtained in a UVItec Transilluminator and a 1 Kb DNA ladder (Invitrogen, Carlsbad, CA, USA) was used as a molecular weight marker.
Binary data points denote the presence/absence of each distinguishable band across all samples for the same primer, in both replicate sets of amplifications.

2.3. V. sativa Seed Metabolomics Analysis

The GC/EI/MS metabolomics analysis was performed using six V. sativa populations, as previously described, with minor modifications [27]. Batches of seeds of each population were pulverized into a fine powder using a blender, and samples (100 mg) were weighed in Eppendorf tubes for metabolite extraction. In total, six biological replications and one quality control (QC) sample were used per population. The previously described protocols were applied with minor modifications [38,39]. The selected solvent system was a methanol–ethyl acetate (1:1, v/v) mixture, 1 mL of which was added to the samples, together with 10 μL of a ribitol solution in methanol (0.2 mg‧mL−1, Sigma-Aldrich Ltd., Steinheim, Germany). Extraction was assisted by placing the samples into an ultrasonic bath (Branson 1210, Danbury, CT, USA) for 25 min, followed by agitation for 1 h. The resulting extracts were filtered through 0.2 μm in pore diameter filters (Macherey-Nagel, Duren, Germany) and evaporated to dryness with a vacuum concentrator (Concentrator Plus, Eppendorf, Hamburg, Germany). The derivatization of the dried extracts was performed in two steps as previously mentioned [39], using a methoxylamine hydrochloride solution in pyridine and N-methyl-N-(trimethyl-silyl) trifluoroacetamide (MSTFA, Macherey-Nagel, Düren, Germany). The analysis of the seeds’ metabolomes was performed employing an Agilent 6890 MS (Agilent Technologies Inc., Santa Clara, CA, USA) platform equipped with a 5973 inert mass selective detector (MSD). The deconvolution of the obtained GC/EI/MS total ion chromatograms (TICs) was performed with the software AMDIS v.2.66 and the metabolite libraries of the National Institute of Standards and Technology library, NIST ‘2020 (NIST, Gaithersburg, MD, USA). Data preprocessing was performed using the MS DIAL v.4.80 software [40] and the discovery of trends and biomarkers of the analyzed populations was achieved using the bioinformatics software Simca v.17.0 (Sartorius AG, Goettingen, Germany) according to a previously presented pipeline [39,41].

2.4. Data Analysis

2.4.1. Morphological Traits

The statistical analysis for morphological traits was conducted using the R program v.4.2.3. [42]. Utilizing the R “stats” package, a heatmap was generated to visualize trait values for each genotype. The heatmap also incorporates hierarchical cluster analyses for both traits and genotypes. The Euclidean distances were computed using the unweighted pair group method with the arithmetic mean (UPGMA) agglomeration method. This methodology facilitated the clustering of traits and genotypes based on their similarities, enhancing the interpretability of the heatmap. Furthermore, a principal component analysis (PCA) was conducted using the “FactorMiner” R package. This analysis aimed to diminish the dimensionality of the original variables while transforming them into orthogonal variables, referred to as principal components. The application of PCA serves to capture the most significant patterns and variations in the dataset, contributing to a more streamlined and interpretable representation of the data.

2.4.2. Molecular Analysis

The genetic diversity of V. sativa populations, the number of different alleles (Na), the number of effective alleles (Ne), the percentage of polymorphic loci (P%), the Shannon’s diversity index (I), the diversity (H), and the unbiased diversity (uh) were calculated using GenALEx v.6.51b2 [43]. The hierarchical distribution of genetic variation among and within populations was also characterized by an analysis of molecular variance (AMOVA) [2] using GenALEx v. 6.51b2 software [43], with variation being examined among and within populations. The tests were implemented using estimates of ΦST, based on distances calculated from allelic data. Tests of significance were performed using 999 permutations within the total dataset. A cluster analysis using an unweighted pair group method with arithmetic averaging (UPGMA) [44] was carried out using the software GenAlex v.6.51b2 [43]. Dendrograms were generated using Mega v.11 [45]. The genetic structure of V. sativa populations was analyzed by performing a principal coordinate analysis (PCoA) using GenAlEx v.6.51b2 [43] based on the standardized covariance of genetic distance for dominant markers. The polymorphism information content (PIC) was calculated using the online program Online Marker Efficiency Calculator (iMEC) [46].
STRUCTURE 2.3.4 [47,48] was used employing the “admixture” and the “independent allele frequencies” models to investigate genetic structure patterns. Twenty independent runs, for K = 1 up to K = 7, were executed in parallel with the Structure_threader 1.3.0 software [49]. For each run, the burn-in period was set to 2 × 105 followed by 5 × 105 iterations. The CLUMPAK main pipeline was used to aggregate results [50].
To estimate the association between the molecular markers and the 22 metabolites and the yield in seed and biomass, a stepwise multiple regression analysis (MRA) was performed [51,52], where every metabolite and yield characteristic was treated as a dependent variable, and the DNA fragments produced by the molecular markers were treated as independent variables. The MRA analysis was performed using SPSS v.26.0.0.

3. Results

3.1. Genotypic Diversity of Morphological Traits

The detailed description and scoring of the 15 morphological traits measured for the six V. sativa genotypes is presented in Table 3. It was observed that for the characteristics of the width of the leaflet (WL) and the color of the standard (CS), no morphological differentiation was shown between the genotypes, in contrast to the other thirteen characteristics where strong differentiation was recorded.
Based on the results of Table 3, a hierarchical cluster analysis was employed using the UPGMA method to examine the morphological traits and six distinct genotypes of V. sativa. The resulting clusters are depicted in Figure 1, where two dendrograms were generated—one for the genotypic varieties and another for the morphological traits. Within the genotypic varieties dendrogram, a notable separation into two distinct groups was observed. M-6900 and BK29 formed one distinct group, while a second group consisted of three subgroups. The first one was formed with BK23, the second was formed with BI65, and the third subgroup was formed with BK45 and BK27. In the dendrogram for morphological traits, a bifurcation into two primary groups occurred, encompassing eight and seven traits, respectively. Furthermore, to visually represent the values of morphological traits within the six varieties, a heatmap was constructed. This heatmap provides an insightful visualization of the variations in morphological trait values across the different genotypes. The heatmap pattern is based on the rating scale provided in Table 1.
Figure 2 depicts the different seed genotypes observed amongst the analyzed populations and they were used to record phenotypic data for 15 significant morphological traits. Figure 3 presents two plots depicting the involvement of various V. sativa genotypes in the first two components of the analysis. These visualizations were generated within the framework of principal component analysis (PCA) with the objective of reducing the dimensionality of the original variables and facilitating the identification of patterns, relationships, and variations within the dataset. In plot (a), the first two components successfully encapsulate a significant amount of information, accounting for 63.1% of the total variance in the dataset. Additionally, a high cos2 (cosine squared) value indicates a robust representation of genotypes on the principal component. Notably, M-6900, BK29, and BI65 exhibit a particularly strong representation within these two components. The accompanying bar plot illustrates the percentage contribution of each genotype to the variability observed in the first two components. M-6900 emerges as the leading contributor with a 31% contribution, followed by BK29 and BK23 in descending order. This bar plot provides a succinct representation of the relative impacts of different genotypes on the observed variability within the analyzed components.

