Next Article in Journal
A Multi-Time Scale Hierarchical Coordinated Optimization Operation Strategy for Distribution Networks with Aggregated Distributed Energy Storage
Previous Article in Journal
Analysis of the Qualitative Parameters of Mobile Laser Scanning for the Creation of Cartographic Works and 3D Models for Digital Twins of Urban Areas
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Different Forms of Human Platelet Lysate on the Proliferation and Phenotype of Human Osteoblasts

by
Mohamad Raihan Kamaruddin
1,
Bahiratuz Zulfa Baharuddin
1,
Nahgeshwarie Ratha Manaalan
1,
Yi Lyn Wong
1,
Muhammad Najib Fathi Hassan
1,
Suria Abdul Aziz
2,
Barathan Muttiah
1 and
Jia Xian Law
1,*
1
Department of Tissue Engineering and Regenerative Medicine (DTERM), Faculty of Medicine, Universiti Kebangsaan Malaysia, Cheras, Kuala Lumpur 56000, Malaysia
2
Department of Pathology, Faculty of Medicine, Universiti Kebangsaan Malaysia, Cheras, Kuala Lumpur 56000, Malaysia
*
Author to whom correspondence should be addressed.
Appl. Sci. 2025, 15(4), 2074; https://doi.org/10.3390/app15042074
Submission received: 6 December 2024 / Revised: 29 January 2025 / Accepted: 12 February 2025 / Published: 16 February 2025

Abstract

Background and aims: Enhanced cell proliferation is crucial for reducing production time and cost in cell therapy, and human platelet lysate (HPL) is often used to boost cell proliferation due to its favorable safety profile. Understanding the roles of different HPL components and their effects on cell culture can lead to more informed choices in medium formulation, which in turn can influence cell behavior and outcomes. Therefore, this study aimed to investigate the effects of two types of HPL, i.e., heparin-supplemented HPL (He-HPL) and fibrinogen-depleted HPL without heparin (Fd-HPL), on human osteoblasts. Materials and Methods: He-HPL and Fd-HPL were prepared from expired platelet concentrates. The presence of growth factors, i.e., brain-derived neurotrophic factor (BDNF) and vascular endothelial growth factor (VEGF), and cytokines, i.e., interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α), in HPL was evaluated. Human fetal osteoblast (hFOB) cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with either He-HPL or Fd-HPL. The cell morphology, viability, calcium deposition, and expression of osteogenic genes were assessed. Results: Comparable levels of BDNF (p > 0.05), VEGF (p > 0.05), and IL-6 (p > 0.05) were detected in both types of HPL, whereas He-HPL exhibited significantly higher levels of TNF-α (p < 0.05). However, there were no notable differences in cell morphology, viability, population doubling time, or total cell yield between the two HPL types. Similarly, no differences were observed in the mineralization of cells treated with He-HPL compared to Fd-HPL. Nonetheless, hFOB cells cultured with He-HPL demonstrated significantly higher expression of osteogenic markers Runx2 and ALP (p < 0.05) compared to those cultured with Fd-HPL. Conclusions: He-HPL and Fd-HPL demonstrate comparable performance in promoting osteoblast proliferation and mineralization, making both usable for bone tissue engineering. However, He-HPL might have a slight edge as it enhances osteogenic gene expression.

1. Introduction

The human skeletal system is a complex framework that provides structural support and protection to vital organs through a dynamic balance of bone formation and resorption. The architects of bone strength and structure, known as osteoblasts, are at the center of this balance. Human osteoblasts are specialized bone-forming cells that play an important role in bone growth, maintenance, and repair by synthesizing and mineralizing bone tissue. In a process known as bone remodeling, osteoblasts collaborate with other bone cells such as osteoclasts (which break down bone tissue) and osteocytes (mature bone cells embedded in the bone matrix) to maintain bone homeostasis [1]. Osteoblasts emerge from mesenchymal stem cells, demonstrating the remarkable plasticity of cellular development. Under the influence of specific molecular signals, these precursor cells undergo a process of differentiation, transforming into functional osteoblasts. This differentiation journey marks the beginning of their pivotal role in bone biology [2].
Fetal bovine serum (FBS) is a natural medium supplement used in cell culture, containing a large amount of nutrients, growth factors, hormones, and proteins that are necessary for cell growth, and is often used for in vitro cultures of mammalian cells [3]. According to a recent study, alkaline phosphatase (ALP) is a potential component of FBS affecting mineralization [4]. In bone, ALP is expressed by osteoblasts. This enzyme does an important job by breaking down certain molecules, leading to an increase in a substance called inorganic phosphate (Pi). Pi, along with calcium ions, is thought to accumulate inside matrix vesicles to form amorphous calcium phosphate or hydroxyapatite crystals, which are believed to be the initial stage of extracellular matrix mineralization during bone formation. However, the use of FBS raises ethical concerns and animal welfare issues, primarily due to the risk of animal pathogen transmission and the possibility of animal protein contamination [5]. For these reasons, significant efforts have been targeted at finding a substitute, such as human serum or human platelet lysate (HPL) [6].
Human platelet lysate (HPL) is a valuable cell culture medium supplement for many cell types [7,8,9]. HPL allows cells to grow without the need for animal serum. It shortens the cell production time, thereby reducing overall production cost, and also facilitates the rapid development of cell-based treatments. This method is ethical and efficient, enabling the production of cell therapies in a human-friendly way within a reasonable time. HPL can be prepared from both fresh platelet concentrates and whole blood [10]. The process involves collecting platelets from donated human blood and then breaking them down to release growth factors and other bioactive molecules. Nonetheless, securing an adequate supply of blood donors for HPL production is challenging due to the high demand on blood banks.
Platelet concentrate is a blood product available in every hospital’s blood bank. Platelet concentrates in blood banks in Malaysia can only be stored for 5 days at 20–24 °C with continual agitation in accordance with Ministry of Health guidelines, and will be discarded as biological waste if no transfusion is performed. Even though the platelet concentrates have expired, most of the platelets and growth factors inside are still intact. Expired platelet concentrates can thus be collected and processed into HPL for cell culture purposes [11,12]. This practice is considered safe as HPL is derived from platelet concentrates prepared according to national and international standards, minimizing the risk of infection.
HPL is rich in various proteins, including fibrinogen and other coagulation factors. Fibrinogen is a soluble plasma glycoprotein that plays a crucial role in blood clotting. When present in excess, fibrinogen can undergo a series of enzymatic reactions triggered by thrombin, leading to the formation of a fibrin clot [13]. In the context of cell culture, this clotting phenomenon can be highly problematic and disruptive to the process of cell culture and storage. Therefore, an anticoagulant such as heparin is frequently added to HPL to prevent clot formation. Heparin suppresses coagulation factors such as fibrinogen, preventing proteins from clumping and producing a gel-like material. However, heparin is usually derived from animals, and despite careful adherence to the recommended maximum dosage, challenges related to clot and precipitate formation can still persist [14].
Fibrinogen-depleted human platelet lysate (Fd-HPL) is used in cell culture as an alternative to HPL to address this issue [14]. Calcium chloride is added to HPL produced via the freeze/thaw cycle method to induce clot formation. Calcium ions promote the conversion of prothrombin to thrombin and accelerate the rate of fibrin monomer polymerization, resulting in increased fibrin clot formation. The precipitate that develops is then removed via centrifugation to obtain Fd-HPL. As a result, it can optimize cell growth conditions and enhance the reliability of experiments on them, particularly in contexts where a pure and uninterrupted cell culture environment is essential.
In this study, we investigated the effects of two types of human platelet lysate, hPL supplemented with heparin and fibrinogen-depleted HPL without heparin supplementation, on the growth kinetics and phenotypes of human osteoblasts. Testing was performed on the human fetal osteoblast cell line (hFOB), which is derived from human fetal bone tissue that has been cultured and immortalized in a laboratory setting. This cell line serves as a valuable tool in scientific research, particularly in studies related to bone development, mineralization, and various bone-related diseases. This study is the first to directly compare the effects of heparin-supplemented HPL (He-HPL) and fibrinogen-depleted HPL (Fd-HPL) on the growth kinetics and osteogenic phenotypes of human osteoblasts, addressing critical gaps in understanding how these culture media influence bone cell behavior.

