Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Organisms and Exposure Experiment Conditions
2.2. Identification of AK and Phylogenetic Analysis
2.3. Total RNA Extraction and cDNA Synthesis
2.4. Gene Expression Analysis of M. japonicus AK
2.5. Statistical Analysis
3. Results and Discussion
3.1. Expression of proPO System-Related Genes in Gonads After Exposure to EDCs
3.2. Expression Analysis of AK Genes in M. japonicus Following Irgarol Exposure
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Silva, E.R.; Ferreira, O.; Ramalho, P.A.; Azevedo, N.F.; Bayón, R.; Igartua, A.; Bordado, J.C.; Calhorda, M.J. Eco-friendly non-biocide-release coatings for marine biofouling prevention. Sci. Total Environ. 2019, 650, 2499–2511. [Google Scholar] [CrossRef] [PubMed]
- Beyer, J.; Song, Y.; Tollefsen, K.E.; Berge, J.A.; Tveiten, L.; Helland, A.; Øxnevad, S.; Schøyen, M. The ecotoxicology of marine tributyltin (TBT) hotspots: A review. Mar. Environ. Res. 2022, 179, 105689. [Google Scholar] [CrossRef]
- Sapozhnikova, Y.; Wirth, E.; Schiff, K.; Fulton, M. Antifouling biocides in water and sediments from California marinas. Mar. Pollut. Bull. 2013, 69, 189–194. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.L. Occurrence and persistence of antifouling biocide Irgarol 1051 and its main metabolite in the coastal waters of Southern England. Sci. Total Environ. 2008, 406, 239–246. [Google Scholar] [CrossRef] [PubMed]
- Eriksson, K.M.; Antonelli, A.; Nilsson, R.H.; Clarke, A.K.; Blanck, H. A phylogenetic approach to detect selection on the target site of the antifouling compound irgarol in tolerant periphyton communities. Environ. Microbiol. 2009, 11, 2065–2077. [Google Scholar] [CrossRef] [PubMed]
- Kaamoush, M.I.A. Biological monitoring of inhibitory effects of antifouling agent Irgarol 1051 on growth and essential metabolites of marine alga Chlorella salina. Int. Marit. Transp. Logist. J. 2022, 11, 145–158. [Google Scholar] [CrossRef]
- Zhang, A.Q.; Zhou, G.-J.; Lam, M.H.W.; Leung, K.M.Y. Toxicities of the degraded mixture of Irgarol 1051 to marine organisms. Chemosphere 2019, 225, 565–573. [Google Scholar] [CrossRef]
- Ali, H.R.; Arifin, M.M.; Sheikh, M.A.; Shazili, N.A.M.; Bachok, Z. Occurrence and distribution of antifouling biocide Irgarol-1051 in coastal waters of Peninsular Malaysia. Mar. Pollut. Bull. 2013, 70, 253–257. [Google Scholar] [CrossRef]
- Sheikh, M.A.; Juma, F.S.; Staehr, P.; Dahl, K.; Rashid, R.J.; Mohammed, M.S.; Ussi, A.M.; Ali, H.R. Occurrence and distribution of antifouling biocide Irgarol-1051 in coral reef ecosystems, Zanzibar. Mar. Pollut. Bull. 2016, 109, 586–590. [Google Scholar] [CrossRef]
- Park, K.; Nikapitiya, C.; Kim, W.-S.; Kwak, T.-S.; Kwak, I.-S. Changes of exoskeleton surface roughness and expression of crucial participation genes for chitin formation and digestion in the mud crab (Macrophthalmus japonicus) following the antifouling biocide irgarol. Ecotoxicol. Environ. Saf. 2016, 132, 186–195. [Google Scholar] [CrossRef]
- Koo, B.J.; Kim, S.-H.; Hyun, J.-H. Feeding behavior of the ocypodid crab Macrophthalmus japonicus and its effects on oxygen-penetration depth and organic-matter removal in intertidal sediments. Estuar. Coast. Shelf Sci. 2019, 228, 106366. [Google Scholar] [CrossRef]
- Otani, S.; Kozuki, Y. Growth characteristics and population dynamics of Macrophthalmus japonicus with decreasing microphytobenthos biomass in muddy estuarine tidal flat. Reg. Stud. Mar. Sci. 2024, 72, 103436. [Google Scholar] [CrossRef]
- Park, K.; Kwak, T.-S.; Kim, W.-S.; Kwak, I.-S. Changes in exoskeleton surface roughness and expression of chitinase genes in mud crab Macrophthalmus japonicus following heavy metal differences of estuary. Mar. Pollut. Bull. 2019, 138, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Nikapitiya, C.; Kim, W.-S.; Park, K.; Kwak, I.-S. Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus). Fish. Shellfish Immun. 2014, 41, 407–416. [Google Scholar] [CrossRef]
- Brady, J.P.; Ayoko, G.A.; Martens, W.N.; Goonetilleke, A. Development of a hybrid pollution index for heavy metals in marine and estuarine sediments. Environ. Monit. Assess. 2015, 187, 306. [Google Scholar] [CrossRef]
- Pan, K.; Wang, W.-X. Trace metal contamination in estuarine and coastal environments in China. Sci. Total Environ. 2012, 421, 3–16. [Google Scholar] [CrossRef]
- Laino, A.; Lopez-Zavala, A.A.; Garcia-Orozco, K.D.; Carrasco-Miranda, J.S.; Santana, M.; Stojanoff, V.; Sotelo-Mundo, R.R.; Garcia, C.F. Biochemical and structural characterization of a novel arginine kinase from the spider Polybetes pythagoricus. PeerJ 2017, 5, e3787. [Google Scholar] [CrossRef]
- Yousef, M.S.; Clark, S.A.; Pruett, P.K.; Somasundaram, T.; Ellington, W.R.; Chapman, M.S. Induced fit in guanidino kinases—Comparison of substrate-free and transition state analog structures of arginine kinase. Protein Sci. 2003, 12, 103–111. [Google Scholar] [CrossRef]
- Bragg, J.; Rajkovic, A.; Anderson, C.; Curtis, R.; Houten, J.V.; Begres, B.; Naples, C.; Snider, M.; Fraga, D.; Singer, M. Identification and Characterization of a Putative Arginine Kinase Homolog from Myxococcus xanthus Required for Fruiting Body Formation and Cell Differentiation. J. Bacteriol. 2012, 194, 2668–2676. [Google Scholar] [CrossRef]
- Wu, Q.-Y.; Li, F.; Wang, X.-Y. Val65 plays an important role in the substrate synergism, structural stability and activity of arginine kinase. Int. J. Biol. Macromol. 2009, 45, 393–398. [Google Scholar] [CrossRef]
- Tong, B.C.; Barbul, A. Cellular and physiological effects of arginine. Mini Rev. Med. Chem. 2004, 4, 823–832. [Google Scholar] [CrossRef] [PubMed]
- Yin, S.J.; Zhang, L.; Zhang, L.; Wan, J.; Song, W.; Jiang, X.; Park, Y.D.; Si, Y.X. Metabolic responses and arginine kinase expression of juvenile cuttlefish (Sepia pharaonis) under salinity stress. Int. J. Biol. Macromol. 2018, 113, 881–888. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.; Luo, H.; Wu, J.; Hung, T.C.; Cao, B.; Liu, X.; Yang, J.; Yang, P. A review of the emerging risks of acute ammonia nitrogen toxicity to aquatic decapod crustaceans. Water 2022, 15, 27. [Google Scholar] [CrossRef]
- Vogt, É.L.; Model, J.F.; Vinagre, A.S. Effects of organotins on crustaceans: Update and perspectives. Front. Endocrinol. 2018, 9, 65. [Google Scholar] [CrossRef]
- Thor, P.; Vermandele, F.; Bailey, A.; Guscelli, E.; Loubet-Sartrou, L.; Dupont, S.; Calosi, P. Ocean acidification causes fundamental changes in the cellular metabolism of the Arctic copepod Calanus glacialis as detected by metabolomic analysis. Sci. Rep. 2022, 12, 22223. [Google Scholar] [CrossRef]
- Kim, W.-S.; Park, K.; Kim, J.-H.; Kwak, I.-S. Effect of endocrine-disrupting chemicals on the expression of a calcium ion channel receptor (ryanodine receptor) in the mud crab (Macrophthalmus japonicus). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2024, 283, 109972. [Google Scholar] [CrossRef]
- Park, K.; Kim, W.-S.; Choi, B.; Kwak, I.-S. Expression Levels of the Immune-Related p38 Mitogen-Activated Protein Kinase Transcript in Response to Environmental Pollutants on Macrophthalmus japonicus Crab. Genes 2020, 11, 958. [Google Scholar] [CrossRef]
- Pereira, C.A.; Alonso, G.D.; Paveto, M.C.; Iribarren, A.; Cabanas, M.L.; Torres, H.N.; Flawiá, M.M. Trypanosoma cruzi Arginine Kinase Characterization and Cloning A Novel Energetic Pathway in Protozoan Parasites. J. Biol. Chem. 2020, 275, 1495–1501. [Google Scholar] [CrossRef]
- Si, Y.-X.; Song, J.-J.; Fang, N.-Y.; Wang, W.; Wang, Z.-J.; Yang, J.-M.; Qian, G.-Y.; Yin, S.-J.; Park, Y.-D. Purification, characterization, and unfolding studies of arginine kinase from Antarctic krill. Int. J. Biol. Macromol. 2014, 67, 426–432. [Google Scholar] [CrossRef]
- Arockiaraj, J.; Vanaraja, P.; Easwvaran, S.; Singh, A.; Alinejaid, T.; Othman, R.Y.; Bhassu, S. Gene profiling and characterization of arginine kinase-1 (MrAK-1) from freshwater giant prawn (Macrobrachium rosenbergii). Fish Shellfish Immunol. 2011, 31, 81–89. [Google Scholar] [CrossRef]
- Yao, C.-L.; Ji, P.-F.; Kong, P.; Wang, Z.-Y.; Xiang, J.-H. Arginine kinase from Litopenaeus vannamei: Cloning, expression and catalytic properties. Fish Shellfish Immunol. 2009, 26, 553–558. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Hong, H.; Yang, D.; Li, J.; Chen, S.; Pan, C.; Lu, H.; Liu, J.; Yan, C. Health risk assessment of heavy metal and its mitigation by glomalin-related soil protein in sediments along the South China coast. Environ. Pollut. 2020, 263, 114565. [Google Scholar] [CrossRef] [PubMed]
- Kamei, Y.; Hatazawa, Y.; Uchitomi, R.; Yoshimura, R.; Miura, S. Regulation of skeletal muscle function by amino acids. Nutrients 2020, 12, 261. [Google Scholar] [CrossRef]
- Liang, B.; Wang, L.; He, T.; Liu, W.; Li, Q.; Li, M. In vitro reactive oxygen species production by mitochondria from the rabbitfish Siganus fuscessens livers and the effects of Irgarol-1051. Environ. Toxicol. Pharmacol. 2013, 35, 154–160. [Google Scholar] [CrossRef] [PubMed]
- Bao, V.W.; Leung, K.M.; Lui, G.C.; Lam, M.H. Acute and chronic toxicities of Irgarol alone and in combination with copper to the marine copepod Tigriopus japonicus. Chemosphere 2013, 90, 1140–1148. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.H.; Eom, H.J.; Kim, M.; Jung, J.H.; Rhee, J.S. Non-target effects of antifouling agents on mortality, hatching success, and acetylcholinesterase activity in the brine shrimp Artemia salina. ToxEHS 2017, 9, 237–243. [Google Scholar] [CrossRef]
- Jagiello, Z.; Dylewski, Ł.; Szulkin, M. The plastic homes of hermit crabs in the Anthropocene. Sci. Total Environ. 2024, 913, 168959. [Google Scholar] [CrossRef]
- Zheng, J.; Cai, L.; Jia, Y.; Chi, M.; Cheng, S.; Liu, S.; Li, F.; Gu, Z. Identification and functional analysis of the doublesex gene in the redclaw crayfish, Cherax quadricarinatus. Gene Expr. Patterns 2020, 37, 119129. [Google Scholar] [CrossRef]
- Kim, N.S.; Shim, W.J.; Yim, U.H.; Hong, S.H.; Ha, S.Y.; Han, G.M.; Shin, K.H. Assessment of TBT and organic booster biocide contamination in seawater from coastal areas of South Korea. Mar. Pollut. Bull. 2014, 78, 201–208. [Google Scholar] [CrossRef]
- Saleh, A.; Molaei, S.; Fumani, N.S.; Abedi, E. Antifouling paint booster biocides (Irgarol 1051 and diuron) in marinas and ports of Bushehr, Persian Gulf. Mar. Pollut. Bull. 2016, 105, 367–372. [Google Scholar] [CrossRef]
- Batista-Andrade, J.A.; Caldas, S.S.; de Oliveira Arias, J.L.; Castro, I.B.; Fillmann, G.; Primel, E.G. Antifouling booster biocides in coastal waters of Panama: First appraisal in one of the busiest shipping zones. Mar. Pollut. Bull. 2016, 112, 415–419. [Google Scholar] [CrossRef] [PubMed]
- Kaonga, C.C.; Takeda, K.; Sakugawa, H. Concentration and degradation of alternative biocides and an insecticide in surface waters and their major sinks in a semi-enclosed sea, Japan. Chemosphere 2016, 145, 256–264. [Google Scholar] [CrossRef] [PubMed]
- Lam, N.H.; Jeong, H.H.; Kang, S.D.; Kim, D.J.; Ju, M.J.; Horiguchi, T.; Cho, H.S. Organotins and new antifouling biocides in water and sediments from three Korean Special Management Sea Areas following ten years of tributyltin regulation: Contamination profiles and risk assessment. Mar. Pollut. Bull. 2017, 121, 302–312. [Google Scholar] [CrossRef] [PubMed]
- Harino, H.; Ohji, M.; Kono, K.; Onduka, T.; Hano, T.; Mochida, K. Current Status of Antifouling Biocides Contamination in the Seto Inland Sea, Japan. Arch. Environ. Contam. Toxicol. 2023, 85, 333–348. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Wu, D.; Li, Y.; Chen, Q.; Zhao, Y. Characterization and expression of arginine kinase 2 from Macrobrachium nipponense in response to salinity stress. Dev. Comp. Immunol. 2020, 113, 103804. [Google Scholar] [CrossRef]
- Yang, Z.; Huang, X.; Liao, H.; Zhang, Z.; Sun, F.; Kou, S.; Bao, Z. Structure and functional analysis reveal an important regulated role of arginine kinase in Patinopecten yessoensis under low pH stress. Aquat. Toxicol. 2020, 222, 105452. [Google Scholar] [CrossRef]
- Xie, Y.; Gong, J.; Ye, H.; Huang, H.; Yang, Y. Molecular Characteristic and Responsive Expression of Arginine Kinase in the Mud Crab, Scylla paramamosain. J. World Aquac. Soc. 2014, 45, 127–137. [Google Scholar] [CrossRef]
- Guo, S.-Y.; Guo, Z.; Guo, Q.; Chen, B.-Y.; Wang, X.-C. Expression, purification, and characterization of arginine kinase from the sea cucumber Stichopus japonicus. Protein Expr. Purif. 2003, 29, 230–234. [Google Scholar] [CrossRef]
- Qi, C.; Li, J.; Huang, K.; Wang, X.; Qin, C.; Li, E.; Qin, J.; Chen, L. The regulatory effects of arginine on ovary development in the Chinese mitten crab Eriocheir sinensis. Aquac. Rep. 2024, 37, 102277. [Google Scholar] [CrossRef]
- Kotlyar, S.; Weihrauch, D.; Paulsen, R.S.; Towle, D.W. Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus. J. Exp. Biol. 2000, 203, 2395–2404. [Google Scholar] [CrossRef]
- McNamara, J.C.; Faria, S.C. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: A review. J. Comp. Physiol. B 2012, 182, 997–1014. [Google Scholar] [CrossRef]
- Park, K.; Kim, W.-S.; Kwak, I.-S. Endocrine-disrupting chemicals impair the innate immune prophenoloxidase system in the intertidal mud crab, Macrophthalmus japonicus. Fish Shellfish Immun. 2019, 87, 322–332. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence | Amplification Size (bp) | Efficiency (%) | Accession Number |
---|---|---|---|---|
AK | TACGACATCTCCAACAAGCG | 75 | 96 | KJ653259 |
AAGAATACCGTCCTGCATCTCC | ||||
GAPDH | TGCTGATGCACCCATGTTTG | 147 | 105 | KJ653265 |
AGGCCCTGGACAATCTCAAAG |
Source | Country | Type | Concentration (ng L−1) | Reference |
---|---|---|---|---|
Water | Peninsular Malaysia | Coast, Marine | 2021.00 | [8] |
California | Coast | 254.00 | [3] | |
South Korea | Coast, Marine | 14.10 | [39] | |
Iran, Bushehr | Coast, Marine | 63.40 | [40] | |
Zanzibar | Coast | 15.44 | [9] | |
Panama | Coast, Marine | 5.00 | [41] | |
Sediment | California | Coast | 9.00 | [3] |
Iran, Bushehr | Coast, Marine | 35.40 | [40] | |
Japan | Ocean | 61.00 | [42] | |
South Korea | Coast | 7.79 | [43] | |
Japan | Coast, Marine | 128.00 | [44] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, W.-S.; Park, K.; Park, J.; Kwak, I.-S. Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Appl. Sci. 2025, 15, 2489. https://doi.org/10.3390/app15052489
Kim W-S, Park K, Park J, Kwak I-S. Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Applied Sciences. 2025; 15(5):2489. https://doi.org/10.3390/app15052489
Chicago/Turabian StyleKim, Won-Seok, Kiyun Park, Jiwon Park, and Ihn-Sil Kwak. 2025. "Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure" Applied Sciences 15, no. 5: 2489. https://doi.org/10.3390/app15052489
APA StyleKim, W.-S., Park, K., Park, J., & Kwak, I.-S. (2025). Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Applied Sciences, 15(5), 2489. https://doi.org/10.3390/app15052489