3.2. Genetic Diversity Estimated by SCoT Markers

To assess the genetic diversity at different loci for 30 individuals from the six V. sativa populations, 11 SCoT markers were analyzed (Table S2, Supplementary Material). The allele size ranged from 250 bp at the SCoT13 loci to 4000 bp at the SCoT61, SCoT30, SCoT34, SCoT51, and SCoT70 loci (Table 4). The number of different alleles (Na) per locus were on average from 0.904 for the SCoT13 locus to 1.717 for the SCoT6 locus (Table 4). The effective alleles number (Ne) ranged from 1.225 at the SCoT13 locus to 1.496 at the SCoT66 locus (Table 4). The highest diversity (H) value was observed for the SCoT61 locus (0.384), while the SCoT13 locus showed the lowest value (0.170) (Table 4). All of the analyzed markers exhibited moderate polymorphism, indicated by the polymorphic information content (PIC) values that ranged from 0.375 (SCoT1, SCoT61, SCoT30 and SCoT15) to 0.409 (SCoT6) (Table 4).
A total of 187 loci were obtained from the 11 selected SCoT primers. Of all the loci analyzed, 55.26% were polymorphic and 44.74% were monomorphic within or between the commercial cultivars and the populations. The BK27 population had the highest number of private bands (four), followed by the rest of the V. sativa populations. The genetic diversity estimates revealed that across the studied V. sativa populations, the number of different alleles (Na) ranged from 1.316 in BK29 to 1.449 in BK45, whilst the number of effective alleles (Ne) ranged from 1.326 in BK27 to 1.425 in BK45 (Table 5). The gene diversity (GD) within the studied genetic material of V. sativa ranged from 0.242 to 0.307 and the Shannon’s information index (I) ranged from 0.287 to 0.361. Additionally, BK45 showed higher levels of genetic diversity for the Shannon’s information index (0.307) compared to commercials and to other populations. Also, BK45 exhibited the highest level of polymorphism (P = 62.03%), and BK27 exhibited the lowest (P = 50.80%) (Table 5).
According to the AMOVA analysis, 81% of the total genetic variation was attributed to differences within genotypes, and the rest (19%) was attributed to differences among them (Table 6) with Fst = 0.195, p < 0.001.
The UPGMA dendrogram, based on the genetic distances among the studied genetic materials, depicted two main clusters (Figure 4). BK45 and BK27 formed one distinct cluster, while the second one included three sub-clusters. The first one included BK29, the second included BK23, and the third included the cultivars BI-65 and M-6900.
According to the PCoA, PC1 and PC2 accounted for 41.08% and 60.77% of the total variation, respectively. The studied populations formed distinct clusters (Figure 5) which were in accordance with the UPGMA dendrogram.
The genetic differentiation (Nei’s genetic distance) [53] ranged from 0.126 (BK45 to BK23) to 0.300 (BK29 to BK27) (Table 7).
Based on Evanno’s ΔΚ [54], the optimal number of clusters was determined as K = 3. After K = 3, the results are not consistent between different runs. Thus, we conclude that K = 3, which is also what the Evanno analysis provides. Most samples from population BK45 and all samples from BK27 formed the first cluster. The second cluster included the majority of individuals from populations BK23, M-6900, and BI-65, while a further group consisted primarily of BK29 individuals (Figure 6).

3.3. Metabolomics Analysis

A seed-specific metabolite profile was obtained by employing a targeted GC/EI/MS metabolomic analysis in the six V. sativa genotypes. The metabolomics analysis revealed a significant difference among the metabolite profiles of the studied genetic material (Figure 7). In total, 84 metabolite features of V. sativa seeds were reproducibly recorded and subjected to a multivariate analysis for the discovery of trends and the corresponding biomarkers. Nevertheless, metabolites from varieties BK45 and M-6900 were differentiated from the rest. The results of OPLS-DA were confirmed by the corresponding hierarchical cluster analysis (HCA) dendrogram (Figure 8). The hierarchical tree dendrogram (Figure 8) grouped the genotypes ΒK27, ΒK23, BK29, and BI65 in one cluster, and there were two distinct clusters for genotype BK45 and M-6900. Additionally, the metabolite biomarkers contributing most to the differentiation of the analyzed genetic material were identified based on VIP values (Figure 9) and values of scaled and centered OPLS regression coefficients (CoeffCS) (Figure 10).
Eleven metabolites (Figure 10) exhibited the highest variability and were classified into two main chemical groups, organic acids and sugars. It is noteworthy that the lowest concentrations of saturated fatty acids such as palmitic and stearic acid were detected in the BI65 and M-6900 lines accordingly, whereas BK29 accumulated the highest amounts. Moreover, BK29 had the lowest content of oxalic acid, with BK45 having the highest. Finally, BK45 presented medium to low concentrations of myo-inositol, with M6900 having the lowest content of myo-inositol.

3.4. SCoT Markers Associated with Metabolites and Yield Characteristics through MRA

In Table 8 and in Supplementary Materials Table S2, additional information for the number of bands can be found.
The analysis with SCoT markers (Table 9) revealed many marker bands associated with metabolites and yield that are statistically significant (R2 > 0.5) (Supplementary Materials). More specifically, three bands were associated with asparagine and one of them (SCoT13_350) a showed very strong negative association (standardized beta coefficient = −0.987, p value < 0.001). Seven bands were associated with citric acid, five bands were associated with erythritol, and one of them (SCoT30_1500) showed a strong positive association (standardized beta coefficient = 0.761, p value < 0.001). Six bands were associated with fumaric acid, eight bands were associated with glycine, five bands were associated with l-glutamic acid, and one of them (SCoT33_646) showed a strong negative association (standardized beta coefficient = −0.646, p value < 0.001). Five bands were associated with linoleic acid and one of them (SCoT66_3000) showed a strong positive association (standardized beta coefficient = 0.748, p value < 0.001). Three bands were associated with l-lactic acid, one of them (SCoT30_900) showed a very strong positive association (standardized beta coefficient = 0.908, p value < 0.001), and another one of them (SCoT6_2000) showed a strong positive association (standardized beta coefficient = 0.616, p value < 0.001). Three bands were associated with l-phenylalanine and one of them (SCoT13_350) showed a very strong negative association (standardized beta coefficient = −0.987, p value < 0.001). Six bands were associated with l-proline, five bands were associated with malic acid, and one of them (SCoT13_350) showed a very strong negative association (standardized beta coefficient = −0.950, p value < 0.001). Five bands were associated with myo-inositol and one of them (SCoT30_1300) showed a very strong negative association (standardized beta coefficient = −0.808, p value < 0.001). Four bands were associated with myristic acid, six bands were associated with oleic acid (Z)-, and one (SCoT13_1600) of them showed a very strong positive association (standardized beta coefficient = 0.990, p value < 0.001). Five bands were associated with oxalic acid and one of them (SCoT30_1500) showed a strong positive association (standardized beta coefficient = 0.798, p value < 0.001). Six bands were associated with pantothenic acid, four bands were associated with salicylic acid, one of them (SCoT15_600) showed a strong negative association (standardized beta coefficient = −0.740, p value < 0.001) and another one of them (SCoT30_900) showed a strong positive association (standardized beta coefficient = 0.682, p value < 0.001). Five bands were associated with stearic acid and one of them (SCoT13_1600) showed a very strong positive association (standardized beta coefficient = 0.980, p value < 0.001). Two bands were associated with succinic acid and one of them (SCoT13_350) showed a very strong negative association (standardized beta coefficient = −0.845, p value < 0.001). Three bands were associated with tyrosine, one of them (SCoT30_900) showed a very strong positive association (standardized beta coefficient = 0.875, p value < 0.001) and another one of them (SCoT13_350) showed a strong negative association (standardized beta coefficient = −0.794, p value < 0.001). Seven bands were associated with β-alanine, eight bands were associated with γ-tocopherol, and one of them (SCoT30_900) showed a very strong positive association (standardized beta coefficient = −0.879, p value < 0.001). Four bands were associated with seed yield and one of them (SCoT30_1300) showed a strong negative association (standardized beta coefficient = −0.651, p value < 0.001). Finally, four bands were associated with biomass yield and one of them (SCoT30_1300) showed a strong positive association (standardized beta coefficient = 0.695, p value < 0.001).
According to the results of the SCoT marker analysis, there was a statistically significant correlation with several metabolites of V. sativa, as determined by MRA.
Additional information on alleles per trait can be found in Supplementary Materials Table S1, and information on the intensity of the association can be found in Table 9. According to all of the above, 119 bands were associated with the examined traits. From those, 20 bands have strong or very strong positive or negative associations. The most common bands with strong or very strong positive or negative associations were SCOT13_350 and SCOT30_900, associated with four traits, SCOT13_1600 and SCOT30_1300, associated with two traits, and SCOT13_350, SCOT30_1500, SCOT30_1300, SCOT15_600, SCOT30_1500, SCOT33_600, SCOT6_2000, and SCOT66_3000, associated with one trait.

4. Discussion

In the framework of attaining sustainable agriculture, legume crops such as the common vetch encounter a number of difficulties. Among the principal difficulties is the application of combined strategies to improve various agronomic and nutritional characteristics. The selection of cultivars with a high forage and/or grain yield has been the number one priority so far. Additionally, breeders have chosen cultivars with blooming durations or pod dehiscence that are tailored to certain climate conditions [54,55]. The common vetch is one of the crops that will require breeding techniques for increased tolerance and resilience in order to adapt to the increasing effects of climate change. The analysis of the genetic diversity of the existing material could be crucial to the exploitation of these genetic resources in breeding programs, particularly those that focus on the demands and effects of climate change.
Moreover, harnessing crop germplasm diversity is an economical way to improve important breeding traits, including the SPC (seed protein content) in grain legume crops. Crop genetic resources are the key reservoir for exploring high-SPC genotypes in grain legumes.
There is a lack of information regarding the genetic diversity of common vetch cultivars, particularly in Greece. Understanding the genetic variation between Greek common vetch genetic resources is essential for effectively conserving and utilizing these resources in breeding programs. The utilization of molecular markers has the potential to significantly enhance our knowledge in this regard. This study, to the best of our knowledge, is the first report on the genetic diversity of V. sativa cultivars and advanced breeding lines using SCoT markers combined with metabolomics and phenotypic analyses of their seeds.
The morphological traits are useful tools either for species identification or as selection indices in breeding programs. In particular, seed traits of Vicia spp. are very important for highlighting genetic variability and are further studied as yield components [56]. In the present study, the traits remained stable over time within each genotype and the most prominent traits were as follows: (i) area of brown ornamentation (ABO), (ii) anthocyanin coloration on the base of the stem (ACS), and (iii) brown ornamentation (BO). Furthermore, genotypes exhibited variation for specific traits. A greater degree of ABO was observed for the cultivar BK-23, while the lowest degree was for M-6900. Furthermore, BK27, BK45, BI65, and BK-23 indicated the highest values for the area of blue–black ornamentation (ABBO) and blue–black ornamentation (BBO). Three categories for 100SW were recognized. 100SW is a significant trait for plant breeders, as it plays an important role in the seed yield and in the percentage of emerged plants after sowing. Varieties with low 100SW produce more seeds/plants; however, large seeds are considered as more tolerant for plant emergence and can survive under stress conditions [57]. No genetic variation was observed for the CS of the flower (color of standard petal), where the predominant color was medium violet. It seems that violet is the most common color of the standard petal in the European varieties of Vicia sativa, as according to Grela et al. [58], a violet to purple color of the standard petal was predominant in 80% among 44 accessions of Vicia sativa from different European regions and countries. According to the PCA, a significant percentage (63.1%) of the total variation was explained by the two main components, while the contribution of each genotype in the total variation ranged from 31% (M-6900) to 5% (BK-45). Therefore, the morphological traits used herein proved rather effective in discriminating the studied genotypes and revealing the phenotypic diversity and could be suggested as quite reliable indices in breeding programs.
The genetic analysis of the common vetch is mainly focused on SSR molecular markers [5,32,55], EST-SSR [21], RAPDs [59], and AFLPs [60]. According to the results of the present study, 55.2% of the alleles were polymorphic. This percentage is lower than that of a combination of SRAP and ISSR markers (82.01%) [12], RAPD markers (94%) [59], and URPs markers (73.5%) [61]. However, the experiment conducted by Chai et al. [6] revealed substantial genetic variation in the common vetch populations based on the DNA products amplified from the five chosen SCoT primers, with 100% of polymorphic loci. These findings indicate that differences in the genetic information of different common vetch populations could be attributed not only to the corresponding sampling size and the geographical origin of the studied populations but also to the careful selection of the most informative primers. Nevertheless, the authors highlighted that when it comes to molecular-assisted breeding, SCoT markers are more advantageous than other molecular markers like SSR, AFLP, and SSAP because of their ease of use, cost affordability, and abundance of polymorphisms.
The same high results were reported for other species of the genus Vicia for SSR markers (99%) [62]. A high proportion (81%) of SCoT genetic variation was observed. Similarly, de la Rosa et al. [55] showed that most of the SSR genetic diversity was recorded within 545 accessions of V. sativa all over the world. The common vetch, as an annual forage legume, usually undergoes self-pollination. Following population genetics principles for species with distinct breeding systems, one would anticipate a relatively abundant genetic diversity within the common vetch species. This diversity is likely attributed to the trait of strictly closed pollination in the common vetch [6]. According to Sun et al. [63], even if V. sativa is being characterized as a strictly self-pollinated plant, Gritton and Wierzbicka [64] reported findings that reveal that various Vicia species originating from the same source were clustered together, suggesting the possibility that Vicia may also undergo cross-pollination. Different factors such as mating system, gene flow, population size, selection, etc., influence the genetic diversity flow between populations, thus reducing the genetic variation between populations [20]. On the other hand, the fact that it is an annual plant results in higher genetic variation within the population.
According to the UPGMA cluster analysis and PCoA, the studied genetic materials were genetically distinguishable, especially the populations BK45 and BK27. According to the UPGMA cluster analysis and PCoA, the population BK23 showed a high genetic similarity to commercial varieties (M-6900 and BI-65), which is a finding that is also supported by the Nei’s genetic distance values. Additionally, these findings are in accordance with the STRUCTURE analysis. According to Cil and Tiryaki [12], cross-pollination within species may provoke/increase genetic similarities between lines and cultivars.
The average PIC value of SCoT markers in the present study was 0.384, indicating that most of the loci have intermediate diversity (Table 4). Similar results, with intermediate to high diversity, are reported in Raveendar et al.’s study [65], with an average PIC value = 0.50 using SSR molecular markers. Similar results were also obtained in Chung et al.’ study [5], with an average PIC value = 0.55, and Sun et al.’s study [63], with an average PIC value = 0.903; these authors also used SSR molecular markers. SSR markers exhibit greater polymorphism, higher resolution, and superior accuracy compared to dominant markers, given their status as co-dominant markers. Those differences in the levels of polymorphism can be attributed to the variety of germplasm that was analyzed, as well as the impact of marker specificity on the process of polymorphism [26]. Also, our findings are consistent with diversity studies conducted on other germplasm collections using various molecular markers, demonstrating the challenge of comparing results across markers and varying levels of polymorphism.
A cost-effective method of enhancing significant breeding characteristics, such as the seed protein content in grain legume crops, involves utilizing crop germplasm variability and investigating a wealth of genetic resources [66]. The metabolomic analysis that was carried out in both populations and commercial cultivars unraveled desirable characteristics in some genotypes with a particular interest for future breeding programs. The hierarchical tree derived from the metabolic profile of the six genotypes clearly separates M-6900 and BK45 from the others and produces slightly different clusters compared to the trees originated from morphological and genotypic data.
Specifically, in the six genotypes of V. sativa that were investigated, 89 metabolites from several typical plant natural product classes were annotated by the application of UPLC-MS technology. The seeds contained two main types of compounds: carbohydrates and amino acids. The quantitative variations among these primary classes were most related to genotypic discrimination. According to a study on the metabolome-based seed categorization of sixteen Vicia species, the distinction between varieties was mostly influenced by the quantitative variations in flavonoids and fatty acids [33].
Numerous favorable traits related to seed quality, including a high concentration of sugars, polyols, amino acids, and derivatives of inositol, are present in the BK45 population. Moreover, all these compounds serve as osmolytes and protect plants against several abiotic stressors [67].
More specifically, erythritol, a sugar alcohol with a small molecular weight, is highly preferable in food manufacturing because it prevents gastrointestinal disturbances [68]. As these compounds are indicators of seed quality and resistance to unfavorable environmental factors, population BK45 can have a dual role, producing both highly nutritional and resilient plants.
Moreover, population BK27 exhibited the most desirable fatty acid composition, as it contained the highest amount of unsaturated fatty acids (oleic and linolenic acid). Regarding the two commercial varieties, both had similar metabolomic profiles; however, variety M6900 exhibited higher levels of sugars and polyols compared to ΒΙ-65.
As we have mentioned in previous studies regarding the metabolomic profile of legumes that are mainly used for animal feed [27,38], high-effective metabolite characteristics are crucial for biomarker-assisted breeding, and by enabling a selection from earlier generations, they might speed up the process. It is also believed that metabolites serve as the link between the phenome and the DNA. Thus, studying both the phenotypic and metabolic characteristics throughout the biological cycle could provide a better understanding of the examined crop germplasm and its potential [69].
Furthermore, the MRA method associated molecular markers with agronomic traits or metabolites and has provided insights into identifying superior genotypes, in agreement with previous studies [51,52,70,71]. Many markers linked to phenotypic or metabolic features were found through MRA analyses using SCoT markers that had a positive or negative statistically significant correlation (R2 > 0.5). Most of the alleles found using SCoT markers had a moderate correlation with the agronomic/metabolite traits. However, the SCoT markers found in this work that were positively linked to the main metabolites contributing to yield, a high nutritional value (i.e., unsaturated fatty acids, amino acids and organic acids), as well as plant tolerance to harsh environments, can be utilized in breeding programs for QTL and marker-assisted selection (MAS). Also, it was discovered that several markers were connected to many common vetch traits. The related QTL may have a pleiotropic effect on various traits, which could explain the connection. Furthermore, a single marker exhibiting a connection that would be reflected in correlations between such traits could result from tightly connected QTLs impacting distinct qualities [72]. For example, SCoT30_900 had a very strong positive correlation with several metabolites of agronomic importance such as tocopherol, l-lactic acid, salicylic acid, and tyrosine, which can serve as antioxidants, thus ameliorating the seed quality and enhancing the plant’s resilience [73,74]. Moreover, excluding vetch cultivars that possess alleles that are negatively linked with the favorable agronomic/metabolic properties is extremely helpful in pre-breeding screening programs. For instance, SCoT13_350 had a very strong negative correlation with several amino acids (asparagine, l-phenylalanine) and metabolites that have medicinal and/or detoxifying qualities (i.e., succinic acid and malic acid) [75,76].
Finally, SCoT30_1300, which has a strong negative correlation to seed yield but a strong positive correlation to biomass yield, can be very useful in selecting varieties utilized for high biomass production.
This work could improve the conservation and management of the pertinent genetic resources by demonstrating the significance of using the phenotypic profile, metabolites, and DNA markers in the assessment, cultivation, and breeding of the common vetch.

