Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Preparation and Incubation of Ophthalmic Arteries
2.3. Measurement of Vascular Reactivity
2.4. Quantification of Reactive Oxygen Species
2.5. Quantification of Prooxidant Redox Genes by Real-Time PCR
2.6. Immunofluorescence Analysis
2.7. Statistical Analysis
3. Results
3.1. Effects of Ang II on Endothelial Function
3.2. Responses of Ophthalmic Arteries after AT1R and AT2R Blockade
3.3. Endothelial Function and ROS Formation
3.4. Prooxidant Redox Enzyme Expression and Endothelial Function
3.5. Effects of Ang II on Vasodilatory Signaling Pathways
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Colafella, K.M.M.; Bovée, D.M.; Danser, A.J. The renin-angiotensin-aldosterone system and its therapeutic targets. Exp. Eye Res. 2019, 186, 107680. [Google Scholar] [CrossRef]
- Rajagopalan, S.; Kurz, S.; Münzel, T.; Tarpey, M.; Freeman, B.A.; Griendling, K.; Harrison, D.G. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J. Clin. Investig. 1996, 97, 1916–1923. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, D.; Chen, Y.; Chabrashvili, T.; Aslam, S.; Conde, L.J.B.; Umans, J.G.; Wilcox, C.S. Role of Oxidative Stress in Endothelial Dysfunction and Enhanced Responses to Angiotensin II of Afferent Arterioles from Rabbits Infused with Angiotensin II. J. Am. Soc. Nephrol. 2003, 14, 2783–2789. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gomolak, J.R.; Didion, S.P. Angiotensin II-induced endothelial dysfunction is temporally linked with increases in interleukin-6 and vascular macrophage accumulation. Front. Physiol. 2014, 5, 396. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Wang, M.; Xue, S.J.; Liu, D.H.; Tang, Y.B. Simvastatin ameliorates angiotensin II-induced endothelial dysfunction through restoration of Rho-BH4-eNOS-NO pathway. Cardiovasc. Drugs Ther. 2012, 26, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Wenzel, P.; Knorr, M.; Kossmann, S.; Stratmann, J.; Hausding, M.; Schuhmacher, S.; Karbach, S.H.; Schwenk, M.; Yogev, N.; Schulz, E.; et al. Lysozyme M-positive monocytes mediate angiotensin II-induced arterial hypertension and vascular dysfunction. Circulation 2011, 124, 1370–1381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oelze, M.; Kröller-Schön, S.; Steven, S.; Lubos, E.; Doppler, C.E.J.; Hausding, M.; Tobias, S.; Brochhausen, C.; Li, H.; Torzewski, M.; et al. Glutathione Peroxidase-1 Deficiency Potentiates Dysregulatory Modifications of Endothelial Nitric Oxide Synthase and Vascular Dysfunction in Aging. Hypertension 2014, 63, 390–396. [Google Scholar] [CrossRef] [Green Version]
- Wenzel, P.; Schuhmacher, S.; Kienhöfer, J.; Müller, J.; Hortmann, M.; Oelze, M.; Schulz, E.; Treiber, N.; Kawamoto, T.; Scharffetter-Kochanek, K.; et al. Manganese superoxide dismutase and aldehyde dehydrogenase deficiency increase mitochondrial oxidative stress and aggravate age-dependent vascular dysfunction. Cardiovasc. Res. 2008, 80, 280–289. [Google Scholar] [CrossRef]
