Astrocytic Nrf2 Mediates the Neuroprotective and Anti-Inflammatory Effects of Nootkatone in an MPTP-Induced Parkinson’s Disease Mouse Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Primary Astrocyte Culture
2.3. Animals
2.4. Drug Administration
2.5. Assessment of Motor Function
2.6. Immunohistochemistry and Immunofluorescence Staining
2.7. Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
2.8. Western Blot Analysis
2.9. Detection of Intracellular ROS Levels
2.10. Measurement of Glutathione Levels
2.11. Transient Transfection and Luciferase Assay
2.12. Electrophoretic Mobility Shift Assay (EMSA)
2.13. Statistical Analysis
3. Results
3.1. NKT Inhibited Dopaminergic Neuronal Cell Death and Restored the Expression of Tyrosine Hydroxylase (TH) and Neurotrophic Factors in MPTP-Treated Mice
3.2. NKT Exerted Anti-Inflammatory and Antioxidant Effects by Inhibiting the Activation of Astrocytes and Microglia in MPTP-Treated Mice
3.3. NKT Increased Nrf2-Driven Antioxidant Enzymes in the Astrocytes of MPTP-Treated Mice and Rat Primary Astrocytes
3.4. Pharmacological Inhibition or Knockdown of Nrf2 Showed That the Nrf2/ARE Signaling Pathway Mediates Antioxidant Enzyme Expression in NKT-Treated Astrocytes
3.5. The Nrf2 Inhibitor Brusatol Reverses the Effects of NKT on Oxidative Stress and Astroglial Antioxidant Enzyme Expression in MPTP-Treated Mice
3.6. The Nrf2 Inhibitor Brusatol Reverses the Neuroprotective and Anti-Inflammatory Effects of NKT in MPTP-Treated Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Poewe, W.; Seppi, K.; Tanner, C.M.; Halliday, G.M.; Brundin, P.; Volkmann, L.; Schrag, A.E.; Lang, A.E. Parkinson’s disease. Nat. Rev. Dis. Primers 2017, 3, 17013. [Google Scholar] [CrossRef] [PubMed]
- Jagaran, K.; Singh, M. Lipid nanoparticles: Promising treatment approach for Parkinson’s disease. Int. J. Mol. Sci. 2022, 23, 9361. [Google Scholar] [CrossRef] [PubMed]
- Váradi, C. Clinical features of Parkinson’s disease: The evolution of critical symptoms. Biology 2020, 9, 103. [Google Scholar] [CrossRef] [PubMed]
- Cacabelos, R. Parkinson’s disease: From pathogenesis to pharmacogenomics. Int. J. Mol. Sci. 2017, 18, 551. [Google Scholar] [CrossRef]
- Grotemeyer, A.; McFleder, R.L.; Wu, J.; Wischhusen, J.; Ip, C.W. Neuroinflammation in Parkinson’s disease-putative pathomechanisms and targets for disease-modification. Front. Immunol. 2022, 13, 878771. [Google Scholar] [CrossRef]
- Nakabeppu, Y.; Tsuchimoto, D.; Yamaguchi, H.; Sakumi, K. Oxidative damage in nucleic acids and Parkinson’s disease. J. Neurosci. Res. 2007, 85, 919–934. [Google Scholar] [CrossRef]
- Toulorge, D.; Schapira, A.H.V.; Hajj, R. Molecular changes in the postmortem parkinsonian brain. J. Neurochem. 2016, 139, 27–58. [Google Scholar] [CrossRef]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative stress: A key modulator in neurodegenerative diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef]
- Cronk, J.C.; Kipnis, J. Microglia-the brain’s busy bees. F1000Prime Rep. 2013, 5, 53. [Google Scholar] [CrossRef]
- Prinz, M.; Priller, J. Microglia and brain macrophages in the molecular age: From origin to neuropsychiatric disease. Nat. Rev. Neurosci. 2014, 25, 300–312. [Google Scholar] [CrossRef]
- Miyazaki, I.; Asanuma, M. Therapeutic strategy of targeting astrocytes for neuroprotection in Parkinson’s disease. Curr. Pharm. Des. 2017, 23, 4936–4947. [Google Scholar] [CrossRef] [PubMed]
- Kam, T.I.; Hinkle, J.T.; Dawson, T.M.; Dawson, V.L. Microglia and astrocyte dysfunction in Parkinson’s disease. Neurobiol. Dis. 2020, 144, 105028. [Google Scholar] [CrossRef]
- Linnerbauer, M.; Wheeler, M.A.; Quintana, F.J. Astrocyte crosstalk in CNS inflammation. Neuron 2020, 108, 608–622. [Google Scholar] [CrossRef] [PubMed]
- Javanmehr, N.; Saleki, K.; Alijanizadeh, P.; Rezaei, N. Microglia dynamics in aging-related neurobehavioral and neuroinflammatory diseases. J. Neuroinflamm. 2022, 19, 273. [Google Scholar] [CrossRef] [PubMed]
- Boas, S.M.; Joyce, K.L.; Cowell, R.M. The NRF2-dependent transcriptional regulation of antioxidant defense pathways: Relevance for cell type-specific vulnerability to neurodegeneration and therapeutic intervention. Antioxidants 2021, 11, 8. [Google Scholar] [CrossRef]
- Vargas, M.R.; Johnson, J.A. The Nrf2-ARE cytoprotective pathway in astrocytes. Expert Rev. Mol. Med. 2009, 11, e17. [Google Scholar] [CrossRef]
- Johnson, D.A.; Johnson, J.A. Nrf2—A therapeutic target for the treatment of neurodegenerative diseases. Free Radic. Biol. Med. 2015, 88, 253–267. [Google Scholar] [CrossRef]
- Brandes, M.S.; Gray, N.E. NRF2 as a therapeutic target in neurodegenerative diseases. ASN Neuro 2020, 12, 1759091419899782. [Google Scholar] [CrossRef]
- Shah, Z.A.; Li, R.C.; Thimmulappa, R.K.; Kensler, T.W.; Yamamoto, M.; Biswal, S.; Doré, S. Role of reactive oxygen species in modulation of Nrf2 following ischemic reperfusion injury. Neuroscience 2007, 147, 53–59. [Google Scholar] [CrossRef]
- Innamorato, N.G.; Rojo, A.I.; García-Yagüe, A.J.; Yamamoto, M.; de Ceballos, M.L.; Cuadrado, A. The transcription factor Nrf2 is a therapeutic target against brain inflammation. J. Immunol. 2008, 181, 680–689. [Google Scholar] [CrossRef]
- Jakel, R.J.; Townsend, J.A.; Kraft, A.D.; Johnson, J.A. Nrf2-mediated protection against 6-hydroxydopamine. Brain Res. 2007, 1144, 192–201. [Google Scholar] [CrossRef]
- Chen, P.C.; Vargas, M.R.; Pani, A.K.; Smeyne, R.J.; Johnson, D.A.; Kan, Y.W.; Johnson, J.A. Nrf2-mediated neuroprotection in the MPTP mouse model of Parkinson’s disease: Critical role for the astrocyte. Proc. Natl. Acad. Sci. USA 2009, 106, 2933–2938. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Gasterich, N.; Clarner, T.; Voelz, C.; Behrens, V.; Beyer, C.; Fragoulis, A.; Zendedel, A. Astrocytic Nrf2 expression protects spinal cord from oxidative stress following spinal cord injury in a male mouse model. J. Neuroinflamm. 2022, 19, 134. [Google Scholar] [CrossRef] [PubMed]
- Liddell, J.R. Are astrocytes the predominant cell type for activation of Nrf2 in aging and neurodegeneration? Antioxidants 2017, 6, 65. [Google Scholar] [CrossRef] [PubMed]
- Fraatz, M.A.; Berger, R.G.; Zorn, H. Nootkatone-a biotechnological challenge. Appl. Microbiol. Biotechnol. 2009, 83, 35–41. [Google Scholar] [CrossRef]
- Murase, T.; Misawa, K.; Haramizu, S.; Minegishi, Y.; Hase, T. Nootkatone, a characteristic constituent of grapefruit, stimulates energy metabolism and prevents diet-induced obesity by activating AMPK. Am. J. Physiol. Endocrinol. Metab. 2010, 299, E266–E275. [Google Scholar] [CrossRef]
- Jha, A.K.; Gairola, S.; Kundu, S.; Doye, P.; Syed, A.M.; Ram, C.; Kulhari, U.; Kumar, M.; Murty, U.S.; Sahu, B.D. Biological activities, pharmacokinetics and toxicity of nootkatone: A Review. Mini Rev. Med. Chem. 2022, 22, 2244–2259. [Google Scholar]
- Bezerra Rodrigues Dantas, L.; Silva, A.L.M.; da Silva Júnior, C.P.; Alcântara, I.S.; Correia de Oliveira, M.R.; Oliveira Brito Pereira Bezerra Martins, A.; Ribeiro-Filho, J.; Coutinho, H.D.M.; Rocha Santos Passos, F.; Quintans-Junior, L.J.; et al. Nootkatone inhibits acute and chronic inflammatory responses in mice. Molecules 2020, 25, 2181. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, M.; Xu, M.; Li, T.; Fan, K.; Yan, T.; Xiao, F.; Bi, K.; Jia, Y. Nootkatone, a neuroprotective agent from Alpiniae Oxyphyllae Fructus, improves cognitive impairment in lipopolysaccharide-induced mouse model of Alzheimer’s disease. Int. Immunopharmacol. 2018, 62, 77–85. [Google Scholar] [CrossRef]
- He, B.; Xu, F.; Xiao, F.; Yan, T.; Wu, B.; Bi, K.; Jia, Y. Neuroprotective effects of nootkatone from Alpiniae oxyphyllae Fructus against amyloid-β-induced cognitive impairment. Metab. Brain Dis. 2018, 33, 251–259. [Google Scholar] [CrossRef]
- Yan, T.; Li, F.; Xiong, W.; Wu, B.; Xiao, F.; He, B.; Jia, Y. Nootkatone improves anxiety- and depression-like behavior by targeting hyperammonemia-induced oxidative stress in D-galactosamine model of liver injury. Environ. Toxicol. 2021, 36, 694–706. [Google Scholar] [CrossRef] [PubMed]
- Yao, Z.; Li, J.; Bian, L.; Li, Q.; Wang, X.; Yang, X.; Wei, X.; Wan, G.; Wang, Y.; Shi, J.; et al. Nootkatone alleviates rotenone-induced Parkinson’s disease symptoms through activation of the PI3K/Akt signaling pathway. Phytother. Res. 2022, 36, 4183–4200. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Lee, Y.Y.; Kim, J.; Seo, H.; Kim, H.S. β-lapachone increases phase II antioxidant enzyme expression via NQO1-AMPK/PI3K-Nrf2/ARE signaling in rat primary astrocytes. Free Radic. Biol. Med. 2016, 97, 168–178. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.Y.; Park, J.S.; Leem, Y.H.; Park, J.E.; Kim, D.Y.; Choi, Y.H.; Park, E.M.; Kang, J.L.; Kim, H.S. The phosphodiesterase 10 inhibitor papaverine exerts anti-inflammatory and neuroprotective effects via the PKA signaling pathway in neuroinflammation and Parkinson’s disease mouse models. J. Neuroinflamm. 2019, 16, 246. [Google Scholar] [CrossRef]
- Park, J.E.; Leem, Y.H.; Park, J.S.; Kim, D.Y.; Kang, J.L.; Kim, H.S. Anti-inflammatory and neuroprotective mechanisms of GTS-21, an α7 nicotinic acetylcholine receptor agonist, in neuroinflammation and Parkinson’s disease mouse models. Int. J. Mol. Sci. 2022, 23, 4420. [Google Scholar] [CrossRef]
- Park, J.E.; Park, J.S.; Leem, Y.H.; Kim, D.Y.; Kim, H.S. NQO1 mediates the anti-inflammatory effects of nootkatone in lipopolysaccharide-induced neuroinflammation by modulating the AMPK signaling pathway. Free Radic. Biol. Med. 2021, 164, 354–368. [Google Scholar] [CrossRef]
- Lee, E.J.; Park, J.S.; Lee, Y.Y.; Kim, D.Y.; Kang, J.L.; Kim, H.S. Anti-inflammatory and anti-oxidant mechanisms of an MMP-8 inhibitor in lipoteichoic acid-stimulated rat primary astrocytes: Involvement of NF-κB, Nrf2, and PPAR-γ signaling pathways. J. Neuroinflamm. 2018, 15, 326. [Google Scholar] [CrossRef]
- Rem, D.; Villeneuve, N.F.; Jiang, T.; Wu, T.; Lau, A.; Toppin, H.A.; Zhang, D.D. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc. Natl. Acad. Sci. USA 2011, 108, 1433–1438. [Google Scholar]
- Dinkova-Kostova, A.T.; Abramov, A.Y. The emerging role of Nrf2 in mitochondrial function. Free Radic. Biol. Med. 2015, 88, 179–188. [Google Scholar] [CrossRef]
- Ryter, S.W.; Choi, A.M. Targeting heme oxygenase-1 and carbon monoxide for therapeutic modulation of inflammation. Transl. Res. 2016, 167, 7–34. [Google Scholar] [CrossRef]
- Jayanti, S.; Moretti, R.; Tiribelli, C.; Gazzin, S. Bilirubin: A promising therapy for Parkinson’s disease. Int. J. Mol. Sci. 2021, 22, 6223. [Google Scholar] [CrossRef] [PubMed]
- Beaver, S.K.; Mesa-Torres, N.; Pey, A.L.; Timson, D.J. NQO1: A target for the treatment of cancer and neurological disease, and a model to understand loss of function disease mechanisms. Biochim. Biophys. Acta Proteins Proteom. 2019, 1867, 663–676. [Google Scholar] [CrossRef] [PubMed]
- Aoyama, K. Glutathione in the brain. Int. J. Mol. Sci. 2021, 22, 5010. [Google Scholar] [CrossRef] [PubMed]
- Asanuma, M.; Miyazaki, I. Glutathione and related molecules in parkinsonism. Int. J. Mol. Sci. 2021, 22, 8689. [Google Scholar] [CrossRef] [PubMed]
- Shih, A.Y.; Johnson, D.A.; Wong, G.; Kraft, A.D.; Jiang, L.; Erb, H.; Johnson, J.A.; Murphy, T.H. Coordinate regulation of glutathione biosynthesis and release by Nrf2-expressing glia potently protects neurons from oxidative stress. J. Neurosci. 2003, 23, 3394–3406. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′-3′) | Size | Accession No. |
---|---|---|---|
HO-1 | F: TGGCGAAGAAACTCTGTCTG R: CAACATTGAGCTGTTTGAGGA | 209 bp | NM_012580 |
NQO1 | F: ATCACCAGGTCTGCAGCTTC R: GCCATGAAGGAGGCTGCTGT | 210 bp | NM_017000 |
MnSOD | F: GGCCAAGGGAGATGTTACAA R: GAACCTTGGACTCCCACAGA | 216 bp | NM_017051 |
GCLC | F: GATGCCAACGAGTCTGACCA R: TGTAAGACGGCATCTCGCTC | 470 bp | NM_012815 |
GCLM | F: AGTGGGCACAGGTAAAACCC R: CGATGACCGAGTACCTCAGC | 371 bp | NM_017305 |
GAPDH | F: ACAGTCTTCTGAGTGGCAGTCA R: GTGCTGAGTATGTCGTGGAGTC | 292 bp | NM_017008 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.-E.; Leem, Y.-H.; Park, J.-S.; Kim, S.-E.; Kim, H.-S. Astrocytic Nrf2 Mediates the Neuroprotective and Anti-Inflammatory Effects of Nootkatone in an MPTP-Induced Parkinson’s Disease Mouse Model. Antioxidants 2023, 12, 1999. https://doi.org/10.3390/antiox12111999
Park J-E, Leem Y-H, Park J-S, Kim S-E, Kim H-S. Astrocytic Nrf2 Mediates the Neuroprotective and Anti-Inflammatory Effects of Nootkatone in an MPTP-Induced Parkinson’s Disease Mouse Model. Antioxidants. 2023; 12(11):1999. https://doi.org/10.3390/antiox12111999
Chicago/Turabian StylePark, Jung-Eun, Yea-Hyun Leem, Jin-Sun Park, Seong-Eun Kim, and Hee-Sun Kim. 2023. "Astrocytic Nrf2 Mediates the Neuroprotective and Anti-Inflammatory Effects of Nootkatone in an MPTP-Induced Parkinson’s Disease Mouse Model" Antioxidants 12, no. 11: 1999. https://doi.org/10.3390/antiox12111999