Intraocular Sustained Release of EPO-R76E Mitigates Glaucoma Pathogenesis by Activating the NRF2/ARE Pathway
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. PLGA.EPO-R76E Provides Sustained Release of EPO-R76E for up to Six Weeks
3.2. PLGA.EPO-R76E Is Neuroprotective in the Microbead Occlusion Model of Glaucoma
3.3. PLGA.EPO-R76E Reduces Retinal Oxidative Stress In Vivo
3.4. PLGA.EPO-R76E Increaseses ARE-Driven Transcripts
3.5. PLGA.EPO-R76E Activates the NRF2/ARE Pathway
3.6. PLGA.EPO-R76E Activates NRF2/ARE through the MAPK Pathway
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Calkins, D.J.; Horner, P.J. The Cell and Molecular Biology of Glaucoma: Axonopathy and the Brain. Investig. Ophthalmol. Vis. Sci. 2012, 53, 2482–2484. [Google Scholar] [CrossRef]
- Weinreb, R.N.; Aung, T.; Medeiros, F.A. The Pathophysiology and Treatment of Glaucoma: A Review. JAMA J. Am. Med. Assoc. 2014, 311, 1901–1911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Greco, A.; Rizzo, M.I.; De Virgilio, A.; Gallo, A.; Fusconi, M.; de Vincentiis, M. Emerging Concepts in Glaucoma and Review of the Literature. Am. J. Med. 2016, 129, 1000.e7–1000.e13. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, I. Relationship between Intraocular Pressure and Preservation of Visual Field in Glaucoma. Surv. Ophthalmol. 2003, 48, S3–S7. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Wang, D.; Grosskreutz, C.L. Mechanisms of Retinal Ganglion Cell Injury and Defense in Glaucoma. Exp. Eye Res. 2010, 91, 48–53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nickells, R.W. The Cell and Molecular Biology of Glaucoma: Mechanisms of Retinal Ganglion Cell Death. Investig. Ophthalmol. Vis. Sci. 2012, 53, 2476–2481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ko, M.L.; Peng, P.H.; Ma, M.C.; Ritch, R.; Chen, C.F. Dynamic Changes in Reactive Oxygen Species and Antioxidant Levels in Retinas in Experimental Glaucoma. Free Radic. Biol. Med. 2005, 39, 365–373. [Google Scholar] [CrossRef]
- Inman, D.M.; Lambert, W.S.; Calkins, D.J.; Horner, P.J. α-Lipoic Acid Antioxidant Treatment Limits Glaucoma-Related Retinal Ganglion Cell Death and Dysfunction. PLoS ONE 2013, 8, e65389. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Wang, S.; Zhong, W.; Yang, B.; Sun, L.; Zheng, Y. Oxidative Stress in the Trabecular Meshwork. Int. J. Mol. Med. 2016, 38, 995–1002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, A.; Namekata, K.; Guo, X.; Noro, T.; Harada, C.; Harada, T. Targeting Oxidative Stress for Treatment of Glaucoma and Optic Neuritis. Oxidative Med. Cell. Longev. 2017, 2017, 2817252. [Google Scholar] [CrossRef] [Green Version]
- Naguib, S.; Backstrom, J.R.; Gil, M.; Calkins, D.J.; Rex, T.S. Retinal Oxidative Stress Activates the NRF2/ARE Pathway: An Early Endogenous Protective Response to Ocular Hypertension. Redox Biol. 2021, 42, 101883. [Google Scholar] [CrossRef]
- Xu, Z.; Cho, H.; Hartsock, M.J.; Mitchell, K.L.; Gong, J.; Wu, L.; Wei, Y.; Wang, S.; Thimmulappa, R.K.; Sporn, M.B.; et al. Neuroprotective Role of Nrf2 for Retinal Ganglion Cells in Ischemia-Reperfusion. J. Neurochem. 2015, 133, 233–241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujita, K.; Nishiguchi, K.M.; Shiga, Y.; Nakazawa, T. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury. Mol. Ther. Methods Clin. Dev. 2017, 5, 130–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Genc, K.; Egrilmez, M.Y.; Genc, S. Erythropoietin Induces Nuclear Translocation of Nrf2 and Heme Oxygenase-1 Expression in SH-SY5Y Cells. Cell Biochem. Funct. 2010, 28, 197–201. [Google Scholar] [CrossRef]
- Wu, H.; Chen, M.; Yan, P.; Yao, Q.; Fan, J.; Gao, Z.; Wang, H. Erythropoietin Suppresses D-Galactose-Induced Aging of Rats via the PI3K/Akt/Nrf2-ARE Pathway. Int. J. Clin. Exp. Pathol. 2018, 11, 2227–2240. [Google Scholar]
- Zakharova, E.T.; Sokolov, A.V.; Pavlichenko, N.N.; Kostevich, V.A.; Abdurasulova, I.N.; Chechushkov, A.V.; Voynova, I.V.; Elizarova, A.Y.; Kolmakov, N.N.; Bass, M.G.; et al. Erythropoietin and Nrf2: Key Factors in the Neuroprotection Provided by Apo-Lactoferrin. Biomet. Int. J. Role Met. Ions Biol. Biochem. Med. 2018, 31, 425–443. [Google Scholar] [CrossRef]
- Zhong, L.; Bradley, J.; Schubert, W.; Ahmed, E.; Adamis, A.P.; Shima, D.T.; Robinson, G.S.; Ng, Y.S. Erythropoietin Promotes Survival of Retinal Ganglion Cells in DBA/2J Glaucoma Mice. Investig. Ophthalmol. Vis. Sci. 2007, 48, 1212–1218. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, T.A.; Geisert, E.E.; Hines-Beard, J.; Rex, T.S. Systemic adeno-associated virus-mediated gene therapy preserves retinal ganglion cells and visual function in DBA/2J glaucomatous mice. Hum. Gene Ther. 2011, 22, 1191–1200. [Google Scholar] [CrossRef] [Green Version]
- Bond, W.S.; Hines-Beard, J.; Goldenmerry, Y.L.; Davis, M.; Farooque, A.; Sappington, R.M.; Calkins, D.J.; Rex, T.S. Virus-Mediated EpoR76E Therapy Slows Optic Nerve Axonopathy in Experimental Glaucoma. Mol. Ther. 2016, 24, 230–239. [Google Scholar] [CrossRef] [Green Version]
- Ding, S.L.; Leow, S.N.; Munisvaradass, R.; Koh, E.H.; Bastion, M.L.C.; Then, K.Y.; Kumar, S.; Mok, P.L. Revisiting the Role of Erythropoietin for Treatment of Ocular Disorders. Eye 2016, 30, 1293–1309. [Google Scholar] [CrossRef] [Green Version]
- Hines-Beard, J.; Bond, W.S.; Backstrom, J.R.; Rex, T.S. Virus-Mediated EpoR76E Gene Therapy Preserves Vision in a Glaucoma Model by Modulating Neuroinflammation and Decreasing Oxidative Stress. J. Neuroinflammation 2016, 13, 39. [Google Scholar] [CrossRef] [Green Version]
- Hernández, C.C.; Burgos, C.F.; Gajardo, A.H.; Silva-Grecchi, T.; Gavilan, J.; Toledo, J.R.; Fuentealba, J. Neuroprotective effects of erythropoietin on neurodegenerative and ischemic brain diseases: The role of erythropoietin receptor. Neural Regen. Res. 2017, 12, 1381–1389. [Google Scholar] [CrossRef] [PubMed]
- Rey, F.; Balsari, A.; Giallongo, T.; Ottolenghi, S.; Giulio, A.M.D.; Samaja, M.; Carelli, S. Erythropoietin as a Neuroprotective Molecule: An Overview of Its Therapeutic Potential in Neurodegenerative Diseases. ASN Neuro 2019, 11, 1759091419871420. [Google Scholar] [CrossRef] [Green Version]
- Rong, X.; Yang, S.; Miao, H.; Guo, T.; Wang, Z.; Shi, W.; Mo, X.; Yuan, W.; Jin, T. Effects of Erythropoietin-Dextran Microparticle-Based PLGA/PLA Microspheres on RGCs. Investig. Ophthalmol. Vis. Sci. 2012, 53, 6025–6034. [Google Scholar] [CrossRef] [Green Version]
- DeJulius, C.R.; Bernardo-Colon, A.; Naguib, S.; Backstrom, J.R.; Kavanaugh, T.; Gupta, M.; Duvall, C.R.; Rex, T.S. Microsphere Antioxidant and Sustained Erythropoietin-R76E Release Functions Cooperate to Reduce Traumatic Optic Neuropathy. J. Control. Release Off. J. Control. Release Soc. 2021, 329, 762–773. [Google Scholar] [CrossRef]
- Sappington, R.M.; Carlson, B.J.; Crish, S.D.; Calkins, D.J. The Microbead Occlusion Model: A Paradigm for Induced Ocular Hypertension in Rats and Mice. Investig. Ophthalmol. Vis. Sci. 2010, 51, 207–216. [Google Scholar] [CrossRef]
- Bernardo-Colon, A.; Vest, V.; Clark, A.; Cooper, M.L.; Calkins, D.J.; Harrison, F.E.; Rex, T.S. Antioxidants Prevent Inflammation and Preserve the Optic Projection and Visual Function in Experimental Neurotrauma. Cell Death Dis. 2018, 9, 1097. [Google Scholar] [CrossRef] [Green Version]
- Naguib, S.; Bernardo-Colón, A.; Rex, T.S. Intravitreal Injection Worsens Outcomes in a Mouse Model of Indirect Traumatic Optic Neuropathy from Closed Globe Injury. Exp. Eye Res. 2020, 202, 108369. [Google Scholar] [CrossRef]
- Rasband, W.S. ImageJ. U.S. National Institutes of Health, Bethesda, Maryland. 2018. Available online: https://cir.nii.ac.jp/crid/1573387450565680768 (accessed on 14 February 2023).
- Lambert, W.S.; Pasini, S.; Formichella, C.R.; Ghose, P.; Vest, V.; Carlson, B.; Yao, V.; Calkins, D.J. Treatment with P38 Inhibitor BIRB 796 Is Neuroprotective in Models of Glaucoma. Investig. Ophthalmol. Vis. Sci. 2019, 60, 618. [Google Scholar]
- de Lucas Cerrillo, A.M.; Bond, W.S.; Rex, T.S. Safety and Angiogenic Effects of Systemc Gene Delivery of a Modified Erythropoietin. Gene Ther. 2015, 22, 365–373. [Google Scholar] [CrossRef] [Green Version]
- Hines-Beard, J.; Marchetta, J.; Gordon, S.; Chaum, E.; Geisert, E.E.; Rex, T.S. A Mouse Model of Ocular Blast Injury That Induces Closed Globe Anterior and Posterior Pole Damage. Exp. Eye Res. 2012, 99, 63–70. [Google Scholar] [CrossRef] [Green Version]
- Santina, L.D.; Inman, D.M.; Lupien, C.B.; Horner, P.J.; Wong, R.O.L. Differential Progression of Structural and Functional Alterations in Distinct Retinal Ganglion Cell Types in a Mouse Model of Glaucoma. J. Neurosci. 2013, 33, 17444–17457. [Google Scholar] [CrossRef] [Green Version]
- Kong, A.W.; Della Santina, L.; Ou, Y. Probing ON and OFF Retinal Pathways in Glaucoma Using Electroretinography. Transl. Vis. Sci. Technol. 2020, 9, 1–14. [Google Scholar] [CrossRef]
- Kumar, S.; Benavente-Perez, A.; Ablordeppey, R.; Lin, C.; Viswanathan, S.; Akopian, A.; Bloomfield, S.A. A Robust Microbead Occlusion Model of Glaucoma for the Common Marmoset. Transl. Vis. Sci. Technol. 2022, 11, 14. [Google Scholar] [CrossRef] [PubMed]
- Gentile, P.; Chiono, V.; Carmagnola, I.; Hatton, P.V. An overview of poly(lactic-co-glycolic) acid (PLGA)-based biomaterials for bone tissue engineering. Int. J. Mol. Sci. 2014, 15, 3640–3659. [Google Scholar] [CrossRef] [PubMed]
- Rocha, C.V.; Gonçalves, V.; da Silva, M.C.; Bañobre-López, M.; Gallo, J. PLGA-Based Composites for Various Biomedical Applications. Int. J. Mol. Sci. 2022, 23, 2034. [Google Scholar] [CrossRef] [PubMed]
- Meng, H.; Guo, J.; Wang, H.; Yan, P.; Niu, X.; Zhang, J. Erythropoietin activates Keap1-Nrf2/ARE pathway in rat brain after ischemia. Int. J. Neurosci. 2014, 124, 362–368. [Google Scholar] [CrossRef]
- Nagai, A.; Nakagawa, E.; Choi, H.B.; Hatori, K.; Kobayashi, S.; Kim, S.U. Erythropoietin and erythropoietin receptors in human CNS neurons, astrocytes, microglia, and oligodendrocytes grown in culture. J. Neuropathol. Exp. Neurol. 2001, 60, 386–392. [Google Scholar] [CrossRef] [Green Version]
- Jeong, J.E.; Park, J.H.; Kim, C.S.; Lee, S.L.; Chung, H.L.; Kim, W.T.; Lee, E.J. Neuroprotective Effects of Erythropoietin against Hypoxic Injury via Modulation of the Mitogen-Activated Protein Kinase Pathway and Apoptosis. Korean J. Pediatr. 2017, 60, 181–188. [Google Scholar] [CrossRef] [Green Version]
- Rafiee, P.; Shi, Y.; Su A Pritchard Jr, J.K.; Tweddell, J.S. Erythropoietin Protects the Infant Heart against Ischemia-Reperfusion Injury by Triggering Multiple Signaling Pathways. Basic Res. Cardiol. 2005, 100, 187–197. [Google Scholar] [CrossRef]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
Txnrd2 | CGGAGGAACGTGTGTGAATGT | TCAGAGCTTGTCCGAGCAAA |
Txnrd3 | CACGCGGGTTAAGGAACTCTT- | GCCCCGTCATCAACTTGATC |
Ho-1 | CCTTCCCGAACATCGACAGCC | GCAGCTCCTCAAACAGCTCAA |
Prdx6 | TTG ATG ATA AGG GCA GGG AC | CTA CCA TCA CGC TCT CTC CC |
Nrf2 | CCA GCT ACT CCC AGG TTG C | CCA AAC TTG CTC CAT GTC CT |
Sod2 | GAC AAA CCT CAG CCC TAA CG | GAA ACC AAG CCA ACC CCA AC |
Protein Name | Catalog Number | Company | Dilution | Species |
---|---|---|---|---|
NRF2 | 137550 | Abcam | 1:600 | Rabbit |
Phosphorylated NRF2 (Ser40 residue) | PA5-67520 | ThermoFisher | 1:1000 | Rabbit |
ß actin | 4967S | Cell Signaling | 1:1000 | Rabbit/mouse |
PI3K | 4257 | Cell Signaling | 1:1000 | Rabbit |
Phosphorylated PI3K | 4228 | Cell Signaling | 1:1000 | Rabbit |
AKT | 4685 | Cell Signaling | 1:500 | Rabbit |
Phosphorylated AKT | 4060 | Cell Signaling | 1:500 | Rabbit |
SAPK/JNK | 9252 | Cell Signaling | 1:1000 | Rabbit |
Phosphorylated JNK | 4668 | Cell Signaling | 1:1000 | Rabbit |
GSK3ß | 12456 | Cell Signaling | 1:500 | Rabbit |
Phosphorylated GSK3ß | 5558 | Cell Signaling | 1:2000 | Rabbit |
MAPK/ERK1/2 | 4695 | Cell Signaling | 1:1000 | Rabbit |
Phosphorylated MAPK/ERK1/2 | 4370 | Cell Signaling | 1:1000 | Rabbit |
Superoxide dismutase 3 (SOD3) | 80946 | Abcam | 1:1000 | Mouse |
Glutathione peroxidase 1 (GPX1) | PA5-26323 | ThermoFisher | 1:1000 | Rabbit |
Peroxiredoxin 6 (Prdx6) | 59543 | Abcam | 1:500 | Rabbit |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Naguib, S.; DeJulius, C.R.; Backstrom, J.R.; Haider, A.A.; Ang, J.M.; Boal, A.M.; Calkins, D.J.; Duvall, C.L.; Rex, T.S. Intraocular Sustained Release of EPO-R76E Mitigates Glaucoma Pathogenesis by Activating the NRF2/ARE Pathway. Antioxidants 2023, 12, 556. https://doi.org/10.3390/antiox12030556
Naguib S, DeJulius CR, Backstrom JR, Haider AA, Ang JM, Boal AM, Calkins DJ, Duvall CL, Rex TS. Intraocular Sustained Release of EPO-R76E Mitigates Glaucoma Pathogenesis by Activating the NRF2/ARE Pathway. Antioxidants. 2023; 12(3):556. https://doi.org/10.3390/antiox12030556
Chicago/Turabian StyleNaguib, Sarah, Carlisle R. DeJulius, Jon R. Backstrom, Ameer A. Haider, John M. Ang, Andrew M. Boal, David J. Calkins, Craig L. Duvall, and Tonia S. Rex. 2023. "Intraocular Sustained Release of EPO-R76E Mitigates Glaucoma Pathogenesis by Activating the NRF2/ARE Pathway" Antioxidants 12, no. 3: 556. https://doi.org/10.3390/antiox12030556