5. Conclusions

In this study, four populations provided by the company AGROLAND S.A., and two commercial varieties developed by the Institute of Industrial and Forage Crops, were subjected to a combined phenotypic, genetic, and metabolomic profile analysis, in order to be utilized for targeted breeding strategies aimed at producing improved varieties.
According to this study, BK45 is the most promising line to be further exploited due to its high genetic diversity and the production of seeds of elevated nutritional value. Additionally, commercial varieties (M6900 and BI65) can both be employed in breeding programs due to their high genetic and metabolomic diversity. The genetic, agronomic, and metabolomic diversity of the populations can help address future challenges, such as adapting to changing climatic conditions. Moreover, our goal is to further exploit our knowledge on the existence of desirable metabolites by utilizing conventional breeding techniques in conjunction with their association with DNA markers, or utilizing them as functional biomarkers, which are a reliable, precise, and user-friendly breeding tool. However, it is advised to combine genetic, morphological, and metabolic data through the MRA method for future pre-selection schemes and the incorporation of selected genetic resources and favorable alleles into breeding programs.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/app14209272/s1, Table S1: Alleles per trait; Table S2: Number of bands; Figure S1. Agarose gel SCoT 1_61; Figure S2. Agarose gel SCoT 30; Figure S3. Agarose gel SCoT 66; Figure S4. Agarose gel SCoT 33; Figure S5. Agarose gel SCoT 34; Figure S6. Agarose gel SCoT 13_15; Figure S7. Agarose gel SCoT 70; Figure S8. Agarose gel SCoT 51; Figure S9. Agarose gel SCoT 6.

Author Contributions

Conceptualization: E.T. (Eleni Tani), E.M.A., D.V., P.M. and I.G.; methodology: E.A., E.S., E.-A.P., C.P., E.T. (Eleni Tani), E.T. (Evangelia Trigka), N.T. and E.P.; validation: all; formal analysis and investigation: all; writing—original draft preparation: all; writing—review and editing: all; funding acquisition: E.T. (Eleni Tani), E.M.A., P.M., D.V. and I.G.; resources: E.T. (Eleni Tani), E.M.A., P.M. and D.V.; supervision: P.M., I.G., K.A.A., E.M.A., E.T. (Eleni Tani) and D.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research has been co-financed by the European Regional Development Fund of the European Union and Greek national funds through the Operational Program Competitiveness, Entrepreneurship and Innovation, under the call RESEARCH–CREATE–INNOVATE (project code: T1EDK-04448).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hanelt, P.; Mettin, D. Biosystematics of the Genus Vicia L. (Leguminosae). Annu. Rev. Ecol. Syst. 1989, 20, 199–223. [Google Scholar] [CrossRef]
  2. Kartal, G.K.; Senbek, G.; Karaca, M.; Acikgoz, E. Hybridization studies in Vicia sativa complex. Euphytica 2020, 216, 29. [Google Scholar] [CrossRef]
  3. Sproor, W. Zohary D, Hopf M. 2000. Domestication of plants in the Old World. 3rd edn. 316pp. New York: Oxford University Press. £19.95 (softback). Ann. Bot. 2001, 88, 666. [Google Scholar] [CrossRef]
  4. Maxted, N.; Bennett, S.J. (Eds.) Plant Genetic Resources of Legumes in the Mediterranean; Current Plant Science and Biotechnology in Agriculture; Springer: Dordrecht, The Netherlands, 2001; Volume 39, ISBN 978-90-481-5613-9. [Google Scholar]
  5. Chung, J.W.; Kim, T.S.; Suresh, S.; Lee, S.Y.; Cho, G.T. Development of 65 novel polymorphic cDNA-SSR markers in common vetch (Vicia sativa subsp. sativa) using next generation sequencing. Molecules 2013, 18, 8376–8392. [Google Scholar] [CrossRef]
  6. Chai, X.; Dong, R.; Liu, W.; Wang, Y.; Liu, Z. Optimizing Sample Size to Assess the Genetic Diversity in Common Vetch (Vicia sativa L.) Populations Using Start Codon Targeted (SCoT) Markers. Molecules 2017, 22, 567. [Google Scholar] [CrossRef]
  7. Parissi, Z.M.; Papaioannou, A.; Abraham, E.M.; Kyriazopoulos, A.P.; Sklavou, P.; Tsiouvaras, C.N. Influence of combined grazing by wild boar and small ruminant on soil and plant nutrient contents in a coppice oak forest. J. Plant Nutr. Soil Sci. 2014, 177, 783–791. [Google Scholar] [CrossRef]
  8. Myrtsi, E.D.; Vlachostergios, D.N.; Petsoulas, C.; Evergetis, E.; Koulocheri, S.D.; Haroutounian, S.A. Citation: Myrtsi, E An Interdisciplinary Assessment of Biochemical and Antioxidant Attributes of Six Greek Vicia sativa L. Varieties. Plants 2023, 12, 2807. [Google Scholar] [CrossRef]
  9. Huang, Y.F.; Gao, X.L.; Nan, Z.B.; Zhang, Z.X. Potential value of the common vetch (Vicia sativa L.) as an animal feedstuff: A review. J. Anim. Physiol. Anim. Nutr. 2017, 101, 807–823. [Google Scholar] [CrossRef]
  10. Dalias, P.; Neocleous, D. Comparative Analysis of the Nitrogen Effect of Common Agricultural Practices and Rotation Systems in a Rainfed Mediterranean Environment. Plants 2017, 6, 61. [Google Scholar] [CrossRef]
  11. Lithourgidis, A.S.; Dordas, C.A.; Damalas, C.A.; Vlachostergios, D.N. Annual intercrops: An alternative pathway for sustainable agriculture. AJCS 2011, 5, 396–410. [Google Scholar]
  12. Cil, A.; Tiryaki, I. Sequence-related amplified polymorphism and inter-simple sequence repeat marker-based genetic diversity and nuclear DNA content variation in common vetch (Vicia sativa L.). Plant Genet. Resour. Characterisation Util. 2016, 14, 183–191. [Google Scholar] [CrossRef]
  13. FAOSTAT. Production Statistics of the Food Agriculture Organization of The United States. Available online: http://www.fao.org/faostat/en/#data/QA (accessed on 3 June 2024).
  14. Rešetnik, I.; Baričevič, D.; Rusu, D.B.; Carović-Stanko, K.; Chatzopoulou, P.; Dajić-Stevanović, Z.; Gonceariuc, M.; Grdiša, M.; Greguraš, D.; Ibraliu, A.; et al. Genetic Diversity and Demographic History of Wild and Cultivated/Naturalised Plant Populations: Evidence from Dalmatian Sage (Salvia officinalis L., Lamiaceae). PLoS ONE 2016, 11, e0159545. [Google Scholar] [CrossRef] [PubMed]
  15. Sarrou, E.; Ganopoulos, I.; Xanthopoulou, A.; Masuero, D.; Martens, S.; Madesis, P.; Mavromatis, A.; Chatzopoulou, P. Genetic diversity and metabolic profile of Salvia officinalis populations: Implications for advanced breeding strategies. Planta 2017, 246, 201–215. [Google Scholar] [CrossRef] [PubMed]
  16. Riedelsheimer, C.; Lisec, J.; Czedik-Eysenberg, A.; Sulpice, R.; Flis, A.; Grieder, C.; Altmann, T.; Stitt, M.; Willmitzer, L.; Melchinger, A.E. Genome-wide association mapping of leaf metabolic profiles for dissecting complex traits in maize. Proc. Natl. Acad. Sci. USA 2012, 109, 8872–8877. [Google Scholar] [CrossRef]
  17. Riedelsheimer, C.; Brotman, Y.; Méret, M.; Melchinger, A.E.; Willmitzer, L. The maize leaf lipidome shows multilevel genetic control and high predictive value for agronomic traits. Sci. Rep. 2013, 3, 2479. [Google Scholar] [CrossRef]
  18. Arias, M.; Hernandez, M.; Remondegui, N.; Huvenaars, K.; Dijk, P.V.; Ritter, E. First genetic linkage map of Taraxacum koksaghyz Rodin based on AFLP, SSR, COS and EST-SSR markers. Sci. Rep. 2016, 6, 31031. [Google Scholar] [CrossRef]
  19. Cesare, M.D.; Hodkinson, T.R.; Barth, S. Chloroplast DNA markers (cpSSRs, SNPs) for Miscanthus, Saccharum and related grasses (Panicoideae, Poaceae). Mol. Breed. 2010, 26, 539–544. [Google Scholar] [CrossRef]
  20. Madesis, P.; Abraham, E.M.; Kalivas, A.; Ganopoulos, I.; Tsaftaris, A. Genetic diversity and structure of natural Dactylis glomerata L. populations revealed by morphological and microsatellite-based (SSR/ISSR) markers. Genet. Mol. Res. 2014, 13, 4226–4240. [Google Scholar] [CrossRef]
  21. Liu, Z.; Chen, T.; Ma, L.; Zhao, Z.; Zhao, P.X.; Nan, Z.; Wang, Y. Global Transcriptome Sequencing Using the Illumina Platform and the Development of EST-SSR Markers in Autotetraploid Alfalfa. PLoS ONE 2013, 8, e83549. [Google Scholar] [CrossRef]
  22. Zhou, Q.; Luo, D.; Ma, L.; Xie, W.; Wang, Y.; Wang, Y.; Liu, Z. Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing. Sci. Rep. 2016, 6, 20549. [Google Scholar] [CrossRef]
  23. Bhattacharyya, P.; Kumaria, S.; Kumar, S.; Tandon, P. Start Codon Targeted (SCoT) marker reveals genetic diversity of Dendrobium nobile Lindl., an endangered medicinal orchid species. Gene 2013, 529, 21–26. [Google Scholar] [CrossRef] [PubMed]
  24. Collard, B.C.Y.; Mackill, D.J. Start Codon Targeted (SCoT) Polymorphism: A Simple, Novel DNA Marker Technique for Generating Gene-Targeted Markers in Plants. Plant Mol. Biol. Report. 2009, 27, 86–93. [Google Scholar] [CrossRef]
  25. Pakseresht, F.; Talebi, R.; Karami, E. Comparative assessment of ISSR, DAMD and SCoT markers for evaluation of genetic diversity and conservation of landrace chickpea (Cicer arietinum L.) genotypes collected from north-west of Iran. Physiol. Mol. Biol. Plants 2013, 19, 563–574. [Google Scholar] [CrossRef]
  26. Avramidou, E.; Ganopoulos, I.; Mylona, P.; Abraham, E.M.; Nianiou-Obeidat, I.; Osathanunkul, M.; Madesis, P. Comparative Analysis of the Genetic Diversity of Faba Bean (Vicia faba L.). Sustainability 2023, 15, 1016. [Google Scholar] [CrossRef]
  27. Avramidou, E.; Sarri, E.; Ganopoulos, I.; Madesis, P.; Kougiteas, L.; Papadopoulou, E.A.; Aliferis, K.A.; Abraham, E.M.; Tani, E. Genetic and Metabolite Variability among Commercial Varieties and Advanced Lines of Vicia faba L. Plants 2023, 12, 908. [Google Scholar] [CrossRef] [PubMed]
  28. Soliman, A.A.; Mousa, M.I.; Mosalam, A.M.; Ghareeb, Z.E.; Ibrahim, S.D.; Rehan, M.; Yu, H.; He, Y. The Potential Genetic Effect for Yield and Foliar Disease Resistance in Faba Bean (Vicia faba L.) Assessed via Morphological and SCoT Markers. Plants 2023, 12, 3645. [Google Scholar] [CrossRef]
  29. Hromadová, Z.; Gálová, Z.; Mikolášová, L.; Balážová, Ž.; Vivodík, M.; Chňapek, M.; Chňapek, C. Efficiency of RAPD and SCoT Markers in the Genetic Diversity Assessment of the Common Bean. Plants 2023, 12, 2763. [Google Scholar] [CrossRef]
  30. Potokina, E.K.; Aleksandrova, T.G. Genetic singularity coefficients of common vetch Vicia sativa L. accessions determined with molecular markers. Russ. J. Genet. 2008, 44, 1309–1316. [Google Scholar] [CrossRef]
  31. Ma, L.; Wang, X.; Yan, M.; Liu, F.; Zhang, S.; Wang, X. Genome survey sequencing of common vetch (Vicia sativa L.) and genetic diversity analysis of Chinese germplasm with genomic SSR markers. Mol. Biol. Rep. 2022, 49, 313–320. [Google Scholar] [CrossRef]
  32. Chung, J.W.; Kim, T.S.; Sundan, S.; Lee, G.A.; Park, J.H.; Cho, G.T.; Lee, H.S.; Lee, J.Y.; Lee, M.C.; Baek, H.J.; et al. New cDNA-SSR markers in the narrow-leaved vetch (Vicia sativa subsp. nigra) using 454 pyrosequencing. Mol. Breed. 2014, 33, 749–754. [Google Scholar] [CrossRef]
  33. Fayek, N.M.; Mekky, R.H.; Dias, C.N.; Kropf, M.; Heiss, A.G.; Wessjohann, L.A.; Farag, M.A. UPLC-MS Metabolome-Based Seed Classification of 16 Vicia Species: A Prospect for Phyto-Equivalency and Chemotaxonomy of Different Accessions. J. Agric. Food Chem. 2021, 69, 5252–5266. [Google Scholar] [CrossRef] [PubMed]
  34. Geilfus, C.M.; Niehaus, K.; Gödde, V.; Hasler, M.; Zörb, C.; Gorzolka, K.; Jezek, M.; Senbayram, M.; Ludwig-Müller, J.; Mühling, K.H. Fast responses of metabolites in Vicia faba L. to moderate NaCl stress. Plant Physiol. Biochem. 2015, 92, 19–29. [Google Scholar] [CrossRef] [PubMed]
  35. Zhou, Q.; Cui, Y.; Dong, S.; Luo, D.; Fang, L.; Shi, Z.; Liu, W.; Wang, Z.; Nan, Z.; Liu, Z. Integrative physiological, transcriptome, and metabolome analyses reveal the associated genes and metabolites involved in cold stress response in common vetch (Vicia sativa L.). Food Energy Secur. 2023, 12, 484. [Google Scholar] [CrossRef]
  36. Ghomi, K.; Rabiei, B.; Sabouri, H.; Alamdari, E.G. Association analysis, genetic diversity and population structure of barley (Hordeum vulgare L.) under heat stress conditions using SSR and ISSR markers linked to primary and secondary metabolites. Mol. Biol. Rep. 2021, 48, 6673–6694. [Google Scholar] [CrossRef] [PubMed]
  37. Doyle, J.J.; Doyle, J.L. Isolation of Plant DNA from Fresh Tissue. Focus 1990, 12, 12–15. [Google Scholar]
  38. Mavromatis, A.; Nianiou-Obeidat, I.; Polidoros, A.; Parissi, Z.; Tani, E.; Irakli, M.; Aliferis, K.A.; Zafeiriou, I.; Mylona, P.V.; Sarri, E.; et al. Characterization of Lupin Cultivars Based on Phenotypical, Molecular and Metabolomic Analyses. Agronomy 2023, 13, 370. [Google Scholar] [CrossRef]
  39. Papadopoulou, E.-A.; Angelis, A.; Skaltsounis, A.-L.; Aliferis, K.A. GC/EI/MS and 1H NMR Metabolomics Reveal the Effect of an Olive Tree Endophytic Bacillus sp. Lipopeptide Extract on the Metabolism of Colletotrichum acutatum. Metabolites 2023, 13, 462. [Google Scholar] [CrossRef]
  40. Tsugawa, H.; Cajka, T.; Kind, T.; Ma, Y.; Higgins, B.; Ikeda, K.; Kanazawa, M.; VanderGheynst, J.; Fiehn, O.; Arita, M. MS-DIAL: Data-independent MS/MS deconvolution for comprehensive metabolome analysis. Nat. Methods 2015, 12, 523–526. [Google Scholar] [CrossRef]
  41. Kostopoulou, S.; Ntatsi, G.; Arapis, G.; Aliferis, K.A. Assessment of the effects of metribuzin, glyphosate, and their mixtures on the metabolism of the model plant Lemna minor L. applying metabolomics. Chemosphere 2020, 239, 124582. [Google Scholar] [CrossRef]
  42. Oksanen, J.; Blanchet, F.G.; Kindt, R.; Legendre, P.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; Stevens, M.H.H.; Wagner, H. Vegan: Community Ecology Package. R Package Version 2.2-0. 2011. Available online: http://CRAN.Rproject.org/package=vegan (accessed on 3 June 2024).
  43. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinform. Appl. 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  44. Excoffier, L.; Smouse, P.E.; Quattro, J.M. Analysis of Molecular Variance Inferred From Metric Distances Among DNA Haplotypes: Application to Human Mitochondrial DNA Restriction Data. Genetics 1992, 131, 479–491. [Google Scholar] [CrossRef] [PubMed]
  45. Sneath, R.R.; Sokal, P.H.A. Numerical Taxonomy: The Principles and Practice of Numerical Classification; W H Freeman & Co: San Francisco, CA, USA, 1973. [Google Scholar]
  46. Amiryousefi, A.; Hyvönen, J.; Poczai, P. iMEC: Online Marker Efficiency Calculator. Appl. Plant Sci. 2018, 6, 4–7. [Google Scholar] [CrossRef] [PubMed]
  47. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Am. J. Hum. Genet. 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  48. Falush, D.; Stephens, M.; Pritchard, J.K. Inference of Population Structure Using Multilocus Genotype Data: Linked Loci and Correlated Allele Frequencies. Genetics 2003, 164, 1567–1587. [Google Scholar] [CrossRef] [PubMed]
  49. Pina-Martins, F.; Silva, D.N.; Fino, J.; Paulo, O.S. Structure_threader: An improved method for automation and parallelization of programs STRUCTURE, FASTSTRUCTURE and MavericK on multicore CPU systems. Mol. Ecol. Resour. 2017, 17, e268–e274. [Google Scholar] [CrossRef]
  50. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Ro, M.A.Y. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  51. Ganopoulos, I.; Argiriou, A.; Tsaftaris, A. Adulterations in Basmati rice detected quantitatively by combined use of microsatellite and fragrance typing with High Resolution Melting (HRM) analysis. Food Chem. 2011, 129, 652–659. [Google Scholar] [CrossRef]
  52. Karapetsi, L.; Pantelidis, G.; Pratsinakis, E.D.; Drogoudi, P.; Madesis, P. Fruit Quality Traits and Genotypic Characterization in a Pomegranate Ex Situ (Punica granatum L.) Collection in Greece. Agriculture 2021, 11, 482. [Google Scholar] [CrossRef]
  53. Ne, M. Estimation of Average Heterozygosity and genetic distance from a small number of individuals. Genetics 1978, 89, 583–590. [Google Scholar] [CrossRef]
  54. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
  55. Rosa, L.D.L.; Zambrana, E.; Ramirez-Parra, E. Molecular bases for drought tolerance in common vetch: Designing new molecular breeding tools. BMC Plant Biol. 2020, 20, 1–18. [Google Scholar] [CrossRef]
  56. Javadi, H.; Salehi Shanjani, P.; Falah Hoseini, L.; Ramazani Yeganeh, M. Evaluación de rasgos morfológicos y de rendimiento en las poblaciones de Vicia spp. Rev. Mex. Cienc. Pecu. 2022, 13, 846–865. [Google Scholar] [CrossRef]
  57. Dong, R.; Jahufer, M.; Dong, D.; Wang, Y.; Liu, Z. Characterisation of the morphological variation for seed traits among 537 germplasm accessions of common vetch (Vicia sativa L.) using digital image analysis. N. Z. J. Agric. Res. 2016, 59, 422–435. [Google Scholar] [CrossRef]
  58. Grela, E.R.; Samolińska, W.; Rybiński, W.; Kiczorowska, B.; Kowalczuk-Vasilev, E.; Matras, J.; Wesołowska, S. Nutritional and Anti-Nutritional Factors in Vicia sativa L. Seeds and the Variability of Phenotypic and Morphological Characteristics of Some Vetch Accessions Cultivated in European Countries. Animals 2020, 11, 44. [Google Scholar] [CrossRef]
  59. Potokina, E.; Vaughan, D.A.; Eggi, E.E.; Tomooka, N. Population diversity of the Vicia sativa agg. (Fabaceae) in the flora of the former USSR deduced from RAPD and seed protein analyses. Genet. Resour. Crop Evol. 2000, 47, 171–183. [Google Scholar] [CrossRef]
  60. Potokina, E.; Blattner, F.R.; Alexandrova, T.; Bachmann, K. AFLP diversity in the common vetch (Vicia sativa L.) on the world scale. Theor. Appl. Genet. 2002, 105, 58–67. [Google Scholar] [CrossRef]
  61. Topu, M.; Tiryaki, İ. Diversity Analysis of Common Vetch (Vicia Sativa L.) Lines and Cultivars Using Pairwise Combinations of Universal Rice Primers. Int. J. Life Sci. Biotechnol. 2022, 5, 504–518. [Google Scholar] [CrossRef]
  62. Göl, Ş.; Doğanlar, S.; Frary, A. Relationship between geographical origin, seed size and genetic diversity in faba bean (Vicia faba L.) as revealed by SSR markers. Mol. Genet. Genom. 2017, 292, 991–999. [Google Scholar] [CrossRef]
  63. Sun, D.S.; Wesche, K.; Chen, D.D.; Zhang, S.H.; Wu, G.L.; Du, G.Z.; Comerford, N.B. Grazing depresses soil carbon storage through changing plant biomass and composition in a Tibetan alpine meadow. Plant Soil Environ. 2011, 57, 271–278. [Google Scholar] [CrossRef]
  64. Gritton, E.T.; Wierzbicka, B. An embryological study of a Pisum sativum x Vicia faba CROSS. Euphytica 1975, 24, 2777284. [Google Scholar] [CrossRef]
  65. Raveendar, S.; Lee, G.A.; Jeon, Y.A.; Lee, Y.J.; Lee, J.R.; Cho, G.T.; Cho, J.H.; Park, J.H.; Ma, K.H.; Chung, J.W. Cross-amplification of Vicia sativa subsp. sativa microsatellites across 22 other Vicia species. Molecules 2015, 20, 1543–1550. [Google Scholar] [CrossRef] [PubMed]
  66. Boukar, O.; Massawe, F.; Muranaka, S.; Franco, J.; Maziya-Dixon, B.; Singh, B.; Fatokun, C. Evaluation of cowpea germplasm lines for protein and mineral concentrations in grains. Plant Genet. Resour. Characterisation Util. 2011, 9, 515–522. [Google Scholar] [CrossRef]
  67. Solovyeva, A.E.; Shelenga, T.V.; Shavarda, A.L.; Burlyaeva, M.O. Comparative analysis of wild and cultivated Lathyrus L. species to assess their content of sugars, polyols, free fatty acids, and phytosterols. Vavilovskii Zhurnal Genet. I Sel. 2020, 24, 730–737. [Google Scholar] [CrossRef] [PubMed]
  68. Mäkinen, O.E.; Wanhalinna, V.; Zannini, E.; Arendt, E.K. Foods for Special Dietary Needs: Non-dairy Plant-based Milk Substitutes and Fermented Dairy-type Products. Crit. Rev. Food Sci. Nutr. 2016, 56, 339–349. [Google Scholar] [CrossRef] [PubMed]
  69. Shi, T.; Zhu, A.; Jia, J.; Hu, X.; Chen, J.; Liu, W.; Ren, X.; Sun, D.; Fernie, A.R.; Cui, F.; et al. Metabolomics analysis and metabolite-agronomic trait associations using kernels of wheat (Triticum aestivum) recombinant inbred lines. Plant J. 2020, 103, 279–292. [Google Scholar] [CrossRef]
  70. Omri, A.; Abdelhamid, S.; Benincasa, C.; Araouki, A.; Ayadi, M.; Gharsallaoui, M.; Gouiaa, M. Genetic diversity and association of molecular markers with biochemical traits in Tunisian olive cultivars. Genet. Resour. Crop. Evol. 2021, 68, 1181–1197. [Google Scholar] [CrossRef]
  71. Khadivi, A.; Mashhadi, Z.; Hosseini, A. Relationship between molecular markers and important fruit-related traits in almond (Prunus dulcis [Mill.] D.A. Webb syn. P. amygdalus Batsch) as revealed using multiple regression analysis (MRA). Food Sci. Nutr. 2023, 11, 7311–7319. [Google Scholar] [CrossRef]
  72. Khadivi-Khub, A. Regression association analysis of fruit traits with molecular markers in cherries. Plant Syst. Evol. 2014, 300, 1163–1173. [Google Scholar] [CrossRef]
  73. Simpson, J.P.; Olson, J.; Dilkes, B.; Chapple, C. Identification of the Tyrosine- and Phenylalanine-Derived Soluble Metabolomes of Sorghum. Front. Plant Sci. 2021, 12, 714164. [Google Scholar] [CrossRef]
  74. Fritsche, S.; Wang, X.; Jung, C. Recent Advances in our Understanding of Tocopherol Biosynthesis in Plants: An Overview of Key Genes, Functions, and Breeding of Vitamin E Improved Crops. Antioxidants 2017, 6, 99. [Google Scholar] [CrossRef]
  75. Gai, W.; Yang, F.; Yuan, L.; Ul Haq, S.; Wang, Y.; Wang, Y.; Shang, L.; Li, F.; Ge, P.; Dong, H.; et al. Multiple-model GWAS identifies optimal allelic combinations of quantitative trait loci for malic acid in tomato. Hortic. Res. 2023, 10, uhad021. [Google Scholar] [CrossRef] [PubMed]
  76. Zhang, X.; Zhang, F.; Li, Z.; Yang, Z.; Hao, L.; Zhao, H. Comparative Transcriptome Analysis of Cynanchum thesioides Under Drought Stress Reveals Candidate Genes Involved in Succinic Acid Biosynthesis. J. Plant Biol. 2023, 66, 283–295. [Google Scholar] [CrossRef]
Figure 1. Heatmap generated for each of the six V. sativa genotypes, illustrating 15 morphological traits. The color-coded scale indicates increases (in blue) and reductions (in yellow red). Hierarchical cluster analysis using the UPGMA method was applied to both morphological traits and genotypes, and the resulting dendrograms visually exhibit their relationships (Abbreviations in Table 1).
Figure 1. Heatmap generated for each of the six V. sativa genotypes, illustrating 15 morphological traits. The color-coded scale indicates increases (in blue) and reductions (in yellow red). Hierarchical cluster analysis using the UPGMA method was applied to both morphological traits and genotypes, and the resulting dendrograms visually exhibit their relationships (Abbreviations in Table 1).
Applsci 14 09272 g001
Figure 2. Seed traits as analytically described in Table 2 from the six V. sativa genotypes studied ((A): BK45, (B): BK27, (C): BK23, (D): BK29, (E): BI65, (F): M-6900).
Figure 2. Seed traits as analytically described in Table 2 from the six V. sativa genotypes studied ((A): BK45, (B): BK27, (C): BK23, (D): BK29, (E): BI65, (F): M-6900).
Applsci 14 09272 g002
Figure 3. PCA results visualized graphically. (a) A plot with the percentage of the variation explained by the first two principal components (63.1%) and the contribution of the varieties to each dimension. (b) A bar plot depicting the contribution of the V. sativa varieties to the first two principal components.
Figure 3. PCA results visualized graphically. (a) A plot with the percentage of the variation explained by the first two principal components (63.1%) and the contribution of the varieties to each dimension. (b) A bar plot depicting the contribution of the V. sativa varieties to the first two principal components.
Applsci 14 09272 g003
Figure 4. UPGMA dendrogram based on Nei’s genetic distance [53] of V. sativa populations of advanced lines (BK45, BK29, BK23, BK27) and commercial cultivars (M-6900, BI-65).
Figure 4. UPGMA dendrogram based on Nei’s genetic distance [53] of V. sativa populations of advanced lines (BK45, BK29, BK23, BK27) and commercial cultivars (M-6900, BI-65).
Applsci 14 09272 g004
Figure 5. Principal coordinates analysis of the molecular genetic diversity observed among 6 V. sativa where the first two coordinates explain 60.77% of the total variability.
Figure 5. Principal coordinates analysis of the molecular genetic diversity observed among 6 V. sativa where the first two coordinates explain 60.77% of the total variability.
Applsci 14 09272 g005
Figure 6. STRUCTURE plots for K = 1, K = 2, and K = 3 for SCoT molecular markers and six genetic materials of V. sativa. Each vertical bar represents a single individual (n = 30) and the probability of its membership in four clusters. Advanced lines (1 = BK4, 2 = BK29, 3 = BK23, 4 = BK27) and commercial cultivars (5 = M-6900, 6 = BI-65). Graphs (AD). DeltaK = mean [IL″(K)]/sd[L(K)]. DK values for different K values calculated using the Evanno method. Number of clusters (K). K = 3 was determined for all three analyses according to the ΔK statistics.
Figure 6. STRUCTURE plots for K = 1, K = 2, and K = 3 for SCoT molecular markers and six genetic materials of V. sativa. Each vertical bar represents a single individual (n = 30) and the probability of its membership in four clusters. Advanced lines (1 = BK4, 2 = BK29, 3 = BK23, 4 = BK27) and commercial cultivars (5 = M-6900, 6 = BI-65). Graphs (AD). DeltaK = mean [IL″(K)]/sd[L(K)]. DK values for different K values calculated using the Evanno method. Number of clusters (K). K = 3 was determined for all three analyses according to the ΔK statistics.
Applsci 14 09272 g006
Figure 7. Orthogonal partial least squares discriminant analysis (OPLS-DA) PC1/PC2 score plot for the analyzed GC/EI/MS metabolite profiles of V. sativa genotypes. The ellipse represents the Hotelling’s T2 (1 = BK45, 2 = BK29, 3 = BK23, 4 = BK27, 5 = M-6900, 7 = BI-65).
Figure 7. Orthogonal partial least squares discriminant analysis (OPLS-DA) PC1/PC2 score plot for the analyzed GC/EI/MS metabolite profiles of V. sativa genotypes. The ellipse represents the Hotelling’s T2 (1 = BK45, 2 = BK29, 3 = BK23, 4 = BK27, 5 = M-6900, 7 = BI-65).
Applsci 14 09272 g007
Figure 8. Hierarchical tree diagram of the GC/EI/MS metabolite profiles of V. sativa populations using Ward’s method (1 = BK4, 2 = BK29, 3 = BK23, 4 = BK27, 5 = M-6900, 7 = BI-65).
Figure 8. Hierarchical tree diagram of the GC/EI/MS metabolite profiles of V. sativa populations using Ward’s method (1 = BK4, 2 = BK29, 3 = BK23, 4 = BK27, 5 = M-6900, 7 = BI-65).
Applsci 14 09272 g008
Figure 9. Variable Influence on Projection (VIP) plot showing the metabolites of V. sativa exhibiting the highest contribution to the observed differentiation among genetic materials. The higher the VIP scores of the metabolites, the more significant their contribution to the differences between the varieties.
Figure 9. Variable Influence on Projection (VIP) plot showing the metabolites of V. sativa exhibiting the highest contribution to the observed differentiation among genetic materials. The higher the VIP scores of the metabolites, the more significant their contribution to the differences between the varieties.
Applsci 14 09272 g009
Figure 10. Values of scaled and centered OPLS regression coefficients (CoeffCS) for selected identified metabolites. Metabolites with the highest absolute values have the largest leverage on the observed discrimination.
Figure 10. Values of scaled and centered OPLS regression coefficients (CoeffCS) for selected identified metabolites. Metabolites with the highest absolute values have the largest leverage on the observed discrimination.
Applsci 14 09272 g010
Table 1. Phenotypic traits (abbreviations), rating scale, and type of inheritance.
Table 1. Phenotypic traits (abbreviations), rating scale, and type of inheritance.
A/APhenotypic TraitsRating ScaleType of Inheritance 1
1Seedling: anthocyanin coloration on base of stem (ACS)1: absent or very weak; 3: weak; 5: medium; 7: strong; 9: very strongQN
2Time of beginning of flowering (FL)1: very early; 3: early; 5: medium; 7: late; 9: very lateQN
3Stem: anthocyanin coloration on leaf axil (ACL)1: absent or very weak; 3: weak; 5: medium; 7: strong; 9: very strongQN
4Leaf: shape of apex (SHA)1: convex; 3: convex to straight; 5: straight; 7: straight to concave; 9: concavePQ
5Width of leaflet (WL)3: narrow; 5: medium; 7: wideQN
6Flower: color of standard (CS)1: white; 3: pink; 5: light violet; 7: medium violet; 9: dark violetPQ
7Pod: hairiness (PH)1: absent or very weak; 3: weak; 5: medium; 7: strong; 9: very strongQN
8100-seed weight (100SW)1: very low; 3: low; 5: medium; 7: large; 9: very largeQN
9Shape (SH)1: circular; 2: slightly irregular; 3: very irregularPQ
10Ground color of testa (GCT)1: whitish; 2: greyish green; 3: greyish brown; 4: brownPQ
11Brown ornamentation (BO)1: absent; 2: speckles; 3: blotches; 4: speckles and blotchesPQ
12Area of brown ornamentation (ABO)1: very small; 3: small; 5: medium; 7: large, 9: very largeQN
13Blue-black ornamentation (BBO)1: absent, 2: spots, 3: blotches, 4: spots and blotchesPQ
14Area of blue-black ornamentation (ABBO)1: very small; 3: small; 5: medium; 7: large, 9: very largeQN
15Color of cotyledons (CC)1: greyish brown; 2: orangeQL
1 QL: qualitative characteristic; QN: quantitative characteristic; PQ: pseudo-qualitative characteristic.
Table 2. SCoT markers used in the study of six V. sativa genotypes.
Table 2. SCoT markers used in the study of six V. sativa genotypes.
SCoT PrimerSequence of Nucleotides (5′-3′)Annealing Temperature (°C)
SCoT1CAACAATGGCTCCCACCA50
SCoT61CAACAATGGCTACCACCG50
SCoT30CCATGGCTACCACCGGCG50
SCoT13ACGACATGGCGACCACCATCG50
SCoT15ACGACATGGCGACCGCGA50
SCoT66ACCATGGTACCAGCGAG50
SCoT33CCATGGCTACCACCGCAG50
SCoT34ACCATGGCTACCACCGCA50
SCoT51ACAATGGCTACCACTGTC50
SCoT70ACCATGGCTACCAGCGCG50
SCoT66ACCATGGTACCAGCGAG50
Table 3. Phenotypic traits of the six V. sativa genotypes according to the technical protocol of CPVO for 15 morphological traits (TP/032/1/19-4-2016).
Table 3. Phenotypic traits of the six V. sativa genotypes according to the technical protocol of CPVO for 15 morphological traits (TP/032/1/19-4-2016).
GenotypeMorphological Traits
ACSFLACLSHAWLCSPH100 SWSHGCTBOABOBBOABBOCC
BK45strongMediumabsentstraightmediummedium violetweaklowcirculargreyish greenblotchessmallabsent-greyish brown
BK27mediumMediumabsentstraightmediummedium violetweakmediumcirculargreyish brownspeckleslargeabsent-greyish brown
BK23weakMediumweakstraightmediummedium violetmediummediumslightly irregulargreyish greenspecklesvery smallabsent-greyish brown
BK29mediumMediumweakstraightmediummedium violetweakhighcirculargreyish brownblotchesvery largespots and blotchessmallorange
BI65weakEarlyweakstraight concavemediummedium violetweakmediumslightly irregulargreyish greenspeckles and blotchesmediumabsent-greyish brown
M6900strongEarlymediumstraight concavemediummedium violetabsentmediumcirculargreyish greenblotchesvery largespots and blotchessmallgreyish brown
ACS: anthocyanin coloration on base of stem, FL: time of beginning of flowering, ACL: stem: anthocyanin coloration on leaf axil, SHA: leaf: shape of ape, WL: width of leaflet, CS: flower: color of standard, PH: pod: hairiness, 100 SW: 100-seed weight, SH: shape, GCT: ground color of testa, BO: brown ornamentation, ABO: area of brown ornamentation, BBO: blue–black ornamentation, ABBO: area of blue–black ornamentation, CC: color of cotyledons.
Table 4. Characteristics of the SCoT markers used in this study for analyzing the diversity of the V. sativa populations.
Table 4. Characteristics of the SCoT markers used in this study for analyzing the diversity of the V. sativa populations.
LocusFragment Size Range (bp)NaNeIGDHPIC
SCoT1450–30001.2371.3710.3130.2130.2670.375
SCoT61600–40001.6761.5330.4520.3070.3840.375
SCoT30300–40001.1041.3000.2480.1700.2130.375
SCoT13250–30000.9041.2250.2040.1360.1700.403
SCoT15300–30001.3461.3780.3210.2180.2730.375
SCoT66500–30001.5101.4960.4160.2840.3550.376
SCoT33300–35001.3431.3610.3070.2090.2610.379
SCoT34300–40001.3531.2880.2610.1740.2180.392
SCoT51500–40001.4721.4660.3930.2640.3310.388
SCoT70300–40001.3581.4010.3320.2270.2840.376
SCoT6700–35001.7171.4880.4220.2850.3570.409
Average 1.3651.3900.3340.2260.2830.384
Na = number of different alleles, Ne = number of effective alleles = 1/(p2 + q2), I = Shannon’s information index = −1 × (p × Ln (p) + q * Ln(q)), GD = gene diversity, H = diversity = 1 − (p2 + q2), uh = unbiased diversity = (N/(N − 1)) × h, PIC = polymorphism information content = 1 − Σ(p)2.
Table 5. Genetic diversity of V. sativa genotypes.
Table 5. Genetic diversity of V. sativa genotypes.
V. sativa
Genotypes
NNaNeNPBNo. Private BandsP (%)Shannon Index (I)GDH
BK4551.4491.425155362.030.3610.3070.246
BK2951.3161.380144054.550.3200.2730.273
BK2351.3421.383146156.150.3260.2770.222
BK2751.3211.326152450.800.2870.2420.193
M-690051.2511.355137051.870.3020.2570.205
BI-6551.3261.380143256.150.3250.2760.221
Mean51.3341.375 0.217
Species level30 55.260.3200.272
N = number of individuals, Na = number of different alleles, Ne = number of effective alleles = 1/(p2 + q2), NBP = number of polymorphic bands, P (%) = percentage of polymorphic bands, I = Shannon’s information index = −1 × (p × Ln (p) + q × Ln(q)), GD = gene diversity, H = diversity = 1 − (p2 + q2), uh = unbiased diversity = (N/(N − 1)) × h.
Table 6. Analysis of molecular variance results for the studied genetic material of V. sativa based on SCoT markers.
Table 6. Analysis of molecular variance results for the studied genetic material of V. sativa based on SCoT markers.
Sourcedf 1SS 2MS 3Est. Var.%
Among Pops5280,73356,147614619%
Within Pops24610,00025,41725,41781%
Total29890,733 31,563100%
StatValuep (rand ≥ data)
PhiPT0.1950.001
1 df: degree of freedom, 2 SS: sum of squares, 3 MS: mean of squares.
Table 7. Estimates of pairwise Nei’s genetic distance (below the diagonal) and FST values (above the diagonal) within overall groups of V. sativa genotypes.
Table 7. Estimates of pairwise Nei’s genetic distance (below the diagonal) and FST values (above the diagonal) within overall groups of V. sativa genotypes.
BK45BK29BK23BK27M-6900BI-65
0.000 BK45
0.1870.000 BK29
0.1260.1670.000 BK23
0.1660.3000.2560.000 BK27
0.1950.1720.1490.2710.000 M-6900
0.1820.1820.1250.2660.1490.000BI-65
Table 8. Additional information for the number of bands.
Table 8. Additional information for the number of bands.
SCoT MarkerNumber of LociNumber of Bands
SCoT145
SCoT635
SCoT1387
SCoT15914
SCoT30817
SCoT33610
SCoT34510
SCoT5112
SCoT6124
SCoT6667
SCoT7024
Table 9. Information on the intensity of the association between the molecular markers and the 22 metabolites and yield in seed and biomass.
Table 9. Information on the intensity of the association between the molecular markers and the 22 metabolites and yield in seed and biomass.
TraitAssociated BandsVery Strong NegativeStrong NegativeModerate NegativeWeak NegativeWeak PositiveModerate PositiveStrong PositiveVery Strong Positive
Asparagine31----2--
Citric acid7--2131--
Erythritol5--211-1-
Fumaric acid6---213--
Glycine8--1232--
L-Glutamic acid5-11-12--
Linoleic acid5--12-11-
L-Lactic acid3----1-11
L-Phenylalanine31---2---
L-Proline6--12-3--
Malic acid51--13---
Myo-Inositol51-1-12--
Myristic acid4--2--2--
Oleic Acid, (Z)-6--1121-1
Oxalic acid5--2-2-1-
Pantothenic acid6--31-2--
Salicylic acid4-1---21-
Stearic acid5--211--1
Succinic acid21-1-----
Tyrosine3-1---11-
β-Alanine7--2131--
γ-Tocopherol81-1222--
kg/acre/seed4-1-2-1--
kg/acre/biomass4---12-1-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Avramidou, E.; Sarri, E.; Papadopoulou, E.-A.; Petsoulas, C.; Tigka, E.; Tourvas, N.; Pratsinakis, E.; Ganopoulos, I.; Tani, E.; Aliferis, K.A.; et al. Phenotypic, Genetic, and Metabolite Variability among Genotypes of Vicia sativa L. Appl. Sci. 2024, 14, 9272. https://doi.org/10.3390/app14209272

AMA Style

Avramidou E, Sarri E, Papadopoulou E-A, Petsoulas C, Tigka E, Tourvas N, Pratsinakis E, Ganopoulos I, Tani E, Aliferis KA, et al. Phenotypic, Genetic, and Metabolite Variability among Genotypes of Vicia sativa L. Applied Sciences. 2024; 14(20):9272. https://doi.org/10.3390/app14209272

Chicago/Turabian Style

Avramidou, Eleni, Efi Sarri, Evgenia-Anna Papadopoulou, Christos Petsoulas, Evangelia Tigka, Nikolaos Tourvas, Emmanouil Pratsinakis, Ioannis Ganopoulos, Eleni Tani, Konstantinos A. Aliferis, and et al. 2024. "Phenotypic, Genetic, and Metabolite Variability among Genotypes of Vicia sativa L." Applied Sciences 14, no. 20: 9272. https://doi.org/10.3390/app14209272

APA Style

Avramidou, E., Sarri, E., Papadopoulou, E.-A., Petsoulas, C., Tigka, E., Tourvas, N., Pratsinakis, E., Ganopoulos, I., Tani, E., Aliferis, K. A., Abraham, E. M., Madesis, P., & Vlachostergios, D. (2024). Phenotypic, Genetic, and Metabolite Variability among Genotypes of Vicia sativa L. Applied Sciences, 14(20), 9272. https://doi.org/10.3390/app14209272

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop