Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation and Confirmation of Microbial Isolates
2.3. Phylogroup and Genus Assignment of E. coli and Coliform Isolates Respectively
2.4. Antibiotic Susceptibility Testing
3. Results
3.1. Characterization of Microbial Isolates
3.2. Antibiotic Susceptibility Testing (AST) of Microbial Isolates
3.3. Antibiotic Resistance of Microbial Isolates
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- UN Sustainable Development Goal 6 on Clean Water and Sanitation (SDG 6): EU Support Through Focused Action; European Parliament. Available online: https://www.europarl.europa.eu/thinktank/en/document/EPRS_BRI(2023)751404 (accessed on 9 January 2025).
- WHO/UNICEF Joint Monitoring Programme for Water Supply, Sanitation and Hygiene. Progress on Household Drinking Water, Sanitation and Hygiene 2000–2022: Special Focus on Gender; United Nations Children’s Fund (UNICEF) and World Health Organization (WHO): New York, NY, USA, 2023. [Google Scholar]
- Kristanti, R.A.; Hadibarata, T.; Syafrudin, M.; Yılmaz, M.; Abdullah, S. Microbiological Contaminants in Drinking Water: Current Status and Challenges. Water Air Soil Pollut. 2022, 233, 299. [Google Scholar] [CrossRef]
- Potgieter, N.; Hoffman, A.N.T. The Relevance of Hygiene to Health in Developing Countries; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef]
- Han, X.; Liu, X.; Gao, D.; Ma, B.; Gao, X.; Cheng, M. Costs and Benefits of the Development Methods of Drinking Water Quality Index: A Systematic Review. Ecol. Indic. 2022, 144, 109501. [Google Scholar] [CrossRef]
- OECD. Financing Water Supply, Sanitation and Flood Protection: Challenges in EU Member States and Policy Options; OECD Studies on Water; OECD: Paris, France, 2020. [Google Scholar] [CrossRef]
- Khatri, N.; Tyagi, S. Influences of Natural and Anthropogenic Factors on Surface and Groundwater Quality in Rural and Urban Areas. Front. Life Sci. 2015, 8, 23–39. [Google Scholar] [CrossRef]
- Kirschke, S.; Avellán, T.; Bärlund, I.; Bogardi, J.J.; Carvalho, L.; Chapman, D.; Dickens, C.W.S.; Irvine, K.; Lee, S.; Mehner, T.; et al. Capacity Challenges in Water Quality Monitoring: Understanding the Role of Human Development. Environ. Monit. Assess 2020, 192, 298. [Google Scholar] [CrossRef] [PubMed]
- Shayo, G.M.; Elimbinzi, E.; Shao, G.N.; Fabian, C. Severity of Waterborne Diseases in Developing Countries and the Effectiveness of Ceramic Filters for Improving Water Quality. Bull. Natl. Res. Cent. 2023, 47, 113. [Google Scholar] [CrossRef]
- Mills, F.; Willetts, J.; Evans, B.; Carrard, N.; Kohlitz, J. Costs, Climate and Contamination: Three Drivers for Citywide Sanitation Investment Decisions. Front. Environ. Sci. 2020, 8, 130. [Google Scholar] [CrossRef]
- Endale, H.; Mathewos, M.; Abdeta, D. Potential Causes of Spread of Antimicrobial Resistance and Preventive Measures in One Health Perspective-A Review. Infect. Drug Resist. 2023, 16, 7515–7545. [Google Scholar] [CrossRef]
- Araújo, L.; Silva, S.; Sá, R.; Lima, A.; Barbosa, A.; Silva, J.; Leite, K.; Júnior, W.; Silveira-Filho, V.; Mendes-Marques, C.; et al. Effects of Antibiotics on Impacted Aquatic Environment Microorganisms; IntechOpen: London, UK, 2020. [Google Scholar] [CrossRef]
- Harrower, J.; McNaughtan, M.; Hunter, C.; Hough, R.; Zhang, Z.; Helwig, K. Chemical Fate and Partitioning Behavior of Antibiotics in the Aquatic Environment—A Review. Environ. Toxicol. Chem. 2021, 40, 3275–3298. [Google Scholar] [CrossRef]
- Kusi, J.; Ojewole, C.O.; Ojewole, A.E.; Nwi-Mozu, I. Antimicrobial Resistance Development Pathways in Surface Waters and Public Health Implications. Antibiotics 2022, 11, 821. [Google Scholar] [CrossRef]
- European Parliament; Council of the European Union. Directive (EU) 2020/2184 on the quality of water intended for human consumption. Off. J. Eur. Union 2020, L435, 1–62. Available online: https://eur-lex.europa.eu/eli/dir/2020/2184/oj (accessed on 9 January 2025).
- ISO 9308-1:2014; Water Quality—Enumeration of Escherichia coli and Coliform Bacteria—Part 1: Membrane Filtration Method for Waters with Low Bacterial Background Flora. International Organization for Standardization (ISO): Geneva, Switzerland, 2014.
- ISO/IEC 17025:2017; General Requirements for the Competence of Testing and Calibration Laboratories. International Organization for Standardization (ISO): Geneva, Switzerland; International Electrotechnical Commision (IEC): Geneva, Switzerland, 2017.
- Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Clermont, O.; Dixit, O.V.A.; Vangchhia, B.; Condamine, B.; Dion, S.; Bridier-Nahmias, A.; Denamur, E.; Gordon, D. Characterization and rapid identification of phylogroup G in Escherichia coli, a lineage with high virulence and antibiotic resistance potential. Environ. Microbiol. 2019, 21, 3107–3117. [Google Scholar] [CrossRef] [PubMed]
- Bej, A.K.; Steffan, R.J.; DiCesare, J.; Haff, L.; Atlas, R.M. Detection of Coliform Bacteria in Water by Polymerase Chain Reaction and Gene Probes. Appl. Environ. Microbiol. 1990, 56, 307–314. [Google Scholar] [CrossRef]
- Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol; American Society for Microbiology: Washington, DC, USA, 2009; pp. 1–23. Available online: https://asm.org/protocols/kirby-bauer-disk-diffusion-susceptibility-test-pro (accessed on 9 January 2025).
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 14.0. Available online: https://www.eucast.org/clinical_breakpoints (accessed on 9 January 2025).
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Evans, B.R.; Leighton, F.A. A history of One Health. Sci. Tech. Rev. 2014, 33, 413–420. [Google Scholar] [CrossRef]
- Wen, X.; Chen, F.; Lin, Y.; Zhu, H.; Yuan, F.; Kuang, D.; Jia, Z.; Yuan, Z. Microbial Indicators and Their Use for Monitoring Drinking Water Quality—A Review. Sustainability 2020, 12, 2249. [Google Scholar] [CrossRef]
- Münster, P.; Kemper, N. Long-Term Analysis of Drinking Water Quality in Poultry and Pig Farms in Northwest Germany. Front. Anim. Sci. 2024, 5, 1467287. [Google Scholar] [CrossRef]
- Stec, J.; Kosikowska, U.; Mendrycka, M.; Stępień-Pyśniak, D.; Niedźwiedzka-Rystwej, P.; Bębnowska, D.; Hrynkiewicz, R.; Ziętara-Wysocka, J.; Grywalska, E. Opportunistic Pathogens of Recreational Waters with Emphasis on Antimicrobial Resistance—A Possible Subject of Human Health Concern. Int. J. Environ. Res. Public Health 2022, 19, 7308. [Google Scholar] [CrossRef]
- Andrzejak, T.; Raje, H.; LaFleur, G.; Willis, J.; Boopathy, R. Water Quality and Antibiotic Resistance in the Recreational Waters. Bioresour. Technol. 2023, 370, 128546. [Google Scholar] [CrossRef]
- Efstratiou, M.A.; Bountouni, M.; Kefalas, E. Spread of Antibiotic Resistance in Aquatic Environments: E. coli as a Case Study. Proceedings 2018, 2, 693. [Google Scholar] [CrossRef]
- Dioli, C.; Pappa, O.; Siatravani, E.; Bratakou, S.; Tatsiopoulos, A.; Giakkoupi, P.; Miriagou, V.; Beloukas, A. Molecular Characterization and Prevalence of Antimicrobial-Resistant Escherichia coli Isolates Derived from Clinical Specimens and Environmental Habitats. Microorganisms 2023, 11, 1399. [Google Scholar] [CrossRef] [PubMed]
- Kaliakatsos, A.; Gounaki, I.; Dokianakis, S.; Maragkaki, E.; Stasinakis, A.S.; Gyparakis, S.; Katsarakis, N.; Manios, T.; Fountoulakis, M.S.; Venieri, D. Treatment of Hospital Wastewater: Emphasis on Ecotoxicity and Antibiotic Resistance Genes. J. Chem. Technol. Biotechnol. 2024, 99, 2129–2138. [Google Scholar] [CrossRef]
- Kotzamanidis, C.; Malousi, A.; Paraskeva, A.; Vafeas, G.; Giantzi, V.; Hatzigiannakis, E.; Dalampakis, P.; Kinigopoulou, V.; Vrouhakis, I.; Zouboulis, A.; et al. River Waters in Greece: A Reservoir for Clinically Relevant Extended-Spectrum-β-Lactamases-Producing Escherichia coli. Sci. Total Environ. 2024, 941, 173554. [Google Scholar] [CrossRef]
- Kolokotsa, A.; Leotsinidis, M.; Kalavrouziotis, I.; Sazakli, E. Effects of Tourist Flows on Antibiotic Resistance in Wastewater of a Greek Island. J. Appl. Microbiol. 2021, 130, 516–527. [Google Scholar] [CrossRef] [PubMed]
- Larson, A.; Hartinger, S.M.; Riveros, M.; Salmon-Mulanovich, G.; Hattendorf, J.; Verastegui, H.; Huaylinos, M.L.; Mäusezahl, D. Antibiotic-Resistant Escherichia Coli in Drinking Water Samples from Rural Andean Households in Cajamarca, Peru. Am. J. Trop. Med. Hyg. 2019, 100, 1363–1368. [Google Scholar] [CrossRef]
- Ramatla, T.; Ramaili, T.; Lekota, K.E.; Ndou, R.; Mphuti, N.; Bezuidenhout, C.; Thekisoe, O. A Systematic Review and Meta-Analysis on Prevalence and Antimicrobial Resistance Profile of Escherichia Coli Isolated from Water in Africa (2000–2021). Heliyon 2023, 9, e16123. [Google Scholar] [CrossRef]
- Salamandane, A.; Alves, S.; Chambel, L.; Malfeito-Ferreira, M.; Brito, L. Characterization of Escherichia Coli from Water and Food Sold on the Streets of Maputo: Molecular Typing, Virulence Genes, and Antibiotic Resistance. Appl. Microbiol. 2022, 2, 133–147. [Google Scholar] [CrossRef]
- Bhowmik, A.; Shah, S.T.; Goswami, S.; Sirajee, A.S.; Ahsan, S. Predominance of Multidrug Resistant Escherichia Coli of Environmental Phylotype in Different Environments of Dhaka, Bangladesh. Trop. Med. Infect. Dis. 2023, 8, 226. [Google Scholar] [CrossRef]
- Rahimi, Z.; Malekzadegan, Y.; Bahador, A.; Azimzadeh, M.; Haghighi, M.A. Phylogenetic Study, Distribution of Virulence Genes and Antibiotic Resistance Profiles of Escherichia coli Isolated from Bushehr Coastal Water. Gene Rep. 2022, 26, 101473. [Google Scholar] [CrossRef]
- Nowicki, S.; deLaurent, Z.R.; de Villiers, E.P.; Githinji, G.; Charles, K.J. The Utility of Escherichia Coli as a Contamination Indicator for Rural Drinking Water: Evidence from Whole Genome Sequencing. PLoS ONE 2021, 16, e0245910. [Google Scholar] [CrossRef]
- Stoppe, N.d.C.; Silva, J.S.; Carlos, C.; Sato, M.I.Z.; Saraiva, A.M.; Ottoboni, L.M.M.; Torres, T.T. Worldwide Phylogenetic Group Patterns of Escherichia Coli from Commensal Human and Wastewater Treatment Plant Isolates. Front. Microbiol. 2017, 8, 2512. [Google Scholar] [CrossRef] [PubMed]
- Tettey, R.; Egyir, B.; Tettey, P.; Arko-Mensah, J.; Addo, S.O.; Owusu-Nyantakyi, C.; Boateng, W.; Fobil, J. Genomic Analysis of Multidrug-Resistant Escherichia Coli from Urban Environmental Water Sources in Accra, Ghana, Provides Insights into Public Health Implications. PLoS ONE 2024, 19, e0301531. [Google Scholar] [CrossRef]
- Koh, X.P.; Shen, Z.; Woo, C.F.; Yu, Y.; Lun, H.I.; Cheung, S.W.; Kwan, J.K.C.; Lau, S.C.K. Genetic and Ecological Diversity of Escherichia Coli and Cryptic Escherichia Clades in Subtropical Aquatic Environments. Front. Microbiol. 2022, 13, 811755. [Google Scholar] [CrossRef]
- Lübcke, P.; Heiden, S.E.; Homeier-Bachmann, T.; Bohnert, J.A.; Schulze, C.; Eger, E.; Schwabe, M.; Guenther, S.; Schaufler, K. Multidrug-Resistant High-Risk Clonal Escherichia Coli Lineages Occur along an Antibiotic Residue Gradient in the Baltic Sea. npj Clean Water 2024, 7, 94. [Google Scholar] [CrossRef]
- Dhengesu, D.; Lemma, H.; Asefa, L.; Tilahun, D. Antimicrobial Resistance Profile of Enterobacteriaceae and Drinking Water Quality Among Households in Bule Hora Town, South Ethiopia. Risk Manag. Healthc. Policy 2022, 15, 1569–1580. [Google Scholar] [CrossRef]
- Ghimire, B.; Pokhrel, M.K.; Banjara, M.; Rijal, K.R.; Ghimire, P. Antimicrobial Resistance in Escherichia Coli and Other Coliform Bacteria Isolated from Bagmati River. Tribhuvan Univ. J. Microbiol. 2023, 10, 95–104. [Google Scholar] [CrossRef]
- Araújo, S.; Silva, V.; de Lurdes Enes Dapkevicius, M.; Pereira, J.E.; Martins, Â.; Igrejas, G.; Poeta, P. Comprehensive Profiling of Klebsiella in Surface Waters from Northern Portugal: Understanding Patterns in Prevalence, Antibiotic Resistance, and Biofilm Formation. Water 2024, 16, 1297. [Google Scholar] [CrossRef]
- Ibrahim, G.; Mzula, A.; Makundi, I.; Mwega, E. Prevalence, Antimicrobial Susceptibility Profile of Citrobacter and Risk Factors Associated with Diarrheal Diseases in Water Wells in Urban West Region, Zanzibar. Open Access Libr. J. 2024, 11, 1–21. [Google Scholar] [CrossRef]
- Waegenaar, F.; García-Timermans, C.; Van Landuyt, J.; De Gusseme, B.; Boon, N. Impact of Operational Conditions on Drinking Water Biofilm Dynamics and Coliform Invasion Potential. Appl. Environ. Microbiol. 2024, 90, e0004224. [Google Scholar] [CrossRef]
- Oyewale, A.T.; Odetoyin, B.W.; Oluduro, A.O.; Adeniyi, I.F. Occurrence of Coliforms and Biofilm-Forming Bacteria in Raw, Treated, and Distributed Water from Two Waterwork Systems in Osun State, Southwestern Nigeria. J. Water Health 2024, 22, 673–688. [Google Scholar] [CrossRef]
- Sakkas, H.; Bozidis, P.; Ilia, A.; Mpekoulis, G.; Papadopoulou, C. Antimicrobial Resistance in Bacterial Pathogens and Detection of Carbapenemases in Klebsiella Pneumoniae Isolates from Hospital Wastewater. Antibiotics 2019, 8, 85. [Google Scholar] [CrossRef]
- Kalla, D.H.; Paila, D.M. A Study of Klebsiella Pneumoniae Isolated from Water Samples in and around Tirupati. Pharma Innov. J. 2023, 12, 413–417. [Google Scholar]
- Feng, J.; Zhou, L.; Zhao, X.; Chen, J.; Li, Z.; Liu, Y.; Ou, L.; Xie, Z.; Wang, M.; Yin, X.; et al. Evaluation of Environmental Factors and Microbial Community Structure in an Important Drinking-Water Reservoir across Seasons. Front. Microbiol. 2023, 14, 1091818. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.Y.; Jong, M.-C.; Acharya, K.; Liew, S.S.X.; Smith, D.R.; Noor, Z.Z.; Goodson, M.L.; Werner, D.; Graham, D.W.; Eswaran, J. Multidrug-Resistant Bacteria and Microbial Communities in a River Estuary with Fragmented Suburban Waste Management. J. Hazard. Mater. 2021, 405, 124687. [Google Scholar] [CrossRef] [PubMed]
- Hartinger, S.M.; Medina-Pizzali, M.L.; Salmon-Mulanovich, G.; Larson, A.J.; Pinedo-Bardales, M.; Verastegui, H.; Riberos, M.; Mäusezahl, D. Antimicrobial Resistance in Humans, Animals, Water and Household Environs in Rural Andean Peru: Exploring Dissemination Pathways through the One Health Lens. Int. J. Environ. Res. Public Health 2021, 18, 4604. [Google Scholar] [CrossRef]
- Gutkind, G.O.; Conza, J.D.; Power, P.; Radice, M. β-Lactamase-Mediated Resistance: A Biochemical, Epidemiological and Genetic Overview. Curr. Pharm. Des. 2013, 19, 164–208. [Google Scholar] [CrossRef]
- Bajaj, P.; Singh, N.S.; Virdi, J.S. Escherichia Coli β-Lactamases: What Really Matters. Front. Microbiol. 2016, 7, 417. [Google Scholar] [CrossRef]
- Ferro, P.; Morales, E.; Ticona, E.; Ferró-Gonzales, P.; Oblitas, A.; Ferró-Gonzáles, A.L. Water Quality and Phenotypic Antimicrobial Resistance in Isolated of E. Coli from Water for Human Consumption in Bagua, under One Health Approach. Heliyon 2024, 10, e23961. [Google Scholar] [CrossRef]
- Duarte, A.C.; Rodrigues, S.; Afonso, A.; Nogueira, A.; Coutinho, P. Antibiotic Resistance in the Drinking Water: Old and New Strategies to Remove Antibiotics, Resistant Bacteria, and Resistance Genes. Pharmaceuticals 2022, 15, 393. [Google Scholar] [CrossRef]
- Kalu, C.M.; Mudau, K.L.; Masindi, V.; Ijoma, G.N.; Tekere, M. Occurrences and Implications of Pathogenic and Antibiotic-Resistant Bacteria in Different Stages of Drinking Water Treatment Plants and Distribution Systems. Heliyon 2024, 10, e26380. [Google Scholar] [CrossRef]
- Kalli, M.; Noutsopoulos, C.; Mamais, D. The Fate and Occurrence of Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes during Advanced Wastewater Treatment and Disinfection: A Review. Water 2023, 15, 2084. [Google Scholar] [CrossRef]
- Makuwa, S.; Green, E.; Tlou, M.; Ndou, B.; Fosso-Kankeu, E. Molecular Classification and Antimicrobial Profiles of Chlorination-Resistant Escherichia Coli at Wastewater Treatment Plant in the North West Province of South Africa. Water Air Soil Pollut. 2023, 234, 490. [Google Scholar] [CrossRef]
- Umar, M. From Conventional Disinfection to Antibiotic Resistance Control—Status of the Use of Chlorine and UV Irradiation during Wastewater Treatment. Int. J. Environ. Res. Public Health 2022, 19, 1636. [Google Scholar] [CrossRef] [PubMed]
- Yu, D.; Ryu, K.; Zhi, S.; Otto, S.J.G.; Neumann, N.F. Naturalized Escherichia Coli in Wastewater and the Co-Evolution of Bacterial Resistance to Water Treatment and Antibiotics. Front. Microbiol. 2022, 13, 810312. [Google Scholar] [CrossRef] [PubMed]
- Nasrollahian, S.; Graham, J.P.; Halaji, M. A Review of the Mechanisms That Confer Antibiotic Resistance in Pathotypes of E. coli. Front. Cell. Infect. Microbiol. 2024, 14, 1387497. [Google Scholar] [CrossRef]
- Park, J.-H.; Bae, K.-S.; Kang, J.; Yoon, J.-K.; Lee, S.-H. Comprehensive Assessment of Multidrug-Resistant and Extraintestinal Pathogenic Escherichia Coli in Wastewater Treatment Plant Effluents. Microorganisms 2024, 12, 1119. [Google Scholar] [CrossRef] [PubMed]
- Kichana, E.; Opare-Boafoa, M.S.; Bekoe, E.M.O. Prevalence of Multidrug-Resistant Escherichia Coli in Household Drinking Water in Rural Ghana. J. Water Sanit. Hyg. Dev. 2022, 12, 862–868. [Google Scholar] [CrossRef]
- Lyimo, B.; Buza, J.; Subbiah, M.; Smith, W.; Call, D.R. Comparison of Antibiotic Resistant Escherichia Coli Obtained from Drinking Water Sources in Northern Tanzania: A Cross-Sectional Study. BMC Microbiol. 2016, 16, 254. [Google Scholar] [CrossRef]
- European Centre for Disease Prevention and Control. Antimicrobial Consumption in the EU/EEA (ESAC-Net)—Annual Epidemiological Report 2021; ECDC: Stockholm, Sweden, 2022. [Google Scholar]
- European Centre for Disease Prevention and Control and World Health Organization. Antimicrobial Resistance Surveillance in Europe 2023—2021 Data; European Centre for Disease Prevention and Control and World Health Organization: Stockholm, Sweden, 2023. [Google Scholar]
- Kritsotakis, E.I.; Lagoutari, D.; Michailellis, E.; Georgakakis, I.; Gikas, A. Burden of Multidrug and Extensively Drug-Resistant ESKAPEE Pathogens in a Secondary Hospital Care Setting in Greece. Epidemiol. Infect. 2022, 150, e170. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, Z.; Zheng, L.; Gong, Z.; Li, Y.; Jin, Y.; Huang, Y.; Chi, M. Urinary Tract Infections Caused by Uropathogenic Escherichia Coli: Mechanisms of Infection and Treatment Options. Int. J. Mol. Sci. 2023, 24, 10537. [Google Scholar] [CrossRef]
- Wanke-Rytt, M.; Sobierajski, T.; Lachowicz, D.; Seliga-Gąsior, D.; Podsiadły, E. Analysis of Etiology of Community-Acquired and Nosocomial Urinary Tract Infections and Antibiotic Resistance of Isolated Strains: Results of a 3-Year Surveillance (2020–2022) at the Pediatric Teaching Hospital in Warsaw. Microorganisms 2023, 11, 1438. [Google Scholar] [CrossRef] [PubMed]
- Whelan, S.; Lucey, B.; Finn, K. Uropathogenic Escherichia Coli (UPEC)-Associated Urinary Tract Infections: The Molecular Basis for Challenges to Effective Treatment. Microorganisms 2023, 11, 2169. [Google Scholar] [CrossRef] [PubMed]
- Akinjogunla, O.J.; Odeyemi, A.T.; Udofia, E.-A.S.; Adefiranye, O.O.; Yah, C.S.; Ehinmore, I.; Etukudo, I.U. Enterobacteriaceae Isolates from Clinical and Household Tap Water Samples: Antibiotic Resistance, Screening for Extended-Spectrum, Metallo- and ampC-Beta-Lactamases, and Detection of blaTEM, blaSHV and blaCTX-M in Uyo, Nigeria. Germs 2023, 13, 50–59. [Google Scholar] [CrossRef] [PubMed]
(A) | |||||
---|---|---|---|---|---|
Target | Oligonucleotide Sequence (5′-3′) | Product Size | Thermal Profile | ||
chuA | F: ATGGTACCGGACGAACCAAC R: TGCCGCCAGTACCAAAGACA | 288 | 95 °C for 10 min 95 °C for 20 s 59 °C * for 30 s 72 °C for 15 s 72 °C for 10 min | 30c | |
yjaA | F: CAAACGTGAAGTGTCAGGAG R: AATGCGTTCCTCAACCTGTG | 211 | |||
TspE4.C2 | F: CACTATTCGTAAGGTCATCC R: AGTTTATCGCTGCGGGTCGC | 152 | |||
arpA | F: AACGCTATTCGCCAGCTTGC R: TCTCCCCATACCGTACGCTA | 400 | |||
arpA | F: GATTCCATCTTGTCAAAATATGCC R: GAAAAGAAAAAGAATTCCCAAGAG | 301 | |||
trpA | F: AGTTTTATGCCCAGTGCGAG R: TCTGCGCCGGTCACGCCC | 219 | |||
cfaB | F: CTAACGTTGATGCTGCTCTG R: TGCTAACTACGCCACGGTAG | 384 | |||
ybgD | F: TATGCGGCTGATGAAGGATC R: GTTGACTAAGCGCAGGTCGA | 177 | |||
trpA Internal Control | F: CGGCGATAAAGACATCTTCAC R: GCAACGCGGCCTGGCGGAAG | 489 | |||
(B) | |||||
Target | Oligonucleotide Sequence (5′-3′) | Product Size | Thermal Profile | ||
lacZ | F: ATGAAAGCTGGCTACAGGAAGGCC R: CACCATGCCGTGGGTTTCAATATT | 876 | 95 °C for 5 min 95 °C for 30 s 60 °C for 30 s 72 °C for 45 s 72 °C for 10 min | 35c | |
lamB | F: GGATATTTCTGGTCCTGGTGCCGG R: ACTTGGTGCCGTTGTCGTTATCC | 554 |
(A) | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AM (%) | AMC (%) | CAZ (%) | CFR (%) | CTX (%) | FOX (%) | CIP (%) | CN (%) | MEM (%) | SXT (%) | TE (%) | |||||
Resistant | 36 (16.4) | 6 (2.7) | 2 (0.9) | 9 (4.1) | 1 (0.5) | 9 (4.1) | 4 (1.8) | 0 (0.0) | 0 (0.0) | 9 (4.1) | 21 (9.5) | ||||
Intermediate | 0 (0.0) | 0 (0.0) | 1 (0.5) | 0 (0.0) | 1 (0.5) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (0.9) | ||||
Susceptible | 184 (83.6) | 214 (97.3) | 217 (98.6) | 211 (95.9) | 218 (99.1) | 211 (95.9) | 216 (98.2) | 220 (100) | 220 (100) | 211 (95.9) | 197 (89.5) | ||||
Total | 220 | 220 | 220 | 220 | 220 | 220 | 220 | 220 | 220 | 220 | 220 | ||||
(B) | |||||||||||||||
AM (%) | AMC (%) | CAZ (%) | CFM (%) | CFR (%) | CTX (%) | CXM (%) | FEP (%) | FOX (%) | CIP (%) | CN (%) | IMP (%) | MEM (%) | SXT (%) | TE (%) | |
Resistant | 100 (72.5) | 62 (44.9) | 21 (15.2) | 6 (4.3) | 54 (39.1) | 21 (15.2) | 2 (1.4) | 0 (0.0) | 63 (45.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 3 (2.2) |
Intermediate | 0 (0.0) | 0 (0.0) | 1 (0.7) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (0.7) |
Susceptible | 38 (27.5) | 76 (55.1) | 116 (84.1) | 132 (95.7) | 84 (60.9) | 117 (84.8) | 136 (98.6) | 138 (100) | 75 (54.3) | 138 (100) | 138 (100) | 138 (100) | 138 (100) | 138 (100) | 134 (97.1) |
Total | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 | 138 |
Antibiotic Group | |||||||
---|---|---|---|---|---|---|---|
A (%) | B (%) | C (%) | D (%) | E (%) | F (%) | G (%) | |
E. coli | |||||||
MDR3 | 9 of 9 (100.0) | 3 of 9 (33.3) | 3 of 9 (33.3) | 0 of 9 (0.0) | 0 of 9 (0.0) | 4 of 9 (44.4) | 8 of 9 (88.9) |
MDR4 | 3 of 3 (100.0) | 2 of 3 (66.7) | 1 of 3 (33.3) | 0 of 3 (0.0) | 0 of 3 (0.0) | 3 of 3 (100.0) | 3 of 3 (100.0) |
Total | 12 of 12 (100.0) | 5 of 12 (41.7) | 4 of 12 (33.3) | 0 of 12 (0.0) | 0 of 12 (0.0) | 7 of 12 (58.3) | 11 of 12 (91.7) |
Coliforms | |||||||
MDR3 | 4 of 4 (100.0) | 4 of 4 (100.0) | 0 of 4 (0.0) | 0 of 4 (0.0) | 0 of 4 (0.0) | 0 of 4 (0.0) | 4 of 4 (100.0) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tzimotoudis, N.; Mataragka, A.; Andritsos, N.D.; Ikonomopoulos, J. Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Appl. Sci. 2025, 15, 2664. https://doi.org/10.3390/app15052664
Tzimotoudis N, Mataragka A, Andritsos ND, Ikonomopoulos J. Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Applied Sciences. 2025; 15(5):2664. https://doi.org/10.3390/app15052664
Chicago/Turabian StyleTzimotoudis, Nikolaos, Antonia Mataragka, Nikolaos D. Andritsos, and John Ikonomopoulos. 2025. "Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece" Applied Sciences 15, no. 5: 2664. https://doi.org/10.3390/app15052664
APA StyleTzimotoudis, N., Mataragka, A., Andritsos, N. D., & Ikonomopoulos, J. (2025). Antibiotic Susceptibility Testing of Escherichia coli and Coliform Isolates Detected in Samples of Drinking Water from Central Greece. Applied Sciences, 15(5), 2664. https://doi.org/10.3390/app15052664