- Kröller-Schön, S.; Steven, S.; Kossmann, S.; Scholz, A.; Daub, S.; Oelze, M.; Xia, N.; Hausding, M.; Mikhed, Y.; Zinßius, E.; et al. Molecular Mechanisms of the Crosstalk Between Mitochondria and NADPH Oxidase Through Reactive Oxygen Species—Studies in White Blood Cells and in Animal Models. Antioxid. Redox Signal. 2014, 20, 247–266. [Google Scholar] [CrossRef] [Green Version]
- Senanayake, P.D.; Drazba, J.; Shadrach, K.; Milsted, A.; Rungger-Brandle, E.; Nishiyama, K.; Miura, S.-I.; Karnik, S.; Sears, J.E.; Hollyfield, J.G. Angiotensin II and Its Receptor Subtypes in the Human Retina. Investig. Opthalmology Vis. Sci. 2007, 48, 3301–3311. [Google Scholar] [CrossRef] [Green Version]
- Ferrari-DiLeo, G.; Davis, E.B.; Anderson, D.R. Angiotensin II binding receptors in retinal and optic nerve head blood vessels. An autoradiographic approach. Investig. Ophthalmol. Vis. Sci. 1991, 32, 21–26. [Google Scholar]
- Sato, T.; Niwa, M.; Himeno, A.; Tsutsumi, K.; Amemiya, T. Quantitative receptor autoradiographic analysis for angiotensin II receptors in bovine retinal microvessels: Quantitation with radioluminography. Cell Mol. Neurobiol. 1993, 13, 233–245. [Google Scholar] [CrossRef]
- Rockwood, E.J.; Fantes, F.; Davis, E.B.; Anderson, D.R. The response of retinal vasculature to angiotensin. Investig. Ophthalmol. Vis. Sci. 1987, 28, 676–682. [Google Scholar]
- Nyborg, N.C.; Nielsen, P.J. Angiotensin-II contracts isolated human posterior ciliary arteries. Investig. Ophthalmol. Vis. Sci. 1990, 31, 2471–2473. [Google Scholar]
- Nyborg, N.C.; Nielsen, P.J.; Prieto, D.; Benedito, S. Angiotensin II does not contract bovine retinal resistance arteries in vitro. Exp. Eye Res. 1990, 50, 469–474. [Google Scholar] [CrossRef]
- Meyer, P.; Flammer, J.; Lüscher, T.F. Local action of the renin angiotensin system in the porcine ophthalmic circulation: Effects of ACE-inhibitors and angiotensin receptor antagonists. Investig. Ophthalmol. Vis. Sci. 1995, 36, 555–562. [Google Scholar]
- Wakisaka, M.; Yoshinari, M.; Nakamura, S.; Asano, T.; Sonoki, K.; Shi, A.-H.; Iwase, M.; Takata, Y.; Fujishima, M. Suppression of Sodium-Dependent Glucose Uptake by Captopril Improves High-Glucose-Induced Morphological and Functional Changes of Cultured Bovine Retinal Pericytes. Microvasc. Res. 1999, 58, 215–223. [Google Scholar] [CrossRef] [PubMed]
- Nadal, J.; Scicli, G.; Carbini, L.; Nussbaum, J.; Scicli, A. Angiotensin II and Retinal Pericytes Migration. Biochem. Biophys. Res. Commun. 1999, 266, 382–385. [Google Scholar] [CrossRef] [PubMed]
- Dubey, R.K.; Flammer, J.; Lüscher, T.F. Angiotensin II and insulin induce growth of ciliary artery smooth muscle: Effects of AT1/AT2 antagonists. Investig. Ophthalmol. Vis. Sci. 1998, 39, 2067–2075. [Google Scholar]
- Carbajo-Lozoya, J.; Lutz, S.; Feng, Y.; Kroll, J.; Hammes, H.-P.; Wieland, T. Angiotensin II modulates VEGF-driven angiogenesis by opposing effects of type 1 and type 2 receptor stimulation in the microvascular endothelium. Cell. Signal. 2012, 24, 1261–1269. [Google Scholar] [CrossRef]
- Otani, A.; Takagi, H.; Suzuma, K.; Honda, Y. Angiotensin II potentiates vascular endothelial growth factor-induced angiogenic activity in retinal microcapillary endothelial cells. Circ. Res. 1998, 82, 619–628. [Google Scholar] [CrossRef] [Green Version]
- Otani, A.; Takagi, H.; Oh, H.; Suzuma, K.; Matsumura, M.; Ikeda, E.; Honda, Y. Angiotensin II-stimulated vascular endothelial growth factor expression in bovine retinal pericytes. Investig. Ophthalmol. Vis. Sci. 2000, 41, 1192–1199. [Google Scholar]
- Larsen, M.; Hommel, E.; Parving, H.-H.; Lund-Andersen, H. Protective effect of captopril on the blood-retina barrier in normotensive insulin-dependent diabetic patients with nephropathy and background retinopathy. Graefe’s Arch. Clin. Exp. Ophthalmol. 1990, 228, 505–509. [Google Scholar] [CrossRef] [PubMed]
- Moravski, C.J.; Kelly, D.; Cooper, M.E.; Gilbert, R.E.; Bertram, J.F.; Shahinfar, S.; Skinner, S.L.; Wilkinson-Berka, J.L. Retinal neovascularization is prevented by blockade of the renin-angiotensin system. Hypertension 2000, 36, 1099–1104. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Kim, J.H.; Yu, Y.S.; Cho, C.S.; Kim, K.-W. Blockade of Angiotensin II Attenuates VEGF-Mediated Blood—Retinal Barrier Breakdown in Diabetic Retinopathy. Br. J. Pharmacol. 2008, 29, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, H.; Yamazaki, M.; Ohyama, T.; Inoue, T.; Arakawa, N.; Domon, Y.; Yokoyama, T. Role of Angiotensin II Type 1 Receptor on Retinal Vascular Leakage in a Rat Oxygen-Induced Retinopathy Model. Ophthalmic Res. 2009, 41, 210–215. [Google Scholar] [CrossRef]
- Nath, M.; Chandra, P.; Halder, N.; Singh, B.; Deorari, A.K.; Kumar, A.; Azad, R.; Velpandian, T. Involvement of Renin-Angiotensin System in Retinopathy of Prematurity—A Possible Target for Therapeutic Intervention. PLoS ONE 2016, 11, e0168809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okunuki, Y.; Usui, Y.; Nagai, N.; Kezuka, T.; Ishida, S.; Takeuchi, M.; Goto, H. Suppression of Experimental Autoimmune Uveitis by Angiotensin II Type 1 Receptor Blocker Telmisartan. Investig. Opthalmology Vis. Sci. 2009, 50, 2255–2261. [Google Scholar] [CrossRef] [Green Version]
- Qiu, Y.; Tao, L.; Zheng, S.; Lin, R.; Fu, X.; Chen, Z.; Lei, C.; Wang, J.; Li, H.; Li, Q.; et al. AAV8-Mediated Angiotensin-Converting Enzyme 2 Gene Delivery Prevents Experimental Autoimmune Uveitis by Regulating MAPK, NF-κB and STAT3 Pathways. Sci. Rep. 2016, 6, 31912. [Google Scholar] [CrossRef] [Green Version]
- Fukuda, K.; Hirooka, K.; Mizote, M.; Nakamura, T.; Itano, T.; Shiraga, F.; Tung, C.; Aquavella, J.; Zavislan, J.; Koh, S.; et al. Neuroprotection against Retinal Ischemia–Reperfusion Injury by Blocking the Angiotensin II Type 1 Receptor. Investig. Opthalmology Vis. Sci. 2010, 51, 3629–3638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Semba, K.; Namekata, K.; Guo, X.; Harada, C.; Harada, T.; Mitamura, Y. Renin–angiotensin system regulates neurodegeneration in a mouse model of normal tension glaucoma. Cell Death Dis. 2014, 5, e1333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quigley, H.A.; Pitha, I.F.; Welsbie, D.S.; Nguyen, C.; Steinhart, M.; Nguyen, T.D.; Pease, M.; Oglesby, E.N.; Berlinicke, C.A.; Mitchell, K.L.; et al. Losartan Treatment Protects Retinal Ganglion Cells and Alters Scleral Remodeling in Experimental Glaucoma. PLoS ONE 2015, 10, e0141137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hazlewood, R.J.; Chen, Q.; Clark, F.K.; Kuchtey, J.; Kuchtey, R.W. Differential effects of angiotensin II type I receptor blockers on reducing intraocular pressure and TGFbeta signaling in the mouse retina. PLoS ONE 2018, 13, e0201719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagai, N.; Kawashima, H.; Toda, E.; Homma, K.; Osada, H.; Guzman, N.A.; Shibata, S.; Uchiyama, Y.; Okano, H.; Tsubota, K.; et al. Renin–angiotensin system impairs macrophage lipid metabolism to promote age-related macular degeneration in mouse models. Commun. Biol. 2020, 3, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Didion, S.P.; Kinzenbaw, D.A.; Faraci, F.M. Critical role for CuZn-superoxide dismutase in preventing angiotensin II-induced endothelial dysfunction. Hypertension 2005, 46, 1147–1153. [Google Scholar] [CrossRef] [Green Version]
- Schrader, L.I.; Kinzenbaw, D.A.; Johnson, A.W.; Faraci, F.M.; Didion, S.P. IL-6 Deficiency Protects Against Angiotensin II–Induced Endothelial Dysfunction and Hypertrophy. Arter. Thromb. Vasc. Biol. 2007, 27, 2576–2581. [Google Scholar] [CrossRef] [Green Version]
- Helmstädter, J.; Frenis, K.; Filippou, K.; Grill, A.; Dib, M.; Kalinovic, S.; Pawelke, F.; Kus, K.; Kröller-Schön, S.; Oelze, M.; et al. Endothelial GLP-1 (Glucagon-Like Peptide-1) Receptor Mediates Cardiovascular Protection by Liraglutide In Mice With Experimental Arterial Hypertension. Arter. Thromb. Vasc. Biol. 2020, 40, 145–158. [Google Scholar] [CrossRef]
- Pollock, J.D.; Williams, D.A.; Gifford, M.A.; Li, L.L.; Du, X.; Fisherman, J.; Orkin, S.H.; Doerschuk, C.M.; Dinauer, M.C. Mouse model of X–linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production. Nat. Genet. 1995, 9, 202–209. [Google Scholar] [CrossRef]
- Gericke, A.; Mayer, V.G.A.; Steege, A.; Patzak, A.; Neumann, U.; Grus, F.H.; Joachim, S.C.; Choritz, L.; Wess, J.; Pfeiffer, N. Cholinergic responses of ophthalmic arteries in M3 and M5 muscarinic acetylcholine receptor knockout mice. Investig. Opthalmology Vis. Sci. 2009, 50, 4822–4827. [Google Scholar] [CrossRef]
- Gericke, A.; Steege, A.; Manicam, C.; Böhmer, T.; Wess, J.; Pfeiffer, N. Role of the M3 Muscarinic Acetylcholine Receptor Subtype in Murine Ophthalmic Arteries After Endothelial Removal. Investig. Opthalmology Vis. Sci. 2014, 55, 625–631. [Google Scholar] [CrossRef] [Green Version]
- Manicam, C.; Staubitz, J.; Brochhausen, C.; Grus, F.H.; Pfeiffer, N.; Gericke, A. The Gatekeepers in the Mouse Ophthalmic Artery: Endothelium-Dependent Mechanisms of Cholinergic Vasodilation. Sci. Rep. 2016, 6, 20322. [Google Scholar] [CrossRef] [Green Version]
- Manicam, C.; Ginter, N.; Li, H.; Xia, N.; Goloborodko, E.; Zadeh, J.K.; Musayeva, A.; Pfeiffer, N.; Gericke, A. Compensatory Vasodilator Mechanisms in the Ophthalmic Artery of Endothelial Nitric Oxide Synthase Gene Knockout Mice. Sci. Rep. 2017, 7, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Frenis, K.; Helmstädter, J.; Ruan, Y.; Schramm, E.; Kalinovic, S.; Kröller-Schön, S.; Jimenez, M.T.B.; Hahad, O.; Oelze, M.; Jiang, S.; et al. Ablation of lysozyme M-positive cells prevents aircraft noise-induced vascular damage without improving cerebral side effects. Basic Res. Cardiol. 2021, 116, 1–20. [Google Scholar] [CrossRef]
- Zadeh, J.K.; Ruemmler, R.; Hartmann, E.K.; Ziebart, A.; Ludwig, M.; Patzak, A.; Xia, N.; Li, H.; Pfeiffer, N.; Gericke, A. Responses of retinal arterioles and ciliary arteries in pigs with acute respiratory distress syndrome (ARDS). Exp. Eye Res. 2019, 184, 152–161. [Google Scholar] [CrossRef] [PubMed]
- Schröder, K.; Vecchione, C.; Jung, O.; Schreiber, J.G.; Shiri-Sverdlov, R.; van Gorp, P.J.; Busse, R.; Brandes, R.P. Xanthine oxidase inhibitor tungsten prevents the development of atherosclerosis in ApoE knockout mice fed a Western-type diet. Free. Radic. Biol. Med. 2006, 41, 1353–1360. [Google Scholar] [CrossRef] [PubMed]
- Gericke, A.; Mann, C.; Zadeh, J.K.; Musayeva, A.; Wolff, I.; Wang, M.; Pfeiffer, N.; Daiber, A.; Li, H.; Xia, N.; et al. Elevated Intraocular Pressure Causes Abnormal Reactivity of Mouse Retinal Arterioles. Oxidative Med. Cell. Longev. 2019, 2019, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gericke, A.; Wolff, I.; Musayeva, A.; Zadeh, J.K.; Manicam, C.; Pfeiffer, N.; Li, H.; Xia, N. Retinal arteriole reactivity in mice lacking the endothelial nitric oxide synthase (eNOS) gene. Exp. Eye Res. 2019, 181, 150–156. [Google Scholar] [CrossRef]
- Welch, W.J.; Wilcox, C.S. AT1 receptor antagonist combats oxidative stress and restores nitric oxide signaling in the SHR. Kidney Int. 2001, 59, 1257–1263. [Google Scholar] [CrossRef] [Green Version]
- Wong, W.T.; Tian, X.Y.; Xu, A.; Ng, C.F.; Lee, H.K.; Chen, Z.Y.; Au, C.L.; Yao, X.; Huang, Y. Angiotensin II Type 1 Receptor-Dependent Oxidative Stress Mediates Endothelial Dysfunction in Type 2 Diabetic Mice. Antioxid. Redox Signal. 2010, 13, 757–768. [Google Scholar] [CrossRef] [Green Version]
- Nagai, N.; Izumi-Nagai, K.; Oike, Y.; Koto, T.; Satofuka, S.; Ozawa, Y.; Yamashiro, K.; Inoue, M.; Tsubota, K.; Umezawa, K.; et al. Suppression of diabetes-induced retinal inflammation by blocking the angiotensin II type 1 receptor or its downstream nuclear factor-kappaB pathway. Investig. Ophthalmol. Vis. Sci. 2007, 48, 4342–4350. [Google Scholar] [CrossRef] [Green Version]
- Chen, P.; Guo, A.M.; Edwards, P.A.; Trick, G.; Scicli, A.G. Role of NADPH oxidase and ANG II in diabetes-induced retinal leukostasis. Am. J. Physiol. Integr. Comp. Physiol. 2007, 293, R1619–R1629. [Google Scholar] [CrossRef] [Green Version]
- Rana, I.; Suphapimol, V.; Jerome, J.R.; Talia, D.M.; Deliyanti, D.; Wilkinson-Berka, J.L. Angiotensin II and aldosterone activate retinal microglia. Exp. Eye Res. 2020, 191, 107902. [Google Scholar] [CrossRef]
- Kossmann, S.; Hu, H.; Steven, S.; Schönfelder, T.; Fraccarollo, D.; Mikhed, Y.; Brähler, M.; Knorr, M.; Brandt, M.; Karbach, S.H.; et al. Inflammatory Monocytes Determine Endothelial Nitric-oxide Synthase Uncoupling and Nitro-oxidative Stress Induced by Angiotensin II. J. Biol. Chem. 2014, 289, 27540–27550. [Google Scholar] [CrossRef] [Green Version]
- Kroller-Schon, S.; Jansen, T.; Schuler, A.; Oelze, M.; Wenzel, P.; Hausding, M.; Kerahrodi, J.G.; Beisele, M.; Lackner, K.J.; Daiber, A.; et al. Peroxisome proliferator-activated receptor gamma, coactivator 1alpha deletion induces angiotensin II-associated vascular dysfunction by increasing mitochondrial oxidative stress and vascular inflammation. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 1928–1935. [Google Scholar] [CrossRef] [Green Version]
- Chrissobolis, S.; Banfi, B.; Sobey, C.G.; Faraci, F.M. Role of Nox isoforms in angiotensin II-induced oxidative stress and endothelial dysfunction in brain. J. Appl. Physiol. 2012, 113, 184–191. [Google Scholar] [CrossRef] [Green Version]
- Dikalov, S.I.; Nazarewicz, R.R.; Bikineyeva, A.; Hilenski, L.; Lassègue, B.; Griendling, K.; Harrison, D.G.; Dikalova, A.E. Nox2-Induced Production of Mitochondrial Superoxide in Angiotensin II-Mediated Endothelial Oxidative Stress and Hypertension. Antioxid. Redox Signal. 2014, 20, 281–294. [Google Scholar] [CrossRef] [Green Version]
- Zadeh, J.K.; Garcia-Bardon, A.; Hartmann, E.K.; Pfeiffer, N.; Omran, W.; Ludwig, M.; Patzak, A.; Xia, N.; Li, H.; Gericke, A. Short-Time Ocular Ischemia Induces Vascular Endothelial Dysfunction and Ganglion Cell Loss in the Pig Retina. Int. J. Mol. Sci. 2019, 20, 4685. [Google Scholar] [CrossRef] [Green Version]
- Zadeh, J.K.; Zhutdieva, M.B.; Laspas, P.; Yüksel, C.; Musayeva, A.; Pfeiffer, N.; Brochhausen, C.; Oelze, M.; Daiber, A.; Xia, N.; et al. Apolipoprotein E Deficiency Causes Endothelial Dysfunction in the Mouse Retina. Oxidative Med. Cell. Longev. 2019, 2019, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galougahi, K.K.; Liu, C.C.; Gentile, C.; Kok, C.; Nunez, A.; Garcia, A.; Fry, N.A.; Davies, M.J.; Hawkins, C.L.; Rasmussen, H.H.; et al. Glutathionylation mediates angiotensin II-induced eNOS uncoupling, amplifying NADPH oxidase-dependent endothelial dysfunction. J. Am. Heart Assoc. 2014, 3, e000731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oak, J.-H.; Cai, H. Attenuation of Angiotensin II Signaling Recouples eNOS and Inhibits Nonendothelial NOX Activity in Diabetic Mice. Diabetes 2006, 56, 118–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Senda, A.; Mukai, Y.; Hayakawa, T.; Kato, Y.; Eliasson, E.; Rane, A.; Toda, T.; Inotsume, N. Angiotensin II Receptor Blockers Inhibit the Generation of Epoxyeicosatrienoic Acid from Arachidonic Acid in Recombinant CYP2C9, CYP2J2 and Human Liver Microsomes. Basic Clin. Pharmacol. Toxicol. 2017, 121, 239–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kato, Y.; Mukai, Y.; Rane, A.; Inotsume, N.; Toda, T. The Inhibitory Effect of Telmisartan on the Metabolism of Arachidonic Acid by CYP2C9 and CYP2C8: An in Vitro Study. Biol. Pharm. Bull. 2017, 40, 1409–1415. [Google Scholar] [CrossRef] [Green Version]
- Laspas, P.; Goloborodko, E.; Sniatecki, J.J.; Kordasz, M.L.; Manicam, C.; Wojnowski, L.; Li, H.; Patzak, A.; Pfeiffer, N.; Gericke, A. Role of nitric oxide synthase isoforms for ophthalmic artery reactivity in mice. Exp. Eye Res. 2014, 127, 1–8. [Google Scholar] [CrossRef]
- Schulz, E.; Wenzel, P.; Münzel, T.; Daiber, A. Mitochondrial Redox Signaling: Interaction of Mitochondrial Reactive Oxygen Species with Other Sources of Oxidative Stress. Antioxid. Redox Signal. 2014, 20, 308–324. [Google Scholar] [CrossRef] [PubMed]
- Gauthier, K.M.; Goldman, D.H.; Aggarwal, N.T.; Chawengsub, Y.; Falck, J.; Campbell, W.B. Role of arachidonic acid lipoxygenase metabolites in acetylcholine-induced relaxations of mouse arteries. Am. J. Physiol. Circ. Physiol. 2011, 300, H725–H735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Ciuceis, C.; Amiri, F.; Brassard, P.; Endemann, D.H.; Touyz, R.M.; Schiffrin, E.L. Reduced vascular remodeling, endothelial dysfunction, and oxidative stress in resistance arteries of angiotensin II-infused macrophage colony-stimulating factor-deficient mice: Evidence for a role in inflammation in angiotensin-induced vascular injury. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 2106–2113. [Google Scholar] [CrossRef] [Green Version]
- Karbach, S.H.; Schönfelder, T.; Brandão, I.; Wilms, E.; Hörmann, N.; Jäckel, S.; Schüler, R.; Finger, S.; Knorr, M.; Lagrange, J.; et al. Gut Microbiota Promote Angiotensin II–Induced Arterial Hypertension and Vascular Dysfunction. J. Am. Hear. Assoc. 2016, 5, e003698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.-H.; Hsiao, G.; Al-Shabrawey, M. Eicosanoids and Oxidative Stress in Diabetic Retinopathy. Antioxidants 2020, 9, 520. [Google Scholar] [CrossRef]
- Holappa, M.; Vapaatalo, H.; Vaajanen, A. Local ocular renin–angiotensin–aldosterone system: Any connection with intraocular pressure? A comprehensive review. Ann. Med. 2020, 52, 191–206. [Google Scholar] [CrossRef]
- Resch, H.; Garhöfer, G.; Hommer, A.; Schmetterer, L.; Fuchsjäger-Mayrl, G. Endothelial dysfunction in glaucoma. Acta Ophthalmol. 2009, 87, 4–12. [Google Scholar] [CrossRef]
- Ruan, Y.; Jiang, S.; Gericke, A. Age-Related Macular Degeneration: Role of Oxidative Stress and Blood Vessels. Int. J. Mol. Sci. 2021, 22, 1296. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Forward | Reverse |
---|---|---|---|
NOX1 | NM_172203.2 | GGTTGGGGCTGAACATTTTTC | TCGACACACAGGAATCAGGAT |
NOX2 | NM_007807.5 | GCACCTGCAGCCTGCCTGAATT | TTGTGTGGATGGCGGTGTGCA |
NOX4 | NM_015760.5 | GGCTGGCCAACGAAGGGGTTAA | GAGGCTGCAGTTGAGGTTCAGGACA |
XDH | NM_011723.3 | CGATGACGAGGACAACGGTA | TGAAGGCGGTCATACTTGGAG |
ACTB | NM_007393.5 | CACCCGCGAGCACAGCTTCTTT | AATACAGCCCGGGGAGCATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Birk, M.; Baum, E.; Zadeh, J.K.; Manicam, C.; Pfeiffer, N.; Patzak, A.; Helmstädter, J.; Steven, S.; Kuntic, M.; Daiber, A.; et al. Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2. Antioxidants 2021, 10, 1238. https://doi.org/10.3390/antiox10081238
Birk M, Baum E, Zadeh JK, Manicam C, Pfeiffer N, Patzak A, Helmstädter J, Steven S, Kuntic M, Daiber A, et al. Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2. Antioxidants. 2021; 10(8):1238. https://doi.org/10.3390/antiox10081238
Chicago/Turabian StyleBirk, Michael, Ewa Baum, Jenia Kouchek Zadeh, Caroline Manicam, Norbert Pfeiffer, Andreas Patzak, Johanna Helmstädter, Sebastian Steven, Marin Kuntic, Andreas Daiber, and et al. 2021. "Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2" Antioxidants 10, no. 8: 1238. https://doi.org/10.3390/antiox10081238