Selenomethionine Attenuated H2O2-Induced Oxidative Stress and Apoptosis by Nrf2 in Chicken Liver Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Cell Culture
2.3. Se cytotoxicity Assay
2.4. Cell Viability Assay
2.5. H2O2-Stimulated Oxidative Stress Model
2.6. LDH Activity Assay
2.7. Determination of Glutathione Peroxidase (GPx) and Thioredoxin Reductase (TrxR) mRNA Half-Lives
2.8. Determination of GPx and TrxR Synthesis Rates
2.9. Measurement of Cellular Reactive Oxygen Species (ROS)
2.10. Measurement of Oxidative and Antioxidative Indices
2.11. TdT-dUTP Terminal Nick-End Labeling (TUNEL) Assay
2.12. Determination of Apoptosis-Related Indices
2.13. RNA Isolation and Quantitative Reverse Transcription PCR (qRT-PCR) Analysis
2.14. Western Blotting Analysis
2.15. Statistical Analysis
3. Results and Discussion
3.1. Cytotoxicity of SM and SS on LMH Cells
3.2. Effects of SS and SM on the mRNA Stability and Protein Synthesis of GPx and TrxR
3.3. Oxidative Stress Model of LMH Induced with H2O2
3.4. SS and SM Protect LMHs under Oxidative Stress
3.5. Effects of SS and SM on the Oxidative and Antioxidative Parameters of LMHs under Oxidative Stress
3.6. Effects of SS and SM on the Cell Apoptosis of LMHs
3.7. Effects of SS and SM on the Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) and Downstream Regulators under Oxidative Stress
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Surai, P.F.; Kochish, I.I.; Romanov, M.N.; Griffin, D.K. Nutritional modulation of the antioxidant capacities in poultry: The case of vitamin E. Poult. Sci. 2019, 98, 4030–4041. [Google Scholar] [CrossRef]
- Li, K.; Jiang, L.; Wang, J.; Xia, L.; Zhao, R.; Cai, C.; Wang, P.; Zhan, X.; Wang, Y. Maternal dietary supplementation with different sources of selenium on antioxidant status and mortality of chicken embryo in a model of diquat-induced acute oxidative stress. Anim. Feed Sci. Technol. 2020, 261, 114369. [Google Scholar] [CrossRef]
- Surai, P.F.; Fisinin, V.I. Selenium in poultry breeder nutrition: An update. Anim. Feed Sci. Technol. 2014, 191, 1–15. [Google Scholar] [CrossRef]
- Sadasivam, N.; Kim, Y.J.; Radhakrishnan, K.; Kim, D.K. Oxidative stress, genomic integrity, and liver diseases. Molecules 2022, 27, 3159. [Google Scholar] [CrossRef]
- Li, S.L.; Li, H.R.; Xu, X.D.; Saw, P.E.; Zhang, L. Nanocarrier-mediated antioxidant delivery for liver diseases. Theranostics 2020, 10, 1262–1280. [Google Scholar] [CrossRef]
- Thiry, C.; Ruttens, A.; Pussemier, L.; Schneider, Y.J. An in vitro investigation of species-dependent intestinal transport of selenium and the impact of this process on selenium bioavailability. Br. J. Nutr. 2013, 109, 2126–2134. [Google Scholar] [CrossRef]
- Kieliszek, M.; Blazejak, S. Selenium: Significance, and outlook for supplementation. Nutrition 2013, 29, 713–718. [Google Scholar] [CrossRef]
- Hariharan, S.; Dharmaraj, S. Selenium and selenoproteins: It’s role in regulation of inflammation. Inflammopharmacology 2020, 28, 667–695. [Google Scholar] [CrossRef]
- Chen, X.; Li, J.B.; Kang, R.; Klionsky, D.J.; Tang, D.L. Ferroptosis: Machinery and regulation. Autophagy 2021, 17, 2054–2081. [Google Scholar] [CrossRef]
- Steinbrenner, H.; Sies, H. Protection against reactive oxygen species by selenoproteins. Biochim. Biophys. Acta-Gen. Subj. 2009, 1790, 1478–1485. [Google Scholar] [CrossRef]