2. Materials and Methods

2.1. Ethical Approval

The study was conducted with ethical approval from the Universiti Kebangsaan Malaysia Research Ethics Committee (JEP-2024-161).

2.2. Preparation of HPL Supplemented with Heparin and Fibrinogen-Depleted HPL) Without Heparin Supplementation

Expired platelet concentrates (PC) from the Blood Bank Unit, Hospital Canselor Tuanku Muhriz (HCTM), were collected and stored at −80 °C. Before processing, the frozen units were thawed in a 37 °C water bath. Subsequently, 3–4 packs of PCs were pooled together in a Scott bottle. The freeze–thaw cycle was repeated twice, resulting in platelet lysis.
To prepare HPL supplemented with heparin, the PCs were centrifuged at 5000 rpm for 15 min at 4 °C. Following that, the supernatants (HPL) were collected and filtered through a 100 µm cell strainer, followed by a 0.22 µm filter. A final concentration of 40 IU/mL heparin (Duopharma, Bandar Baru Bangi, Malaysia) was added to prevent clotting, and the processed platelet lysate was stored at −80 °C until further use.
For the preparation of Fd-HPL without heparin supplementation, calcium chloride (CaCl2; Sigma-Aldrich, St. Louis, MO, USA) was added to the HPL to a final concentration of 20 mM and incubated at 37 °C for 2 h, followed by overnight incubation for 12 h at 4 °C. After this, the clotted HPL was centrifuged at 5000 rpm for 15 min at 4 °C. Then, the fibrin clot was removed and the collected supernatant was sterile-filtered using a 0.22 µm filter before being stored at −80 °C until further use.

2.3. Human Fetal Osteoblast Cell Line (hFOB) Culture

The human fetal osteoblast cell line (hFOB) was cultured with DMEM/F12 medium (Sigma-Aldrich) supplemented with different types of HPLs. Antibiotic–antimycotic (1%; Sigma-Aldrich) was added to prevent microbial contamination. The media were replaced every two to three days while the cells were grown at 37 °C and 5% CO2.

2.4. Cell Morphologic, Viability and Yield

The osteoblasts were seeded at a density of 2000 cells/cm2 in six-well plates and cultured in DMEM/F12 medium (Sigma-Aldrich) supplemented with 10% (v/v) human platelet lysates (HPLs) along with 1% antibiotic–antimycotic solution (Sigma-Aldrich). Morphological changes, growth patterns, and confluency of the cultured cells were monitored every 2–3 days using an inverted microscope at 40× magnification. Images were captured at five random points per well for consistency and analyzed using ImageJ software (version 1.53k) to measure cell length, width, and size. Meanwhile, another set of cultured cells was grown to 70–80% confluence and then released from the culture plate using 0.05% trypsin-EDTA (Sigma-Aldrich) to manually quantify cell number, viability and yield using a hemocytometer and trypan blue. The cell suspension was diluted, and an aliquot of the suspension was placed in the hemocytometer to count the number of cells under a microscope. The total cell number was then calculated by multiplying the count by the dilution factor, which gives the final cell yield per well or per culture dish. For each group, six samples were analyzed. The tests were repeated three times. Viability was determined using the following formula:
(Total live cells/total live + dead cells) × 100%.
The group growth rate, i.e., population doubling time (PDT), was calculated using the following formula:
PDT = t log2/(logN2 − logN1),
where t denotes time in culture (hour), N2 denotes the cell number at the end of the passage and N1 denotes the cell number seeded at the beginning of the passage.

