MLN-4760 Induces Oxidative Stress without Blood Pressure and Behavioural Alterations in SHRs: Roles of Nfe2l2 Gene, Nitric Oxide and Hydrogen Sulfide
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
2.3. Systolic BP and Heart Rate Determination
2.4. Testing Exploratory Behaviour and Anxiety-Like Behaviour
2.5. Total NO Synthase Activity
2.6. Measurement of Plasma H2S Concentration
2.7. Measurement of Conjugated Dienes Content
2.8. Gene Expression Determination
2.9. Statistical Analysis
3. Results
3.1. Hemodynamic Parameters of Experimental Animals
3.2. Behavioural Analysis of Exploration and Anxiety-Like Behaviour
3.3. Total NOS Activity and Expression of Nos3-1, Ace2 and Mas1 Genes
3.4. Oxidative Damage and Expression of Genes Involved in Antioxidant Defence and Inflammatory Responses
3.5. Plasma Level of H2S and Gene Expression H2S-Producing Enzymes
4. Discussion
5. Limitations
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nehme, A.; Zouein, F.A.; Deris Zayeri, Z.; Zibara, K. An update on the tissue renin angiotensin system and its role in physiology and pathology. J. Cardiovasc. Dev. Dis. 2019, 6, 14. [Google Scholar] [CrossRef] [Green Version]
- Beltrán-García, J.; Osca-Verdegal, R.; Pallardó, F.V.; Ferreres, J.; Rodríguez, M.; Mulet, S.; Sanchis-Gomar, F.; Carbonell, N.; García-Giménez, J.L. Oxidative stress and inflammation in COVID-19-associated sepsis: The potential role of anti-oxidant therapy in avoiding disease progression. Antioxidants 2020, 9, 936. [Google Scholar] [CrossRef]
- Silvagno, F.; Vernone, A.; Pescarmona, G.P. The role of glutathione in protecting against the severe inflammatory response triggered by COVID-19. Antioxidants 2020, 9, 624. [Google Scholar] [CrossRef]
- Ahmad, I.; Pawara, R.; Surana, S.; Patel, H. The repurposed ACE2 inhibitors: SARS-CoV-2 entry blockers of COVID-19. Top. Curr. Chem. 2021, 379, R804–R817. [Google Scholar] [CrossRef]
- Mostafa-Hedeab, G. ACE2 as drug target of COVID-19 virus treatment, simplified updated review. Rep. Biochem. Mol. Biol. 2020, 9, 97. [Google Scholar] [CrossRef]
- Vitiello, A.; Ferrara, F. Pharmacotherapy Based on ACE2 Targeting and COVID-19 Infection. Int. J. Mol. Sci. 2022, 23, 6644. [Google Scholar] [CrossRef]
- Xu, P.; Sriramula, S.; Lazartigues, E. ACE2/ANG-(1–7)/Mas pathway in the brain: The axis of good. Am. J. Physiol. -Regul. Integr. Comp. Physiol. 2011, 300, R804–R817. [Google Scholar] [CrossRef] [Green Version]
- Patel, K.P.; Schultz, H.D. Angiotensin peptides and nitric oxide in cardiovascular disease. Antioxid. Redox Signal. 2013, 19, 1121–1132. [Google Scholar] [CrossRef]
- Zicha, J.; Kunes, J. Ontogenetic aspects of hypertension development: Analysis in the rat. Physiol. Rev. 1999, 79, 1227–1282. [Google Scholar] [CrossRef]
- Puzserova, A.; Ilovska, V.; Balis, P.; Slezak, P.; Bernatova, I. Age-related alterations in endothelial function of femoral artery in young SHR and WKY rats. BioMed Res. Int. 2014, 2014, 658479. [Google Scholar] [CrossRef]
- Galleano, M.; Bernatova, I.; Puzserova, A.; Balis, P.; Sestakova, N.; Pechanova, O.; Fraga, C.G. (–)—Epicatechin reduces blood pressure and improves vasorelaxation in spontaneously hypertensive rats by NO—Mediated mechanism. IUBMB Life 2013, 65, 710–715. [Google Scholar] [CrossRef]
- Kodavanti, U.P.; Schladweiler, M.C.; Ledbetter, A.D.; Watkinson, W.P.; Campen, M.J.; Winsett, D.W.; Richards, J.R.; Crissman, K.M.; Hatch, G.E.; Costa, D.L. The spontaneously hypertensive rat as a model of human cardiovascular disease: Evidence of exacerbated cardiopulmonary injury and oxidative stress from inhaled emission particulate matter. Toxicol. Appl. Pharmacol. 2000, 164, 250–263. [Google Scholar] [CrossRef]
- Shannahan, J.H.; Schladweiler, M.C.; Richards, J.H.; Ledbetter, A.D.; Ghio, A.J.; Kodavanti, U.P. Pulmonary oxidative stress, inflammation, and dysregulated iron homeostasis in rat models of cardiovascular disease. J. Toxicol. Environ. Health Part A 2010, 73, 641–656. [Google Scholar] [CrossRef]
- Sagvolden, T.; Johansen, E.B. Rat Models of ADHD. In Behavioral Neuroscience of Attention Deficit Hyperactivity Disorder and Its Treatment; Springer: Berlin/Heidelberg, Germany, 2011; pp. 301–315. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.A.; de Kloet, A.D.; Smeltzer, M.D.; Cahill, K.M.; Hiller, H.; Bruce, E.B.; Pioquinto, D.J.; Ludin, J.A.; Katovich, M.J.; Raizada, M.K. Coupling corticotropin-releasing-hormone and angiotensin converting enzyme 2 dampens stress responsiveness in male mice. Neuropharmacology 2018, 133, 85–93. [Google Scholar] [CrossRef]
- de Kloet, A.D.; Cahill, K.M.; Scott, K.A.; Krause, E.G. Overexpression of angiotensin converting enzyme 2 reduces anxiety-like behavior in female mice. Physiol. Behav. 2020, 224, 113002. [Google Scholar] [CrossRef]
- Wang, L.; De Kloet, A.D.; Pati, D.; Hiller, H.; Smith, J.A.; Pioquinto, D.J.; Ludin, J.A.; Oh, S.P.; Katovich, M.J.; Frazier, C.J. Increasing brain angiotensin converting enzyme 2 activity decreases anxiety-like behavior in male mice by activating central Mas receptors. Neuropharmacology 2016, 105, 114–123. [Google Scholar] [CrossRef] [Green Version]
- Bild, W.; Ciobica, A. Angiotensin-(1-7) central administration induces anxiolytic-like effects in elevated plus maze and decreased oxidative stress in the amygdala. J. Affect. Disord. 2013, 145, 165–171. [Google Scholar] [CrossRef]
- Bernatova, I. Endothelial dysfunction in experimental models of arterial hypertension: Cause or consequence? BioMed Res. Int. 2014, 2014, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Sampaio, W.O.; Souza dos Santos, R.A.; Faria-Silva, R.; da Mata Machado, L.T.; Schiffrin, E.L.; Touyz, R.M. Angiotensin-(1-7) through receptor Mas mediates endothelial nitric oxide synthase activation via Akt-dependent pathways. Hypertension 2007, 49, 185–192. [Google Scholar] [CrossRef]
- Jiang, T.; Yu, J.T.; Zhu, X.C.; Zhang, Q.Q.; Tan, M.S.; Cao, L.; Wang, H.F.; Lu, J.; Gao, Q.; Zhang, Y.D. Angiotensin-(17) induces cerebral ischaemic tolerance by promoting brain angiogenesis in a M as/eNOS--dependent pathway. Br. J. Pharmacol. 2014, 171, 4222–4232. [Google Scholar] [CrossRef]
- Ledo, A.; Lourenço, C.; Cadenas, E.; Barbosa, R.; Laranjinha, J. The bioactivity of neuronal-derived nitric oxide in aging and neurodegeneration: Switching signaling to degeneration. Free Radic. Biol. Med. 2021, 162, 500–513. [Google Scholar] [CrossRef]
- Cury, Y.; Picolo, G.; Gutierrez, V.P.; Ferreira, S.H. Pain and analgesia: The dual effect of nitric oxide in the nociceptive system. Nitric Oxide 2011, 25, 243–254. [Google Scholar] [CrossRef]
- Volke, V.; Soosaar, A.; Bourin, M.; Männistö, P.T.; Vasar, E. 7-Nitroindazole, a nitric oxide synthase inhibitor, has anxiolytic-like properties in exploratory models of anxiety. Psychopharmacology 1997, 131, 399–405. [Google Scholar] [CrossRef]
- Freudenberg, F.; Alttoa, A.; Reif, A. Neuronal nitric oxide synthase (NOS1) and its adaptor, NOS1AP, as a genetic risk factors for psychiatric disorders. Genes Brain Behav. 2015, 14, 46–63. [Google Scholar] [CrossRef]
- Tan, B.H.; Wong, P.T.-H.; Bian, J.-S. Hydrogen sulfide: A novel signaling molecule in the central nervous system. Neurochem. Int. 2010, 56, 3–10. [Google Scholar] [CrossRef]
- Lee, M.; Schwab, C.; Yu, S.; McGeer, E.; McGeer, P.L. Astrocytes produce the antiinflammatory and neuroprotective agent hydrogen sulfide. Neurobiol. Aging 2009, 30, 1523–1534. [Google Scholar] [CrossRef]
- Panthi, S.; Manandhar, S.; Gautam, K. Hydrogen sulfide, nitric oxide, and neurodegenerative disorders. Transl. Neurodegener. 2018, 7, 3. [Google Scholar] [CrossRef]
- Giustarini, D.; Santucci, A.; Bartolini, D.; Galli, F.; Rossi, R. The age-dependent decline of the extracellular thiol-disulfide balance and its role in SARS-CoV-2 infection. Redox Biol. 2021, 41, 101902. [Google Scholar] [CrossRef]
- Hati, S.; Bhattacharyya, S. Impact of thiol–Disulfide balance on the binding of COVID-19 spike protein with angiotensin-converting enzyme 2 receptor. ACS Omega 2020, 5, 16292–16298. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Manda, G.; Hassan, A.; Alcaraz, M.J.; Barbas, C.; Daiber, A.; Ghezzi, P.; León, R.; López, M.G.; Oliva, B. Transcription factor NRF2 as a therapeutic target for chronic diseases: A systems medicine approach. Pharmacol. Rev. 2018, 70, 348–383. [Google Scholar] [CrossRef] [Green Version]
- Dovinova, I.; Kvandova, M.; Balis, P.; Gresova, L.; Majzunova, M.; Horakova, L.; Julie, Y.; Barancik, M. The role of Nrf2 and PPARγ in the improvement of oxidative stress in hypertension and cardiovascular diseases. Physiol. Res. 2020, 69, S541. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Pajares, M.; Benito, C.; Jiménez-Villegas, J.; Escoll, M.; Fernández-Ginés, R.; Yagüe, A.J.G.; Lastra, D.; Manda, G.; Rojo, A.I. Can activation of NRF2 be a strategy against COVID-19? Trends Pharmacol. Sci. 2020, 41, 598–610. [Google Scholar] [CrossRef] [PubMed]
- Berenyiova, A.; Bernatova, I.; Zemancikova, A.; Drobna, M.; Cebova, M.; Golas, S.; Balis, P.; Liskova, S.; Valaskova, Z.; Krskova, K. Vascular Effects of Low-Dose ACE2 Inhibitor MLN-4760—Benefit or Detriment in Essential Hypertension? Biomedicines 2021, 10, 38. [Google Scholar] [CrossRef] [PubMed]
- Kluknavsky, M.; Balis, P.; Puzserova, A.; Radosinska, J.; Berenyiova, A.; Drobna, M.; Lukac, S.; Muchova, J.; Bernatova, I. (−)-Epicatechin prevents blood pressure increase and reduces locomotor hyperactivity in young spontaneously hypertensive rats. Oxidative Med. Cell Longev. 2016, 2016, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Pecháňová, O.g.; Bernátová, I.; Pelouch, V.; Šimko, F. Protein remodelling of the heart in NO-deficient hypertension: The effect of captopril. J. Mol. Cell Cardiol. 1997, 29, 3365–3374. [Google Scholar] [CrossRef]
- Mok, Y.-Y.P.; Atan, M.S.B.M.; Ping, C.Y.; Jing, W.Z.; Bhatia, M.; Moochhala, S.; Moore, P.K. Role of hydrogen sulphide in haemorrhagic shock in the rat: Protective effect of inhibitors of hydrogen sulphide biosynthesis. Br. J. Pharmacol. 2004, 143, 881. [Google Scholar] [CrossRef]
- Zemancikova, A.; Torok, J.; Balis, P.; Valovic, P.; Ulicna, O.; Chomova, M. Modulation of sympathoadrenergic contractions by perivascular adipose tissue in mesenteric arteries of rats with different level of body adiposity. J. Physiol. Pharm. 2020, 71, 589–596. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Taquet, M.; Geddes, J.R.; Husain, M.; Luciano, S.; Harrison, P.J. 6-month neurological and psychiatric outcomes in 236 379 survivors of COVID-19: A retrospective cohort study using electronic health records. Lancet Psychiatry 2021, 8, 416–427. [Google Scholar] [CrossRef]
- Gramaglia, C.; Gattoni, E.; Gambaro, E.; Bellan, M.; Balbo, P.E.; Baricich, A.; Sainaghi, P.P.; Pirisi, M.; Binda, V.; Feggi, A. Anxiety, Stress and Depression in COVID-19 Survivors From an Italian Cohort of Hospitalized Patients: Results From a 1-Year Follow-Up. Front. Psychiatry 2022, 13, 1–11. [Google Scholar] [CrossRef]
- Kangussu, L.M.; Almeida-Santos, A.F.; Bader, M.; Alenina, N.; Fontes, M.A.P.; Santos, R.A.; Aguiar, D.C.; Campagnole-Santos, M.J. Angiotensin-(1-7) attenuates the anxiety and depression-like behaviors in transgenic rats with low brain angiotensinogen. Behav. Brain Res. 2013, 257, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Almeida-Santos, A.F.; Kangussu, L.M.; Moreira, F.A.; Santos, R.A.; Aguiar, D.C.; Campagnole-Santos, M.J. Anxiolytic-and antidepressant-like effects of angiotensin-(1–7) in hypertensive transgenic (mRen2) 27 rats. Clin. Sci. 2016, 130, 1247–1255. [Google Scholar] [CrossRef] [PubMed]
- Feng, P.; Wu, Z.; Liu, H.; Shen, Y.; Yao, X.; Li, X.; Shen, Z. Electroacupuncture improved chronic cerebral hypoperfusion-induced anxiety-like behavior and memory impairments in spontaneously hypertensive rats by downregulating the ACE/Ang II/AT1R axis and upregulating the ACE2/Ang-(1-7)/MasR axis. Neural Plast. 2020, 2020, 1–12. [Google Scholar] [CrossRef]
- Zhong, J.-C.; Huang, D.-Y.; Yang, Y.-M.; Li, Y.-F.; Liu, G.-F.; Song, X.-H.; Du, K. Upregulation of angiotensin-converting enzyme 2 by all-trans retinoic acid in spontaneously hypertensive rats. Hypertension 2004, 44, 907–912. [Google Scholar] [CrossRef] [Green Version]
- Hernández Prada, J.A.; Ferreira, A.J.; Katovich, M.J.; Shenoy, V.; Qi, Y.; Santos, R.A.; Castellano, R.K.; Lampkins, A.J.; Gubala, V.; Ostrov, D.A. Structure-based identification of small-molecule angiotensin-converting enzyme 2 activators as novel antihypertensive agents. Hypertension 2008, 51, 1312–1317. [Google Scholar] [CrossRef] [Green Version]
- Díez-Freire, C.; Vázquez, J.; Correa de Adjounian, M.a.F.; Ferrari, M.F.; Yuan, L.; Silver, X.; Torres, R.; Raizada, M.K. ACE2 gene transfer attenuates hypertension-linked pathophysiological changes in the SHR. Physiol. Genom. 2006, 27, 12–19. [Google Scholar] [CrossRef] [Green Version]
- Yamazato, M.; Yamazato, Y.; Sun, C.; Diez-Freire, C.; Raizada, M.K. Overexpression of angiotensin-converting enzyme 2 in the rostral ventrolateral medulla causes long-term decrease in blood pressure in the spontaneously hypertensive rats. Hypertension 2007, 49, 926–931. [Google Scholar] [CrossRef] [Green Version]
- Huentelman, M.J.; Grobe, J.L.; Vazquez, J.; Stewart, J.M.; Mecca, A.P.; Katovich, M.J.; Ferrario, C.M.; Raizada, M.K. Protection from angiotensin II—Induced cardiac hypertrophy and fibrosis by systemic lentiviral delivery of ACE2 in rats. Exp. Physiol. 2005, 90, 783–790. [Google Scholar] [CrossRef] [Green Version]
- Sriramula, S.; Cardinale, J.P.; Lazartigues, E.; Francis, J. ACE2 overexpression in the paraventricular nucleus attenuates angiotensin II-induced hypertension. Cardiovasc. Res. 2011, 92, 401–408. [Google Scholar] [CrossRef]
- Diz, D.I.; Garcia-Espinosa, M.A.; Gegick, S.; Tommasi, E.N.; Ferrario, C.M.; Ann Tallant, E.; Chappell, M.C.; Gallagher, P.E. Injections of angiotensin--converting enzyme 2 inhibitor MLN4760 into nucleus tractus solitarii reduce baroreceptor reflex sensitivity for heart rate control in rats. Exp. Physiol. 2008, 93, 694–700. [Google Scholar] [CrossRef]
- Patel, V.B.; Zhong, J.-C.; Grant, M.B.; Oudit, G.Y. Role of the ACE2/angiotensin 1–7 axis of the renin–angiotensin system in heart failure. Circ. Res. 2016, 118, 1313–1326. [Google Scholar] [CrossRef] [Green Version]
- Reynolds, J.; Mahajan, S.D. SARS-CoV2 alters blood brain barrier integrity contributing to neuro-inflammation. J. Neuroimmune Pharmacol. 2021, 16, 4–6. [Google Scholar] [CrossRef]
- Xia, H.; Suda, S.; Bindom, S.; Feng, Y.; Gurley, S.B.; Seth, D.; Navar, L.G.; Lazartigues, E. ACE2-mediated reduction of oxidative stress in the central nervous system is associated with improvement of autonomic function. PLoS ONE 2011, 6, e22682. [Google Scholar] [CrossRef] [Green Version]
- Jiang, T.; Gao, L.; Shi, J.; Lu, J.; Wang, Y.; Zhang, Y. Angiotensin-(1-7) modulates renin–angiotensin system associated with reducing oxidative stress and attenuating neuronal apoptosis in the brain of hypertensive rats. Pharmacol. Res. 2013, 67, 84–93. [Google Scholar] [CrossRef]
- Abdel-Fattah, M.M.; Messiha, B.A.S.; Mansour, A.M. Modulation of brain ACE and ACE2 may be a promising protective strategy against cerebral ischemia/reperfusion injury: An experimental trial in rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2018, 391, 1003–1020. [Google Scholar] [CrossRef]
- Fratta Pasini, A.M.; Stranieri, C.; Girelli, D.; Busti, F.; Cominacini, L. Is Ferroptosis a key component of the process leading to multiorgan damage in COVID-19? Antioxidants 2021, 10, 1677. [Google Scholar] [CrossRef]
- Stec, D.E.; Abraham, N.G. Pharmacological and Clinical Significance of Heme Oxygenase-1. Antioxidants 2021, 10, 854. [Google Scholar] [CrossRef]
- Ayuso, P.; García-Martín, E.; Agúndez, J.A. Variability of the Genes Involved in the Cellular Redox Status and Their Implication in Drug Hypersensitivity Reactions. Antioxidants 2021, 10, 294. [Google Scholar] [CrossRef]
- Mazur-Bialy, A.I.; Pocheć, E. The time-course of antioxidant irisin activity: Role of the Nrf2/HO-1/HMGB1 axis. Antioxidants 2021, 10, 88. [Google Scholar] [CrossRef]
- Neri, M.; Cantatore, S.; Pomara, C.; Riezzo, I.; Bello, S.; Turillazzi, E.; Fineschi, V. Immunohistochemical expression of proinflammatory cytokines IL-1β, IL-6, TNF-α and involvement of COX-2, quantitatively confirmed by Western blot analysis, in Wernicke’s encephalopathy. Pathol. Res. Pract. 2011, 207, 652–658. [Google Scholar] [CrossRef]
- Koppula, S.; Kumar, H.; Kim, I.S.; Choi, D.-K. Reactive oxygen species and inhibitors of inflammatory enzymes, NADPH oxidase, and iNOS in experimental models of Parkinson’s disease. Mediat. Inflamm. 2012, 2012, 1–16. [Google Scholar] [CrossRef] [Green Version]
- El-Sayed, K.; Ali, D.A.; Maher, S.A.; Ghareeb, D.; Selim, S.; Albogami, S.; Fayad, E.; Kolieb, E. Prophylactic and Ameliorative Effects of PPAR-γ Agonist Pioglitazone in Improving Oxidative Stress, Germ Cell Apoptosis and Inflammation in Gentamycin-Induced Testicular Damage in Adult Male Albino Rats. Antioxidants 2022, 11, 191. [Google Scholar] [CrossRef]
- Broom, L.; Marinova-Mutafchieva, L.; Sadeghian, M.; Davis, J.B.; Medhurst, A.D.; Dexter, D.T. Neuroprotection by the selective iNOS inhibitor GW274150 in a model of Parkinson disease. Free Radic. Biol. Med. 2011, 50, 633–640. [Google Scholar] [CrossRef]
- Sheng, W.; Zong, Y.; Mohammad, A.; Ajit, D.; Cui, J.; Han, D.; Hamilton, J.L.; Simonyi, A.; Sun, A.Y.; Gu, Z. Pro-inflammatory cytokines and lipopolysaccharide induce changes in cell morphology, and upregulation of ERK1/2, iNOS and sPLA2-IIA expression in astrocytes and microglia. J. Neuroinflam. 2011, 8, 121. [Google Scholar] [CrossRef] [Green Version]
- Nunes, A.K.S.; Rapôso, C.; Rocha, S.W.S.; de Sousa Barbosa, K.P.; de Almeida Luna, R.L.; da Cruz-Hoefling, M.A.; Peixoto, C.A. Involvement of AMPK, IKβα-NFκB and eNOS in the sildenafil anti-inflammatory mechanism in a demyelination model. Brain Res. 2015, 1627, 119–133. [Google Scholar] [CrossRef]
- Chen, W.; Qi, J.; Feng, F.; Bao, G.; Wang, T.; Xiang, M.; Xie, W.-f. Neuroprotective effect of allicin against traumatic brain injury via Akt/endothelial nitric oxide synthase pathway-mediated anti-inflammatory and anti-oxidative activities. Neurochem. Int. 2014, 68, 28–37. [Google Scholar] [CrossRef]
- Girotti, A.W.; Korytowski, W. Nitric oxide inhibition of chain lipid peroxidation initiated by photodynamic action in membrane environments. Cell Biochem. Biophys. 2020, 78, 149–156. [Google Scholar] [CrossRef]
- Luo, W.; Wang, Y.; Yang, H.; Dai, C.; Hong, H.; Li, J.; Liu, Z.; Guo, Z.; Chen, X.; He, P.; et al. Heme oxygenase-1 ameliorates oxidative stress-induced endothelial senescence via regulating endothelial nitric oxide synthase activation and coupling. Aging 2018, 10, 1722. [Google Scholar] [CrossRef]
- Savoia, C.; Arrabito, E.; Parente, R.; Nicoletti, C.; Madaro, L.; Battistoni, A.; Filippini, A.; Steckelings, U.M.; Touyz, R.M.; Volpe, M. Mas receptor activation contributes to the improvement of nitric oxide bioavailability and vascular remodeling during chronic AT1R (Angiotensin Type-1 Receptor) blockade in experimental hypertension. Hypertension 2020, 76, 1753–1761. [Google Scholar] [CrossRef]
- Dominic, P.; Ahmad, J.; Bhandari, R.; Pardue, S.; Solorzano, J.; Jaisingh, K.; Watts, M.; Bailey, S.R.; Orr, A.W.; Kevil, C.G. Decreased availability of nitric oxide and hydrogen sulfide is a hallmark of COVID-19. Redox Biol. 2021, 43, 101982. [Google Scholar] [CrossRef]
- Renieris, G.; Katrini, K.; Damoulari, C.; Akinosoglou, K.; Psarrakis, C.; Kyriakopoulou, M.; Dimopoulos, G.; Lada, M.; Koufargyris, P.; Giamarellos-Bourboulis, E.J. Serum hydrogen sulfide and outcome association in pneumonia by the SARS-CoV-2 corona virus. Shock 2020, 54, 633–637. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, V.; Scuto, M.; Salinaro, A.T.; Dionisio, G.; Modafferi, S.; Ontario, M.L.; Greco, V.; Sciuto, S.; Schmitt, C.P.; Calabrese, E.J. Hydrogen sulfide and carnosine: Modulation of oxidative stress and inflammation in kidney and brain axis. Antioxidants 2020, 9, 1303. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Tu, C.; Zhao, J.; Ou, D.; Chen, G.; Liu, Y.; Xiao, X. Exogenous hydrogen sulfide protects against global cerebral ischemia/reperfusion injury via its anti-oxidative, anti-inflammatory and anti-apoptotic effects in rats. Brain Res. 2013, 1491, 188–196. [Google Scholar] [CrossRef] [PubMed]
- Corsello, T.; Komaravelli, N.; Casola, A. Role of hydrogen sulfide in NRF2-and sirtuin-dependent maintenance of cellular redox balance. Antioxidants 2018, 7, 129. [Google Scholar] [CrossRef]
- Jamaluddin, M.; Haas de Mello, A.; Tapryal, N.; Hazra, T.K.; Garofalo, R.P.; Casola, A. NRF2 Regulates Cystathionine Gamma-Lyase Expression and Activity in Primary Airway Epithelial Cells Infected with Respiratory Syncytial Virus. Antioxidants 2022, 11, 1582. [Google Scholar] [CrossRef]
- Liu, N.; Lin, X.; Huang, C. Activation of the reverse transsulfuration pathway through NRF2/CBS confers erastin-induced ferroptosis resistance. Br. J. Cancer 2020, 122, 279–292. [Google Scholar] [CrossRef]
- Donnarumma, E.; Bhushan, S.; Bradley, J.M.; Otsuka, H.; Donnelly, E.L.; Lefer, D.J.; Islam, K.N. Nitrite therapy ameliorates myocardial dysfunction via H2S and nuclear factor--erythroid 2--related factor 2 (Nrf2)--dependent signaling in chronic heart failure. J. Am. Heart Assoc. 2016, 5, e003551. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer | Tm (°C) | Amplicon Size (bp) |
---|---|---|---|---|
Nos1 (NM_052799.1) | GCA GAG GCC GTC AAG TTC T | GAG AAT GGT CGC CTT GAC CC | 60 | 72 |
Nos2 (NM_012611.3) | AAA CGC TAC ACT TCC AAC GC | TGC TGA GAG CTT TGT TGA GGT C | 59 | 91 |
Nos3 (NM_021838.2) | GAT CCC CCG GAG AAT GGA GA | TCG GAT TTT GTA ACT CTT GTG CT | 60 | 105 |
Nfe2l2 (NM_031789.2) | TGC CAT TAG TCA GTC GCT CTC | ACC GTG CCT TCA GTG TGC | 60 | 102 |
Pparg (NM_013124.3) | CTC ACA ATG CCA TCA GG TTT GG | GCT GGT CGA TAT CAC TGG AGA T | 59 | 84 |
Sod1 (NM_017050.1) | CTG AAG GCG AGC ATG GGT TC | TCC AAC ATG CCT CTC TTC ATC C | 60 | 131 |
Sod2 (NM_017051.2) | GCT GGC CAA GGG AGA TGT TAC | TGCTGTGATTGATATGGCCCC | 60 | 83 |
Gpx4 (NM_017165.4) | TAA GTA CAG GGG TTG CGT GTG | CAA GGG AAG GCC AGG ATT CG | 60 | 135 |
Hmox1 (NM_017165.4) | AGA AGA GGC TAA GAC CGC CT | TCT GGT CTT TGT GTT CCT CTG TC | 60 | 86 |
Mpst (NM_138843.2) | GGC ATC GAA CCT GGA CAC AT | GGC GTT GGA TCT CCT CTG G | 60 | 100 |
Cth (NM_017074.2) | GTA TGG AGG CAC CAA CAG GTA | GGT TGG GTT TGT GGG TGT TTC | 60 | 151 |
Cbs (NM_012522.2) | ATG GTG ACT CTC GGG AAC ATG | AGG TGG ATC GGC TTG AAC TG | 59 | 104 |
Tnf (NM_012675.3) | CGT CAG CCG ATT TGC CAT TTC | TGG GCT CAT ACC AGG GCT T | 60 | 116 |
Il1b (NM_031512.2) | CAC CTC TCA AGC AGA GCA CAG | GGG TTC CAT GGT GAA GTC AAC | 60 | 79 |
Ptgs1 (NM_017043.4) | AGC ACA TTC GGT GGT GAT GT | GGG TAA TCT GGC ACA CGG AA | 60 | 116 |
Ptgs2 (NM_017232.3) | CTA CCA TCT GGC TTC GGG AG | TGG AAC AGT CGC TCG TCA TC | 60 | 85 |
Rpl10a (NM_031065.1) | TCC ACC TGG CTG TCA ACT TC | GGC AGC AAC GAG GTT TAT TGG | 60 | 134 |
Ace2 (NM_001012006.2) | TCA GAG CTG GGA TGC AGA AA | GGC TCA GTC AGC ATG GAG TTT | 60 | 111 |
Mas1 (NM_012757.2) | TTC ATA GCC ATC CTC AGC TTC TTG | GTT CTT CCG TAT CTT CAC CAC CAA | 60 | 84 |
Parameter | Cont Group n = 11 | MLN Group n = 11 |
---|---|---|
Basal systolic BP (mmHg) | 146 ± 3 | 148 ± 4 |
End systolic BP (mmHg) | 158 ± 8 | 157 ± 8 |
Basal HR (bpm) | 531 ± 18 | 559 ± 13 |
End HR (bpm) | 514 ± 25 | 520 ± 24 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kluknavsky, M.; Micurova, A.; Cebova, M.; Şaman, E.; Cacanyiova, S.; Bernatova, I. MLN-4760 Induces Oxidative Stress without Blood Pressure and Behavioural Alterations in SHRs: Roles of Nfe2l2 Gene, Nitric Oxide and Hydrogen Sulfide. Antioxidants 2022, 11, 2385. https://doi.org/10.3390/antiox11122385
Kluknavsky M, Micurova A, Cebova M, Şaman E, Cacanyiova S, Bernatova I. MLN-4760 Induces Oxidative Stress without Blood Pressure and Behavioural Alterations in SHRs: Roles of Nfe2l2 Gene, Nitric Oxide and Hydrogen Sulfide. Antioxidants. 2022; 11(12):2385. https://doi.org/10.3390/antiox11122385
Chicago/Turabian StyleKluknavsky, Michal, Andrea Micurova, Martina Cebova, Ezgi Şaman, Sona Cacanyiova, and Iveta Bernatova. 2022. "MLN-4760 Induces Oxidative Stress without Blood Pressure and Behavioural Alterations in SHRs: Roles of Nfe2l2 Gene, Nitric Oxide and Hydrogen Sulfide" Antioxidants 11, no. 12: 2385. https://doi.org/10.3390/antiox11122385