- Wang, H.; Cong, X.; Qin, K.; Yan, M.K.; Xu, X.F.; Liu, M.K.; Xu, X.; Zhang, Y.; Gao, Q.Y.; Cheng, S.Y.; et al. Se-enriched cardamine violifolia improves laying performance and regulates ovarian antioxidative function in aging laying hens. Antioxidants 2023, 12, 450. [Google Scholar] [CrossRef] [PubMed]
- Xia, X.J.; Zhang, X.L.; Liu, M.C.; Duan, M.Y.; Zhang, S.S.; Wei, X.B.; Liu, X.Y. Toward improved human health: Efficacy of dietary selenium on immunity at the cellular level. Food Funct. 2021, 12, 976–989. [Google Scholar] [CrossRef] [PubMed]
- Rusetskaya, N.Y.; Fedotov, I.V.; Koftina, V.A.; Borodulin, V.B. Selenium compounds in redox regulation of inflammation and apoptosis. Biochem. Mosc.-Suppl. Ser. B-Biomed. Chem. 2019, 13, 277–292. [Google Scholar] [CrossRef]
- Falk, M.; Lebed, P.; Bernhoft, A.; Framstad, T.; Kristoffersen, A.B.; Salbu, B.; Oropeza-Moe, M. Effects of sodium selenite and L-selenomethionine on feed intake, clinically relevant blood parameters and selenium species in plasma, colostrum and milk from high-yielding sows. J. Trace Elem. Med. Biol. 2019, 52, 176–185. [Google Scholar] [CrossRef]
- Schrauzer, G.N. Nutritional selenium supplements: Product types, quality, and safety. J. Am. Coll. Nutr. 2001, 20, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Burk, R.F.; Hill, K.E. Regulation of selenoproteins. Annu. Rev. Nutr. 1993, 13, 65–81. [Google Scholar] [CrossRef]
- Finley, J.W. Bioavailability of selenium from foods. Nutr. Rev. 2006, 64, 146–151. [Google Scholar] [CrossRef] [PubMed]
- Schrauzer, G.N. Selenomethionine: A review of its nutritional significance, metabolism and toxicity. J. Nutr. 2000, 130, 1653–1656. [Google Scholar] [CrossRef]
- Yuan, D.; Zhan, X.A.; Wang, Y.X. Effects of selenium sources and levels on reproductive performance and selenium retention in broiler breeder, egg, developing embryo, and 1-day-old chick. Biol. Trace Elem. Res. 2011, 144, 705–714. [Google Scholar] [CrossRef]
- Vieira, S.L. Chelated minerals for poultry. Braz. J. Poult. Sci. 2008, 10, 73–79. [Google Scholar] [CrossRef]
- Ji, F.; Luo, X.G.; Lu, L.; Liu, B.; Yu, S.X. Effect of manganese source on manganese absorption by the intestine of broilers. Poult. Sci. 2006, 85, 1947–1952. [Google Scholar] [CrossRef]
- Surai, P.F. Effect of selenium and vitamin E content of the maternal diet on the antioxidant system of the yolk and the developing chick. Br. Poult. Sci. 2000, 41, 235–243. [Google Scholar] [CrossRef]
- Pan, C.L.; Huang, K.H.; Zhao, Y.X.; Qin, S.Y.; Chen, F.; Hu, Q.H. Effect of selenium source and level in hen’s diet on tissue selenium deposition and egg selenium concentrations. J. Agric. Food Chem. 2007, 55, 1027–1032. [Google Scholar] [CrossRef]
- Wu, R.J.; Zhan, X.A.; Wang, Y.X.; Zhang, X.W.; Wang, M.; Yuan, D. Effect of different selemethionine forms and levels on performance of breeder hens and se distribution of tissue and egg inclusion. Biol. Trace Elem. Res. 2011, 143, 923–931. [Google Scholar] [CrossRef]
- Li, J.L.; Li, H.X.; Li, S.; Gao, X.J.; Xu, S.W.; Tang, Z.X. Effects of Selenoprotein W gene expression by selenium involves regulation of mRNA stability in chicken embryos neurons. BioMetals 2012, 25, 459–468. [Google Scholar] [CrossRef]
- Dematteis, G.; Restelli, E.; Chiesa, R.; Aronica, E.; Genazzani, A.A.; Lim, D.; Tapella, L. Calcineurin controls expression of eaat1/glast in mouse and human cultured astrocytes through dynamic regulation of protein synthesis and degradation. Int. J. Mol. Sci. 2020, 21, 2213. [Google Scholar] [CrossRef]
- Sanchez-Martan, V.; Morales, P.; Iriondo-DeHond, A.; Hospital, X.F.; Fernandez, M.; Hierro, E.; Haza, A.I. Differential apoptotic effects of bee product mixtures on normal and cancer hepatic cells. Antioxidants 2023, 12, 615. [Google Scholar] [CrossRef]
- Berger, M.; Aijaz, I.; Berger, P.; Dobrindt, U.; Koudelka, G. Transcriptional and Translational Inhibitors Block SOS Response and Shiga Toxin Expression in Enterohemorrhagic Escherichia coli. Sci. Rep. 2019, 9, 18777. [Google Scholar] [CrossRef]
- Ranawat, P.; Bansal, M.P. Apoptosis induced by modulation in selenium status involves p38 MAPK and ROS: Implications in spermatogenesis. Mol. Cell Biochem. 2009, 330, 83–95. [Google Scholar] [CrossRef]
- Yu, Q.R.; Han, F.L.; Rombenso, A.; Qin, J.G.; Chen, L.Q.; Li, E.R. Dietary selenium supplementation alleviates low salinity stress in the Pacific white shrimp Litopenaeus vannamei: Growth, antioxidative capacity and hepatopancreas transcriptomic responses. Br. J. Nutr. 2023, 130, 933–943. [Google Scholar] [CrossRef]
- Wu, X.S.; Wei, C.W.; Pan, C.L.; Duan, Y.; Huang, K.H. Regulation of expression and activity of selenoenzymes by different forms and concentrations of selenium in primary cultured chicken hepatocytes. Br. J. Nutr. 2010, 104, 1605–1612. [Google Scholar] [CrossRef] [PubMed]
- Allmang, C.; Wurth, L.; Krol, A. The selenium to selenoprotein pathway in eukaryotes: More molecular partners than anticipated. Biochim. Biophys. Acta-Gen. Subj. 2009, 1790, 1415–1423. [Google Scholar] [CrossRef] [PubMed]
- Li, J.L.; Li, W.; Sun, X.T.; Xia, J.; Li, X.N.; Lin, J.; Zhang, C.; Sun, X.C.; Xu, S.W. Selenophosphate synthetase 1 (SPS1) is required for the development and selenium homeostasis of central nervous system in chicken (Gallus gallus). Oncotarget 2017, 8, 35919–35932. [Google Scholar] [CrossRef] [PubMed]
- Gallegos, A.; Berggren, M.; Gasdaska, J.R.; Powis, G. Mechanisms of the regulation of thioredoxin reductase activity in cancer cells by the chemopreventive agent selenium. Cancer Res. 1997, 57, 4965–4970. [Google Scholar] [PubMed]
- San Jose, L.H.; Signer, R.A.J. Cell-type-specific quantification of protein synthesis in vivo. Nat. Protoc. 2019, 14, 441–460. [Google Scholar] [CrossRef] [PubMed]
- Shao, M.Y.; Wang, Y.F.; Dong, H.Y.; Wang, L.; Zhang, X.Q.; Han, X.; Sang, X.A.; Bao, Y.N.; Peng, M.Y.; Cao, G. From liver fibrosis to hepatocarcinogenesis: Role of excessive liver H2O2 and targeting nanotherapeutics. Bioact. Mater. 2023, 23, 187–205. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.P.; Li, J.R.; Fan, T.G.; Zhong, S.Y.; Qin, X.M.; Li, R.; Gao, J.L.; Liang, Y.W. Protective effects of curcumin/cyclodextrin polymer inclusion complex against hydrogen peroxide-induced LO2 cells damage. Food Sci. Nutr. 2022, 10, 1649–1656. [Google Scholar] [CrossRef]
- Kurt, B.O.; Ozdemir, S. Selenium heals the chlorpyrifos-induced oxidative damage and antioxidant enzyme levels in the rat tissues. Biol. Trace Elem. Res. 2023, 201, 1772–1780. [Google Scholar] [CrossRef]
- Jia, L.; Wang, T.; Sun, Y.Y.; Zhang, M.R.; Tian, J.Y.; Chen, H.; Shen, Z.G.; Abro, H.K.; Su, N.N.; Cui, J. Protective Effect of selenium-enriched red radish sprouts on carbon tetrachloride-induced liver injury in mice. J. Food Sci. 2019, 84, 3027–3036. [Google Scholar] [CrossRef]
- Qin, D.D.; Yang, F.Y.; Hu, Z.M.; Liu, J.L.; Wu, Q.; Luo, Y.; Yang, L.F.; Han, S.; Luo, F.J. Peptide T8 isolated from yak milk residue ameliorates H2O2-induced oxidative stress through Nrf2 signaling pathway in HUVEC cells. Food Biosci. 2021, 44, 101408. [Google Scholar] [CrossRef]
- Wang, Y.X.; Xiao, X.; Zhan, X.A. Antagonistic effects of different selenium sources on growth inhibition, oxidative damage, and apoptosis induced by fluorine in broilers. Poult. Sci. 2018, 97, 3207–3217. [Google Scholar] [CrossRef]
- Li, B.X.; Li, W.Y.; Tian, Y.B.; Guo, S.X.; Qian, L.; Xu, D.N.; Cao, N. Selenium-alleviated hepatocyte necrosis and dna damage in cyclophosphamide-treated geese by mitigating oxidative stress. Biol. Trace Elem. Res. 2020, 193, 508–516. [Google Scholar] [CrossRef]
- Surai, P.F.; Kochish, I.I. Nutritional modulation of the antioxidant capacities in poultry: The case of selenium. Poult. Sci. 2019, 98, 4231–4239. [Google Scholar] [CrossRef]
- Romanov, V.; Whyard, T.C.; Waltzer, W.C.; Grollman, A.P.; Rosenquist, T. Aristolochic acid-induced apoptosis and G2 cell cycle arrest depends on ROS generation and MAP kinases activation. Arch. Toxicol. 2015, 89, 47–56. [Google Scholar] [CrossRef]
- Zhou, L.; Jiang, L.F.; Xu, M.L.; Liu, Q.; Gao, N.; Li, P.; Liu, E.H. Miltirone exhibits antileukemic activity by ROS-mediated endoplasmic reticulum stress and mitochondrial dysfunction pathways. Sci. Rep. 2016, 6, 20585. [Google Scholar] [CrossRef]
- Sternfeld, T.; Tischleder, A.; Schuster, M.; Bogner, J.R. Mitochondrial membrane potential and apoptosis of blood mononuclear cells in untreated HIV-1-infected patients. HIV Med. 2009, 10, 512–519. [Google Scholar] [CrossRef]
- Jiang, M.X.; Qi, L.; Li, L.S.; Li, Y.J. The caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer. Cell Death Discov. 2020, 6, 112. [Google Scholar] [CrossRef]
- Edlich, F. BCL-2 proteins and apoptosis: Recent insights and unknowns. Biochem. Biophys. Res. Commun. 2018, 500, 26–34. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, B.B.; Wu, P.X.; Chu, Y.; Gui, S.S.; Zheng, Y.Z.; Chen, X.D. Dietary selenium alleviated mouse liver oxidative stress and nafld induced by obesity by regulating the KEAP1/NRF2 pathway. Antioxidants 2022, 11, 349. [Google Scholar] [CrossRef]
- Jiang, Z.H.; Lin, H.J.; Yao, H.D.; Zhang, Z.W.; Fu, J.; Xu, S.W. SelW protects against H2O2-induced liver injury in chickens via inhibiting inflammation and apoptosis. Rsc Adv. 2017, 7, 15158–15167. [Google Scholar] [CrossRef]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef]
- Yu, X.; Shao, X.G.; Sun, H.; Li, Y.N.; Yang, J.; Deng, Y.C.; Huang, Y.G. Activation of cerebral peroxisome proliferator-activated receptors gamma exerts neuroprotection by inhibiting oxidative stress following pilocarpine-induced status epilepticus. Brain Res. 2008, 1200, 146–158. [Google Scholar] [CrossRef]
- Xue, H.T.; Cao, H.B.; Xing, C.H.; Feng, J.P.; Zhang, L.W.; Zhang, C.Y.; Hu, G.L.; Yang, F. Selenium triggers Nrf2-AMPK crosstalk to alleviate cadmium-induced autophagy in rabbit cerebrum. Toxicology 2021, 459, 152855. [Google Scholar] [CrossRef]
- Jez, M.; Ciesla, M.; Stepniewski, J.; Langrzyk, A.; Muchova, L.; Vitek, L.; Jozkowicz, A.; Dulak, J. Valproic acid downregulates heme oxygenase-1 independently of Nrf2 by increasing ubiquitination and proteasomal degradation. Biochem. Biophys. Res. Commun. 2017, 485, 160–166. [Google Scholar] [CrossRef]
- Wang, H.; Cheng, Q.; Bao, L.J.; Li, M.Q.; Chang, K.K.; Yi, X.F. Cytoprotective role of heme oxygenase-1 in cancer chemoresistance: Focus on Antioxidant, antiapoptotic, and pro-autophagy properties. Antioxidants 2023, 12, 1217. [Google Scholar] [CrossRef]
- Piras, S.; Furfaro, A.L.; Brondolo, L.; Passalacqua, M.; Marinari, U.M.; Pronzato, M.A.; Nitti, M. Differentiation impairs Bach1 dependent HO-1 activation and increases sensitivity to oxidative stress in SH-SY5Y neuroblastoma cells. Sci. Rep. 2017, 7, 7568. [Google Scholar] [CrossRef]
- Sun, J.Y.; Hoshino, H.; Takaku, K.; Nakajima, O.; Muto, A.; Suzuki, H.; Tashiro, S.; Takahashi, S.; Shibahara, S.; Alam, J.; et al. Hemoprotein Bach1 regulates enhancer availability of heme oxygenase-1 gene. Embo J. 2002, 21, 5216–5224. [Google Scholar] [CrossRef]
- Yang, H.; Wang, Q.; Li, S. MicroRNA-218 promotes high glucose-induced apoptosis in podocytes by targeting heme oxygenase-1. Biochem. Biophys. Res. Commun. 2016, 471, 582–588. [Google Scholar] [CrossRef]
- Hung, Y.W.; Ouyang, C.; Ping, X.; Qi, Y.; Wang, Y.C.; Kung, H.J.; Ann, D.K. Extracellular arginine availability modulates eIF2α O-GlcNAcylation and heme oxygenase 1 translation for cellular homeostasis. J. Biomed. Sci. 2023, 30, 32. [Google Scholar] [CrossRef]
- Zhao, X.L.; Gao, J.Y.; Hogenkamp, A.; Knippels, L.M.J.; Garssen, J.; Bai, J.; Yang, A.S.; Wu, Y.; Chen, H.B. Selenium-enriched soy protein has antioxidant potential via modulation of the Nrf2-HO1 signaling pathway. Foods 2021, 10, 2542. [Google Scholar] [CrossRef]
- Wang, J.Q.; Liu, C.; Zhao, Y.B.; Wang, J.L.; Li, J.H.; Zheng, M.X. Selenium regulates Nrf2 signaling to prevent hepatotoxicity induced by hexavalent chromium in broilers. Poult. Sci. 2023, 102, 102335. [Google Scholar] [CrossRef]
- Song, D.G.; Cheng, Y.Z.; Li, X.X.; Wang, F.Q.; Lu, Z.Q.; Xiao, X.; Wang, Y.Z. Biogenic nanoselenium particles effectively attenuate oxidative stress-induced intestinal epithelial barrier injury by activating the Nrf2 antioxidant pathway. Acs Appl. Mater. Interfaces 2017, 9, 14724–14740. [Google Scholar] [CrossRef]
Gene | Accession Number | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) | Product Size |
---|---|---|---|---|
Nrf2 | NM_205117.1 | AGAAAACGCTGAACCACCAATC | GCTGGGTGGCTGAGTTTGATTA | 217 bp |
TrxR | NM_001030762.3 | GGGGTCTTGGAGGAACATGTG | CCCCAGTTCAGTGAGCCAATG | 187 bp |
GPx | NM_001277853.2 | CTGCAACCAATTCGGGCAC | CGCACTTCTCGAACATGGTG | 116 bp |
HO-1 | NM_205344.1 | TGTCCCTCCACGAGTTCAAGC | GACAGGTCTCCCAAATAGCGG | 301 bp |
GAPDH | NM_204305.1 | CCTCTCTGGCAAAGTCCAAGTG | GGTCACGCTCCTGGAAGATAGT | 176 bp |
Antibody Name | Dilution Ratio | Manufacturers |
---|---|---|
β-actin | 1:10,000 | Abclonal, Biotechnology Co., Ltd., Wuhan, China |
p-Nrf2 | 1:1000 | HuaAn Biotechnology Co., Ltd., Hangzhou, China |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, L.; Xu, Y.; Ding, X.; Li, K.; Liang, S.; Li, D.; Wang, Y.; Fu, A.; Yu, W.; Zhan, X. Selenomethionine Attenuated H2O2-Induced Oxidative Stress and Apoptosis by Nrf2 in Chicken Liver Cells. Antioxidants 2023, 12, 1685. https://doi.org/10.3390/antiox12091685
Xie L, Xu Y, Ding X, Li K, Liang S, Li D, Wang Y, Fu A, Yu W, Zhan X. Selenomethionine Attenuated H2O2-Induced Oxidative Stress and Apoptosis by Nrf2 in Chicken Liver Cells. Antioxidants. 2023; 12(9):1685. https://doi.org/10.3390/antiox12091685
Chicago/Turabian StyleXie, Lingyu, Yibin Xu, Xiaoqing Ding, Kaixuan Li, Shuang Liang, Danlei Li, Yongxia Wang, Aikun Fu, Weixiang Yu, and Xiuan Zhan. 2023. "Selenomethionine Attenuated H2O2-Induced Oxidative Stress and Apoptosis by Nrf2 in Chicken Liver Cells" Antioxidants 12, no. 9: 1685. https://doi.org/10.3390/antiox12091685