2.5. Gene Expression Levels of Osteoblast and Osteocyte Markers

Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The RNA yield was quantified using a spectrophotometer at 260 nm (A260). The RNA concentration ranged from 250 ng/µL to 300 ng/µL across samples. Purity was assessed by calculating the A260/A280 ratio, which ranged from 1.9 to 2.0, confirming the absence of significant protein contamination. The yield and purity of the extracted RNA were confirmed using a spectrophotometer. Total RNA was kept at −80 °C after extraction. Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany) as per the manufacturer’s guidelines. This included an initial step to remove genomic DNA contamination using gDNA Wipeout Buffer, and the RNA was directly used for reverse transcription with a master mix containing Quantiscript Reverse Transcriptase, RT Buffer, and RT Primer Mix to synthesize complementary DNA (cDNA). The reaction occurred at 42 °C, efficiently transcribing RNA with complex secondary structures while maintaining its integrity, and was inactivated at 95 °C. The total reaction volume and RNA input were standardized across all samples to ensure consistency in cDNA synthesis.
Real-time PCR was conducted using the Luna® Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) with primers designed for target genes such as alkaline phosphatase (ALP), type 1 collagen (Col 1), osteocalcin (OCN), runt-related transcription factor 2 (Runx2), osteopontin (OPN), bone sialoprotein (BSP), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using Primer3 software, validated against the GeneBank database (Table 1). Primer specificity was confirmed through in silico analysis and melt curve analysis, which showed single peaks for each target gene. The qPCR reaction was set up with a final volume of 20 µL, containing 10 µL Luna Universal qPCR Master Mix (1X), 0.5 µL forward primer (0.25 µM), 0.5 µL reverse primer (0.25 µM), variable template DNA (<100 ng), and nuclease-free water to adjust the volume. All components were thawed, mixed thoroughly, and centrifuged briefly to collect the liquid. Reactions were performed on a Bio-Rad iCycler (BioRad, Hercules, CA, USA) with a thermal profile of initial denaturation at 95 °C for 1 min, followed by 40 amplification cycles consisting of denaturation at 95 °C for 15 s and annealing extension at 60 °C for 30 s. Negative controls without template (NTC) were included to monitor contamination. This series of cycles was followed by a melt curve analysis to check the reaction specificity. The expression level of each targeted gene was normalized to GAPDH, the housekeeping gene. Each experiment was performed in triplicate, and data are presented as mean ± SEM.

2.6. Calcium Deposition (Alizarin Red Staining)

The osteoblasts were seeded at a density of 5000 cells/cm2 and cultured until 90% confluence. Cells were then fixed with 4% paraformaldehyde (Sigma-Aldrich) and stained with Alizarin red (Sigma-Aldrich) to detect natural calcium deposition of osteoblasts. The experiments were performed in triplicate.

2.7. Enzyme-Linked Immunosorbent Assay (ELISA)

ELISA kits from BioLegend (San Diego, CA, USA) were used to detect the concentration of vascular endothelial growth factor (VEGF), brain-derived neurotrophic factor (BDNF), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNF-α) following the manufacturer’s instructions. The ELISA plate was coated with the capture antibody and incubated overnight at 4 °C. After blocking of non-specific sites, standards and samples were added to the wells and incubated. The detection antibody and HRP-conjugated secondary antibody were then added, followed by substrate solution. After color development, the reaction was stopped and absorbance was measured at 450 nm using a spectrophotometer. The concentrations of target growth factors and cytokines were determined from the standard curves. For each group, six samples were analyzed. The experiments were performed in triplicate.

2.8. Statistical Analysis

The data are presented as mean ± standard error of mean (SEM). Statistical analysis was performed using the software GraphPad Prism version 10.3.1.509 (GraphPad Software Inc., La Jolla, CA, USA). Unpaired t-tests were performed to examine statistical differences between groups. The differences were considered significant if p < 0.05.

3. Results

3.1. Cell Viability, Total Cell Number and PDT of hFOB

hFOB cells were trypsinized once they reached 70–80% confluence to determine the cell viability, cell yield and PDT. The hFOB cells cultured with Fd-HPL and He-HPL were both trypsinized at day 4. The cell viability exceeded 90% for both groups, i.e., 98.38 ± 1.21% for He-HPL and 97.98 ± 0.83% for Fd-HPL; there was no statistical difference in viability. (Figure 1A). Starting with a density of 2000 cells/cm2 in a T25 flask, there was no significant difference in total cell number between hFOB cultured with He-HPL (1,157,000 cells) and Fd-HPL (1,057,000 cells) (Figure 1B). There was also no significant difference in PDT between hFOB grown in He-HPL (15.12 ± 0.23 h) and Fd-HPL (15.47 ± 0.55 h) (Figure 1C).

3.2. Morphology of hFOB

hFOB cultured with He-HPL and Fd-HPL took four days to reach 70–80% confluence. The cells in all groups had similar spindle-shaped fibroblastic morphology. However, hFOB cultured in Fd-HPL displayed less consistent cell morphology, with some cells exhibiting irregular flattened shapes and enlarged sizes (Figure 2). Nonetheless, no statistical significance was detected for cell length, width, and size between the two groups, except cell length on day 4 (Figure 3).

3.3. hFOB Cells Cultured with He-HPL Have Same Calcium Deposition as Those Cultured with Fd-HPL

Both He-HPL and Fd-HPL enhanced osteoblast mineralization, as evidenced by increased calcium deposition indicated by the intense Alizarin red staining (Figure 4).

3.4. He-HPL Enhances Osteogenic Marker Expression Compared to Fd-HPL

The results indicate that the He-HPL group exhibited significantly higher expression of osteogenic markers (Runx2 and ALP) compared to the Fd-HPL group, suggesting enhanced osteogenic differentiation (Figure 5).

3.5. The Concentration of TNF-α Reduced Significantly in Fd-HPL Compared to He-HPL

After fibrinogen depletion, the concentrations of BDNF (313.33 ± 28.72 ng/mL in Fd-HPL and 242.67 ± 6.13 ng/mL in He-HPL), VEGF (630.17 ± 19.75 pg/mL in Fd-HPL and 576 ± 4.73 pg/mL in He-HPL), and IL-6 (23.5 ± 2.36 pg/mL in Fd-HPL and 28.17 ± 0.93 in He-HPL) were maintained. A significant decrease in concentration was recorded for TNF-α, dropping from 32.33 ± 0.76 pg/mL in He-HPL to 19.00 ± 2.60 pg/mL in Fd-HPL (Figure 6).

4. Discussion

The human skeletal system relies on osteoblasts for bone formation, maintenance, and repair. Osteoblasts collaborate with osteoclasts and osteocytes to regulate bone remodeling [2]. Thus, osteoblasts can be used in the field of tissue engineering and regenerative medicine to promote bone repair and regeneration. Fetal bovine serum (FBS) is traditionally used for in vitro cell cultures, but its ethical concerns and risk of contamination have led to the use of other serum alternatives such as HPL. HPL, derived from donated human blood, offers ethical, efficient, and animal pathogen-safe cell culture. Fibrinogen in HPL may cause clotting; thus, anticoagulants like heparin are used. Fibrinogen-depleted HPL (Fd-HPL) eliminates this need. In our previous study, a calcium chloride-based protocol was developed to prepare Fd-HPL [14]. However, the effects of HPL with heparin (He-HPL) and Fd-HPL on human osteoblasts have yet to be elucidated. Thus, this study investigates the effects of HPL with heparin and Fd-HPL without heparin on human fetal osteoblast (hFOB) growth and phenotype.
Previous studies have shown that HPL is widely utilized in stem cell cultures due to its rich growth factor content, but its high fibrinogen levels can lead to unwanted fibrin gel formation, disrupting cell expansion [11,14]. To counteract this, heparin, an animal-derived anticoagulant, is often added to prevent clot formation by inhibiting thrombin. While heparin is commonly used to prevent fibrin gel formation in HPL due to its anticoagulant properties, it can negatively impact osteogenic differentiation. Research has shown that high doses of heparin can interfere with the mineralization process crucial for osteoblast differentiation, reducing ALP activity and calcium deposition, which are markers of osteogenesis [15,16]. Data further indicate that heparin disrupts the CXCR4/SDF-1 signaling axis and may interfere with the migration and homing capacity of bone marrow-derived mononuclear cells [17]. Therefore, it has been suggested that heparin should be supplied at lowest possible concentrations in media containing HPL to prevent gel formation [18]. Additionally, fibrinogen, a pro-inflammatory component, can increase immune cell adhesion and negatively impact MSCs’ immune-modulating abilities. Thus, alternatives like Fd-HPL, which support heparin-free culture conditions, are being explored to avoid these negative impacts while still enabling effective cell expansion. This heparin-free approach also addresses safety concerns related to animal-derived components, making it a more viable option for clinical applications [14].
The findings from the cell culture experiments on cell viability, yield, and PDT revealed no statistically significant differences between the two groups. Both He-HPL and Fd-HPL supported high cell viability, exceeding 90%, while the final cell yields and population doubling times remained comparable. These findings suggest that both He-HPL and Fd-HPL are equally effective in supporting the proliferation and maintenance of human osteoblasts. These results align with previous studies demonstrating the robustness of HPL in supporting cellular growth across various preparation methods. For instance, a study indicated that different HPL formulations derived from various preparation methods, such as He-HPL and Fd-HPL, were similarly effective in supporting the growth of mesenchymal stem cells [19]. The absence of a statistically significant difference could also be attributed to the inherent biological variability in osteoblast response or the saturation of growth-promoting factors in both HPL preparations. Previous research has shown that growth factors like platelet-derived growth factor (PDGF), transforming growth factor-beta (TGF-β), and VEGF, which are present in HPL, play crucial roles in cellular proliferation and differentiation [20]. Since both He-HPL and Fd-HPL are likely to contain similar concentrations of these growth factors, as indicated by the comparable levels of BDNF and VEFG in this study as well as TGF-ꞵ1 and PDGF-BB in the previous study by Kee et al. [14], it is plausible that the cells reached their proliferative capacity under both conditions, leading to the observed similarities. These observations indicate that the addition of calcium chloride to prepare Fd-HPL does not significantly alter the concentration of key bioactive components. Thus, Fd-HPL retains the bioactive properties necessary to support osteoblast proliferation to a degree comparable to He-HPL. This may explain why no differences were observed in the proliferation rate, total cell count, or viability between the two groups.
The morphological variations observed between hFOB cells cultured in He-HPL and Fd-HPL on day 1 provide insights into the initial cellular response to these two different platelet lysate preparations. Cells in He-HPL initially exhibited irregular, flattened morphologies and appeared larger compared to those in Fd-HPL, which displayed a more consistent and fibroblastic shape. This early difference suggests that He-HPL may induce a distinct early cellular response, potentially due to variations in the concentration of bioactive molecules in the lysate. Growth factors, such as PDGF, TGF-β, and VEGF, are known to influence cell adhesion, morphology, and proliferation, and slight variations in their availability between He-HPL and Fd-HPL could explain the different morphologies observed on day 1 [14]. Despite these initial differences, by day 4, hFOB cells in both He-HPL and Fd-HPL cultures exhibited similar spindle-shaped fibroblastic morphologies, indicating that both methods support normal osteoblast behavior over time. The convergence of cell shape by Day 4 suggests that both He-HPL and Fd-HPL provide an adequate environment for osteoblastic growth and proliferation, despite their initial differences in bioactivity. This is consistent with studies that have demonstrated the effectiveness of platelet lysates in promoting mesenchymal stem cell and osteoblast-like cell proliferation and differentiation, regardless of the specific preparation method used [14,21,22].
The spindle-shaped fibroblastic morphologies observed in both groups by day 4 align with the expected morphology of osteoblasts in culture, reflecting healthy proliferation and the cells’ ability to adapt to their environment. The fact that these morphological differences did not persist beyond day 1 suggests that the initial stress or adaptation period in He-HPL conditions was overcome, leading to normal cellular behavior in the long term. Similar studies have shown that while different platelet lysate preparations can induce varied short-term responses, long-term cell growth and differentiation tend to converge as cells adjust to the culture environment [21]. These findings suggest that both He-HPL and Fd-HPL provide sufficient bioactive factors to support osteoblast-like cell growth, despite slight initial variations in cellular morphology. This also highlights the versatility of hFOB cells in adapting to different culture conditions, as well as the robustness of both forms of HPL in supporting cell viability and morphology over extended culture periods.
Real-time PCR analysis revealed significantly higher expression of Runx2 and ALP in He-HPL compared to Fd-HPL and no significant differences in the mRNA expression of other osteogenic markers, including OPN, BSP, Col 1 and OCN. The increase in the mRNA expressions of ALP, an early marker of osteoblast differentiation [23], and Runx2, a master regulator of osteoblast differentiation [24] demonstrated that He-HPL might have more potent osteogenic differentiation potential compared to Fd-HPL. These discrepancies might be due to the presence of heparin, which has been reported to promote osteogenic differentiation of mesenchymal stem cells via the induction of BMP and WNT pathways [25,26]. Additionally, Fd-HPL has a high calcium level that has been reported to suppress osteogenic gene expression [14,27]. These findings suggest that He-HPL is more effective in maintaining the osteogenic markers of hFOB cells.
There was a lack of significant differences in calcium deposition between hFOB cells cultured with He-HPL and those cultured with Fd-HPL. Despite the reduction in fibrinogen content, both He-HPL and Fd-HPL were equally capable of supporting calcium deposition, suggesting that fibrinogen depletion does not impair the ability of HPL to maintain the osteogenic potential of hFOB. This finding indicated that differences in the fibrinogen and calcium concentration in both forms of HPL did not influence the osteogenic potential of hFOB.
In this study, we measured the concentration of four growth factors and cytokines, i.e., VEGF, BDNF, TNF-α, and IL-6. Only the concentration of TNF-α dropped significantly after the depletion of fibrinogen, while the concentration of other growth factors and cytokines are maintained. When fibrinogen is depleted, TNF-α may be reduced due to the loss of this stabilization effect and be removed together with fibrinogen, leading to its lower concentration in Fd-HPL [28].
Both types of HPL promoted osteoblast mineral deposition, indicating both are equally potent for the expansion of HPL in vitro without causing changes in cell phenotype. Coupled with consistency in cell growth and morphology, all these findings indicated that both types of HPL are rich in nutrients required for the in vitro expansion of osteoblasts.
Despite providing valuable insights into the effects of He-HPL and Fd-HPL on osteoblast growth and osteogenic differentiation, this study has certain limitations. Firstly, the results are based on hFOB, which may not fully represent the complexities of primary osteoblasts or osteogenesis in vivo. Additionally, while the study focused on gene expression as a marker of osteogenic potential, protein-level validation through techniques like Western blot or immunofluorescence was not performed, which could have provided a more complete picture of the osteogenic process. Furthermore, the study did not explore the metabolic effects or other functional consequences of using these platelet lysates, which could offer additional insights into their potential applications. Finally, the use of He-HPL and Fd-HPL, while promising, requires further investigation, particularly in clinical or in vivo models, to better understand their long-term effects and safety profiles. These limitations suggest that future studies should include more comprehensive assays and in vivo models to validate these findings. As a key limitation, future studies will also include FBS controls to directly compare its effects alongside He-HPL and Fd-HPL, enabling a clearer understanding of how HPL compares to FBS in osteoblast proliferation, differentiation, and overall functionality.
Future studies could explore additional methods to assess osteoblast proliferation and differentiation, such as incorporating proliferation assays like the BrdU incorporation assay, MTT/MTS assay, or Ki-67 staining. These assays would provide more comprehensive insights into the effects of He-HPL and Fd-HPL on osteoblast proliferation, complementing the current findings from cell number counting. By incorporating these assays, future work could further elucidate the mechanisms underlying the enhanced osteogenic differentiation observed with He-HPL supplementation, offering more robust evidence of its potential for bone-related therapies. Moreover, exploring protein expression through Western blotting or immunofluorescence for key osteogenic markers would also enhance the understanding of osteoblast behavior under different culture conditions. Additionally, these assays could be employed in longer-term studies to better mimic in vivo bone formation processes, providing a more complete picture of the potential clinical applications of HPL in osteoblast-based therapies.

5. Conclusions

The comparable performance of He-HPL and Fd-HPL in promoting osteoblast proliferation, viability, and mineralization underscores their potential as valuable medium supplements for bone regeneration. Their ability to support rapid population doubling and high cell yield suggests their utility in enhancing the efficiency of osteoblast culture for therapeutic applications, including the treatment of bone fractures, osteoporosis, and large-scale bone defects. Notably, He-HPL offers an additional advantage by enhancing the osteogenic markers of cultured osteocytes, likely due to its heparin content and lower calcium concentration. These findings highlight the need to tailor platelet lysate preparations to meet specific clinical or research requirements. Further studies should investigate the comprehensive composition of HPL to optimize its application in both research and clinical contexts.

Author Contributions

Conceptualization, J.X.L.; Methodology, N.R.M., S.A.A. and J.X.L.; Validation, N.R.M. and Y.L.W.; Formal analysis, B.Z.B.; Investigation, M.N.F.H.; Data curation, M.R.K. and B.Z.B.; Writing—original draft, M.R.K., B.Z.B., N.R.M., Y.L.W. and B.M.; Writing—review & editing, J.X.L.; Supervision, M.N.F.H.; Project administration, B.M.; Funding acquisition, J.X.L. All authors have read and agreed to the published version of the manuscript.

Funding

The research was conducted with funding provided by the Faculty of Medicine, Universiti Kebangsaan Malaysia (FF-2024-266).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of Universiti Kebangsaan Malaysia (JEP-2024-161, approved June 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Siddiqui, J.A.; Partridge, N.C. Physiological Bone Remodeling: Systemic Regulation and Growth Factor Involvement. Physiology 2016, 31, 233–245. [Google Scholar] [CrossRef] [PubMed]
  2. Šromová, V.; Sobola, D.; Kaspar, P. A Brief Review of Bone Cell Function and Importance. Cells 2023, 12, 2576. [Google Scholar] [CrossRef] [PubMed]
  3. Subbiahanadar Chelladurai, K.; Selvan Christyraj, J.D.; Rajagopalan, K.; Yesudhason, B.V.; Venkatachalam, S.; Mohan, M.; Chellathurai Vasantha, N.; Selvan Christyraj, J.R.S. Alternative to FBS in animal cell culture—An overview and future perspective. Heliyon 2021, 7, e07686. [Google Scholar] [CrossRef] [PubMed]
  4. Ansari, S.; Ito, K.; Hofmann, S. Alkaline Phosphatase Activity of Serum Affects Osteogenic Differentiation Cultures. ACS Omega 2022, 7, 12724–12733. [Google Scholar] [CrossRef] [PubMed]
  5. Villasante, A.; Robinson, S.T.; Cohen, A.R.; Lock, R.; Guo, X.E.; Vunjak-Novakovic, G. Human Serum Enhances Biomimicry of Engineered Tissue Models of Bone and Cancer. Front. Bioeng. Biotechnol. 2021, 9, 658472. [Google Scholar] [CrossRef] [PubMed]
  6. Liau, L.L.; Hassan MN, F.B.; Tang, Y.L.; Ng, M.H.; Law, J.X. Feasibility of Human Platelet Lysate as an Alternative to Foetal Bovine Serum for In Vitro Expansion of Chondrocytes. Int. J. Mol. Sci. 2021, 22, 1269. [Google Scholar] [CrossRef] [PubMed]
  7. Oeller, M.; Laner-Plamberger, S.; Krisch, L.; Rohde, E.; Strunk, D.; Schallmoser, K. Human platelet lysate for good manufacturing practice-compliant cell production. Int. J. Mol. Sci. 2021, 22, 5178. [Google Scholar] [CrossRef] [PubMed]
  8. Baik, S.Y.; Lim, Y.A.; Kang, S.J.; Ahn, S.H.; Lee, W.G.; Kim, C.H. Effects of platelet lysate preparations on the proliferation of HaCaT cells. Ann. Lab. Med. 2014, 34, 43–50. [Google Scholar] [CrossRef][Green Version]
  9. Schallmoser, K.; Strunk, D. Generation of a pool of human platelet lysate and efficient use in cell culture. Methods Mol. Biol. 2013, 946, 349–362. [Google Scholar] [PubMed]
  10. Palombella, S.; Orfei, C.P.; Castellini, G.; Gianola, S.; Lopa, S.; Mastrogiacomo, M.; Moretti, M.; de Girolamo, L. Systematic review and meta-analysis on the use of human platelet lysate for mesenchymal stem cell cultures: Comparison with fetal bovine serum and considerations on the production protocol. Stem Cell Res. Ther. 2022, 13, 142. [Google Scholar] [CrossRef]
  11. Hassan MN, F.; Yap, Z.Y.; Tang, Y.L.; Ng, M.H.; Law, J.X. Expired platelet concentrate as a source of human platelet lysate for xenogeneic-free culture of human dermal fibroblasts. Sains Malays. 2021, 50, 2355–2365. [Google Scholar] [CrossRef]
  12. Harto, P.H.B.B.; Mahmud, M.H.B.; Othman, A.H.B.; Ngadenin, N.H.B.; Azahar, N.S.B.M.; Hassan, M.N.F.B.; Yahaya, N.H.M.; Rani, R.A.; Leong, C.F.; Ng, M.H.; et al. Human platelet lysate promotes proliferation but fails to maintain chondrogenic markers of chondrocytes. Sains Malays. 2019, 48, 2169–2176. [Google Scholar] [CrossRef]
  13. Kattula, S.; Byrnes, J.R.; Wolberg, A.S. Fibrinogen and fibrin in hemostasis and thrombosis. Arterioscler. Thromb. Vasc. Biol. 2017, 37, e13–e21. [Google Scholar] [CrossRef] [PubMed]
  14. Kee, L.T.; Lee, Y.T.; Ng, C.Y.; Hassan, M.N.F.; Ng, M.H.; Mahmood, Z.; Aziz, S.A.; Law, J.X. Preparation of fibrinogen-depleted human platelet lysate to support heparin-free expansion of umbilical cord-derived mesenchymal stem cells. Biology 2023, 12, 1085. [Google Scholar] [CrossRef]
  15. Kanzaki, S.; Takahashi, T.; Kanno, T.; Ariyoshi, W.; Shinmyouzu, K.; Tujisawa, T.; Nishihara, T. Heparin inhibits BMP-2 osteogenic bioactivity by binding to both BMP-2 and BMP receptor. J. Cell. Physiol. 2008, 216, 844–850. [Google Scholar] [CrossRef] [PubMed]
  16. Yang, L.; Butcher, M.; Simon, R.R.; Osip, S.L.; Shaughnesy, S.G. The effect of heparin on osteoblast differentiation and activity in primary cultures of bovine aortic smooth muscle cells. Atherosclerosis 2005, 179, 79–86. [Google Scholar] [CrossRef] [PubMed]
  17. Seeger, F.H.; Rasper, T.; Fischer, A.; Muhly-Reinholz, M.; Hergenreider, E.; Leistner, D.M.; Sommer, K.; Manavski, Y.; Henschler, R.; Chavakis, E.; et al. Heparin disrupts the CXCR4/SDF-1 axis and impairs the functional capacity of bone marrow-derived mononuclear cells used for cardiovascular repair. Circ. Res. 2012, 111, 854–862. [Google Scholar] [CrossRef]
  18. Hameda, H.; Kalz, J.; Walenda, G.; Lohmann, M.; Wagner, W. Heparin concentration is critical for cell culture with human platelet lysate. Cytotherapy 2013, 15, 1174–1181. [Google Scholar] [CrossRef] [PubMed]
  19. Mareschi, K.; Marini, E.; Niclot, A.G.S.B.; Barone, M.; Pinnetta, G.; Adamini, A.; Spadea, M.; Labanca, L.; Lucania, G.; Ferrero, I.; et al. A New Human Platelet Lysate for Mesenchymal Stem Cell Production Compliant with Good Manufacturing Practice Conditions. Int. J. Mol. Sci. 2022, 23, 3234. [Google Scholar] [CrossRef]
  20. Shanbhag, S.; Mohamed-Ahmed, S.; Lunde, T.H.F.; Suliman, S.; Bolstad, A.I.; Hervig, T.; Mustafa, K. Influence of platelet storage time on human platelet lysates and platelet lysate-expanded mesenchymal stromal cells for bone tissue engineering. Stem Cell Res. Ther. 2020, 11, 351. [Google Scholar] [CrossRef] [PubMed]
  21. Nguyen, V.T.; Nardini, M.; Ruggiu, A.; Cancedda, R.; Descalzi, F.; Mastrogiacomo, M. Platelet lysate induces in human osteoblasts resumption of cell proliferation and activation of pathways relevant for revascularization and regeneration of damaged bone. Int. J. Mol. Sci. 2020, 21, 5123. [Google Scholar] [CrossRef] [PubMed]
  22. Ruggiu, A.; Ulivi, V.; Sanguineti, F.; Cancedda, R.; Descalzi, F. The effect of Platelet Lysate on osteoblast proliferation associated with a transient increase of the inflammatory response in bone regeneration. Biomaterials 2013, 34, 9318–9330. [Google Scholar] [CrossRef] [PubMed]
  23. Lee, J.M.; Kim, M.G.; Byun, J.H.; Kim, G.C.; Ro, J.H.; Hwang, D.S.; Choi, B.B.; Park, G.C.; Kim, U.K. The effect of biomechanical stimulation on osteoblast differentiation of human jaw periosteum-derived stem cells. Maxillofac. Plast. Reconstr. Surg. 2017, 39, 7. [Google Scholar] [CrossRef] [PubMed]
  24. Wysokinski, D.; Pawlowska, E.; Blasiak, J. RUNX2: A Master Bone Growth Regulator That May Be Involved in the DNA Damage Response. DNA Cell Biol. 2015, 34, 305–315. [Google Scholar] [CrossRef]
  25. Ling, L.; Dombrowski, C.; Foong, K.M.; Haupt, L.M.; Stein, G.S.; Nurcombe, V.; van Wijnen, A.J.; Cool, S.M. Synergism between Wnt3a and heparin enhances osteogenesis via a phosphoinositide 3-kinase/Akt/RUNX2 pathway. J. Biol. Chem. 2010, 285, 26233–26244. [Google Scholar] [CrossRef] [PubMed]
  26. Simann, M.; Schneider, V.; Le Blanc, S.; Dotterweich, J.; Zehe, V.; Krug, M.; Jakob, F.; Schilling, T.; Schütze, N. Heparin affects human bone marrow stromal cell fate: Promoting osteogenic and reducing adipogenic differentiation and conversion. Bone 2015, 78, 102–113. [Google Scholar] [CrossRef] [PubMed]
  27. Han, Y. High concentrations of calcium suppress osteogenic differentiation of human periodontal ligament stem cells in vitro. J. Dent. Sci. 2021, 16, 817–824. [Google Scholar] [CrossRef] [PubMed]
  28. Burnouf, T.; Goubran, H.A.; Chen, T.M.; Radosevic, M.; El-Ekiaby, M. Human platelet lysate: Replacing fetal bovine serum as a gold standard for human cell propagation? Biomater. Sci. 2016, 4, 709–721. [Google Scholar] [CrossRef]
Figure 1. There were no notable significant differences in (A) cell viability, (B) total cell number, and (C) PDT between He-HPL and Fd-HPL groups. Values expressed as mean ± SEM (N = 6 per group).
Figure 1. There were no notable significant differences in (A) cell viability, (B) total cell number, and (C) PDT between He-HPL and Fd-HPL groups. Values expressed as mean ± SEM (N = 6 per group).
Applsci 15 02074 g001
Figure 2. Morphology of osteoblasts cultured in Fd-HPL and He-HPL at day 1 and day 4. Scale bars represent 100 µm.
Figure 2. Morphology of osteoblasts cultured in Fd-HPL and He-HPL at day 1 and day 4. Scale bars represent 100 µm.
Applsci 15 02074 g002
Figure 3. Measurement of (A) cell length on day 1, (B) cell width on day 1, (C) cell size on day 1, (D) cell length on day 4, (E) cell width on day 4, and (F) cell size on day 4 between He-HPL and Fd-HPL groups. No statistical differences were detected between the two groups except for cell length on day 4. Values expressed as mean ± SEM (N = 6 per group). * indicates p < 0.05.
Figure 3. Measurement of (A) cell length on day 1, (B) cell width on day 1, (C) cell size on day 1, (D) cell length on day 4, (E) cell width on day 4, and (F) cell size on day 4 between He-HPL and Fd-HPL groups. No statistical differences were detected between the two groups except for cell length on day 4. Values expressed as mean ± SEM (N = 6 per group). * indicates p < 0.05.
Applsci 15 02074 g003
Figure 4. Alizarin red staining, which specifically binds to calcium deposits in the extracellular matrix, indicating mineralization by osteoblasts. There is similar intense red staining observed in the He-HPL group and the Fd-HPL group. Scale bars represent 100 µm.
Figure 4. Alizarin red staining, which specifically binds to calcium deposits in the extracellular matrix, indicating mineralization by osteoblasts. There is similar intense red staining observed in the He-HPL group and the Fd-HPL group. Scale bars represent 100 µm.
Applsci 15 02074 g004
Figure 5. Osteogenic marker expression in He-HPL and Fd-HPL groups. The He-HPL group showed significantly higher expression of Runx2 and ALP compared to the Fd-HPL group. Data represent mean ± SEM (N = 3 per group). Statistical significance was determined with ** representing p < 0.01 and * representing p < 0.05.
Figure 5. Osteogenic marker expression in He-HPL and Fd-HPL groups. The He-HPL group showed significantly higher expression of Runx2 and ALP compared to the Fd-HPL group. Data represent mean ± SEM (N = 3 per group). Statistical significance was determined with ** representing p < 0.01 and * representing p < 0.05.
Applsci 15 02074 g005
Figure 6. Concentrations of growth factors and cytokines in He-HPL and Fd-HPL. (A) BDNF, (B) VEGF, (C) IL-6, and (D) TNF-α. There were no notable differences in the concentrations of BDNF, VEGF, and IL-6 between He-HPL and Fd-HPL. However, Fd-HPL exhibited a decreased concentration of TNF-α compared to He-HPL. Values expressed as mean ± SEM (N = 6 per group). * represents p < 0.05.
Figure 6. Concentrations of growth factors and cytokines in He-HPL and Fd-HPL. (A) BDNF, (B) VEGF, (C) IL-6, and (D) TNF-α. There were no notable differences in the concentrations of BDNF, VEGF, and IL-6 between He-HPL and Fd-HPL. However, Fd-HPL exhibited a decreased concentration of TNF-α compared to He-HPL. Values expressed as mean ± SEM (N = 6 per group). * represents p < 0.05.
Applsci 15 02074 g006
Table 1. Primers used in RT-PCR.
Table 1. Primers used in RT-PCR.
GeneAccession NumberPrimer Sequence
GAPDHNM_002046Forward primer: ACCACAGTCCATGCCATCAC
Reverse primer: TCCACCACCCTGTTGCTGTA
ALPNM_000478Forward primer: GCTGTAAGGACATCGCCTACCA
Reverse primer: CCTGGCTTTCTCGTCACTCTCA
Col 1NM_000088Forward primer: GATTCCCTGGACCTAAAGGTGC
Reverse primer: AGCCTCTCCATCTTTGCCAGCA
OCNNM_199173Forward primer: CGCTACCTGTATCAATGGCTGG
Reverse primer: CTCCTGAAAGCCGATGTGGTCA
Runx 2NM_004348Forward primer: CCGCACGACAACCGCACCAT
Reverse primer: CGCTGGGGCCCACAAATCTC
OPNNM_000582Forward primer: CGAGGTGATAGTGTGGTTTATGG
Reverse primer: GCACCATTCAACTCCTCGCTTTC
BSPNM_004967Forward primer: GGCAGTAGTGACTCATCCGAAG
Reverse primer: GAAAGTGTGGTATTCTCAGCCTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kamaruddin, M.R.; Baharuddin, B.Z.; Ratha Manaalan, N.; Wong, Y.L.; Hassan, M.N.F.; Abdul Aziz, S.; Muttiah, B.; Law, J.X. Effect of Different Forms of Human Platelet Lysate on the Proliferation and Phenotype of Human Osteoblasts. Appl. Sci. 2025, 15, 2074. https://doi.org/10.3390/app15042074

AMA Style

Kamaruddin MR, Baharuddin BZ, Ratha Manaalan N, Wong YL, Hassan MNF, Abdul Aziz S, Muttiah B, Law JX. Effect of Different Forms of Human Platelet Lysate on the Proliferation and Phenotype of Human Osteoblasts. Applied Sciences. 2025; 15(4):2074. https://doi.org/10.3390/app15042074

Chicago/Turabian Style

Kamaruddin, Mohamad Raihan, Bahiratuz Zulfa Baharuddin, Nahgeshwarie Ratha Manaalan, Yi Lyn Wong, Muhammad Najib Fathi Hassan, Suria Abdul Aziz, Barathan Muttiah, and Jia Xian Law. 2025. "Effect of Different Forms of Human Platelet Lysate on the Proliferation and Phenotype of Human Osteoblasts" Applied Sciences 15, no. 4: 2074. https://doi.org/10.3390/app15042074

APA Style

Kamaruddin, M. R., Baharuddin, B. Z., Ratha Manaalan, N., Wong, Y. L., Hassan, M. N. F., Abdul Aziz, S., Muttiah, B., & Law, J. X. (2025). Effect of Different Forms of Human Platelet Lysate on the Proliferation and Phenotype of Human Osteoblasts. Applied Sciences, 15(4), 2074. https://doi.org/10.3390/app15042074

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop