Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia
Abstract
:1. Introduction
2. Patients and Methods
2.1. Study Design and Participant Demographics
2.2. Sample Processing
2.3. Assessment of Gene Expression
2.4. Immunohistochemistry
2.5. Malondialdehyde Assay
2.6. Statistical Analysis
3. Results
3.1. The Placentas of Women with Late-Onset Preeclampsia Display Enhanced Expression of NOX-1 and NOX-2
3.2. The Placentas of Women with Late-Onset Preeclampsia Show Augmented Iron Deposits and TFRC Expression
3.3. The Placentas of Women with Late-Onset Preeclampsia Exhibit Augmented Levels of ACSL-4, ALOX-5 and GPX-4
3.4. The Placentas of Women with LO-PE Exhibit Elevated Detection of MDA
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Filipek, A.; Jurewicz, E. [Preeclampsia—A Disease of Pregnant Women]. Postep. Biochem. 2018, 64, 229–232. [Google Scholar] [CrossRef] [PubMed]
- Tranquilli, A.L. Introduction to ISSHP New Classification of Preeclampsia. Pregnancy Hypertens. 2013, 3, 58–59. [Google Scholar] [CrossRef] [PubMed]
- Brown, M.A.; Magee, L.A.; Kenny, L.C.; Karumanchi, S.A.; McCarthy, F.P.; Saito, S.; Hall, D.R.; Warren, C.E.; Adoyi, G.; Ishaku, S. Hypertensive Disorders of Pregnancy: ISSHP Classification, Diagnosis, and Management Recommendations for International Practice. Hypertension 2018, 72, 24–43. [Google Scholar] [CrossRef]
- Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222. Obstet. Gynecol. 2020, 135, E237–E260. [CrossRef] [PubMed]
- Raymond, D.; Peterson, E. A Critical Review of Early-Onset and Late-Onset Preeclampsia. Obs. Gynecol. Surv. 2011, 66, 497–506. [Google Scholar] [CrossRef] [PubMed]
- Lisonkova, S.; Joseph, K.S. Incidence of Preeclampsia: Risk Factors and Outcomes Associated with Early- versus Late-Onset Disease. Am. J. Obs. Gynecol. 2013, 209, 544.e1–544.e12. [Google Scholar] [CrossRef] [PubMed]
- Herzog, E.M.; Eggink, A.J.; Reijnierse, A.; Kerkhof, M.A.M.; de Krijger, R.R.; Roks, A.J.M.; Reiss, I.K.M.; Nigg, A.L.; Eilers, P.H.C.; Steegers, E.A.P.; et al. Impact of Early- and Late-Onset Preeclampsia on Features of Placental and Newborn Vascular Health. Placenta 2017, 49, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Lisonkova, S.; Sabr, Y.; Mayer, C.; Young, C.; Skoll, A.; Joseph, K.S. Maternal Morbidity Associated with Early-Onset and Late-Onset Preeclampsia. Obstet. Gynecol. 2014, 124, 771–781. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Sáez, M.A.; Álvarez-Mon, M.A.; Torres-Carranza, D.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; Bravo, C.; et al. The Pivotal Role of the Placenta in Normal and Pathological Pregnancies: A Focus on Preeclampsia, Fetal Growth Restriction, and Maternal Chronic Venous Disease. Cells 2022, 11, 568. [Google Scholar] [CrossRef]
- Ren, Z.; Gao, Y.; Gao, Y.; Liang, G.; Chen, Q.; Jiang, S.; Yang, X.; Fan, C.; Wang, H.; Wang, J.; et al. Distinct Placental Molecular Processes Associated with Early-Onset and Late-Onset Preeclampsia. Theranostics 2021, 11, 5028. [Google Scholar] [CrossRef]
- Staff, A.C. The Two-Stage Placental Model of Preeclampsia: An Update. J. Reprod. Immunol. 2019, 134–135, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Ji, L.L.; Yeo, D. Oxidative Stress: An Evolving Definition. Fac. Rev. 2021, 10, 13. [Google Scholar] [CrossRef] [PubMed]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid. Med. Cell Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [PubMed]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxid. Med. Cell Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef] [PubMed]
- Gaschler, M.M.; Stockwell, B.R. Lipid Peroxidation in Cell Death. Biochem. Biophys. Res. Commun. 2017, 482, 419. [Google Scholar] [CrossRef] [PubMed]
- Jakovljevic, B.; Novakov-Mikic, A.; Brkic, S.; Bogavac, M.A.; Tomic, S.; Miler, V. Lipid Peroxidation in the First Trimester of Pregnancy. J. Matern. -Fetal Neonatal Med. 2012, 25, 1316–1318. [Google Scholar] [CrossRef] [PubMed]
- Johnston, P.C.; McCance, D.R.; Holmes, V.A.; Young, I.S.; McGinty, A. Placental Antioxidant Enzyme Status and Lipid Peroxidation in Pregnant Women with Type 1 Diabetes: The Effect of Vitamin C and E Supplementation. J. Diabetes Complicat. 2016, 30, 109–114. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Tian, F.J.; Lin, Y.; Xu, W.M. Oxidative Stress: Placenta Function and Dysfunction. Am. J. Reprod. Immunol. 2016, 76, 258–271. [Google Scholar] [CrossRef] [PubMed]
- Schoots, M.H.; Gordijn, S.J.; Scherjon, S.A.; van Goor, H.; Hillebrands, J.L. Oxidative Stress in Placental Pathology. Placenta 2018, 69, 153–161. [Google Scholar] [CrossRef]
- Mégier, C.; Peoc’h, K.; Puy, V.; Cordier, A.G. Iron Metabolism in Normal and Pathological Pregnancies and Fetal Consequences. Metabolites 2022, 12, 129. [Google Scholar] [CrossRef]
- Zhang, Y.; Lu, Y.; Jin, L. Iron Metabolism and Ferroptosis in Physiological and Pathological Pregnancy. Int. J. Mol. Sci. 2022, 23, 9395. [Google Scholar] [CrossRef] [PubMed]
- Beharier, O.; Kajiwara, K.; Sadovsky, Y. Ferroptosis, Trophoblast Lipotoxic Damage, and Adverse Pregnancy Outcome. Placenta 2021, 108, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Yang, X.; Han, X.; Shi, M.; Sun, L.; Liu, M.; Zhang, P.; Huang, Z.; Yang, X.; Li, R. Ferroptosis-Related Gene Expression in the Pathogenesis of Preeclampsia. Front. Genet. 2022, 13, 2043. [Google Scholar]
- Salazar, G. NADPH Oxidases and Mitochondria in Vascular Senescence. Int. J. Mol. Sci. 2018, 19, 1327. [Google Scholar] [CrossRef] [PubMed]
- Tarafdar, A.; Pula, G. The Role of NADPH Oxidases and Oxidative Stress in Neurodegenerative Disorders. Int. J. Mol. Sci. 2018, 19, 3824. [Google Scholar] [CrossRef] [PubMed]
- Ursini, F.; Maiorino, M. Lipid Peroxidation and Ferroptosis: The Role of GSH and GPx4. Free Radic. Biol. Med. 2020, 152, 175–185. [Google Scholar] [CrossRef] [PubMed]
- Kawabata, H. Transferrin and Transferrin Receptors Update. Free Radic. Biol. Med. 2019, 133, 46–54. [Google Scholar] [CrossRef]
- Doll, S.; Proneth, B.; Tyurina, Y.Y.; Panzilius, E.; Kobayashi, S.; Ingold, I.; Irmler, M.; Beckers, J.; Aichler, M.; Walch, A.; et al. ACSL4 Dictates Ferroptosis Sensitivity by Shaping Cellular Lipid Composition. Nat. Chem. Biol. 2017, 13, 91–98. [Google Scholar] [CrossRef]
- Tsikas, D. Assessment of Lipid Peroxidation by Measuring Malondialdehyde (MDA) and Relatives in Biological Samples: Analytical and Biological Challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef]
- Sun, Q.Y.; Zhou, H.H.; Mao, X.Y. Emerging Roles of 5-Lipoxygenase Phosphorylation in Inflammation and Cell Death. Oxid. Med. Cell Longev. 2019, 2019, 2749173. [Google Scholar] [CrossRef]
- Bitonto, V.; Garello, F.; Scherberich, A.; Filippi, M. Prussian Blue Staining to Visualize Iron Oxide Nanoparticles. Methods Mol. Biol. 2023, 2566, 321–332. [Google Scholar] [CrossRef] [PubMed]
- Von Dadelszen, P.; Payne, B.; Li, J.; Ansermino, J.M.; Pipkin, F.B.; Côté, A.M.; Douglas, M.J.; Gruslin, A.; Hutcheon, J.A.; Joseph, K.S.; et al. Prediction of Adverse Maternal Outcomes in Pre-Eclampsia: Development and Validation of the FullPIERS Model. Lancet 2011, 377, 219–227. [Google Scholar] [CrossRef] [PubMed]
- Sibai, B.M. Evaluation and Management of Severe Preeclampsia before 34 Weeks’ Gestation. Am. J. Obs. Gynecol. 2011, 205, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Sáez, M.A.; Fraile-Martínez, O.; Álvarez-Mon, M.A.; García-Montero, C.; Guijarro, L.G.; Asúnsolo, Á.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; et al. Overexpression of Glycolysis Markers in Placental Tissue of Pregnant Women with Chronic Venous Disease: A Histological Study. Int. J. Med. Sci. 2022, 19, 186. [Google Scholar] [CrossRef]
- Vallone, P.M.; Butler, J.M. AutoDimer: A Screening Tool for Primer-Dimer and Hairpin Structures. Biotechniques 2004, 37, 226–231. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martinez, O.; García-Montero, C.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Saez, M.A.; Guijarro, L.G.; et al. Evidence of Increased Oxidative Stress in the Placental Tissue of Women Who Suffered an Episode of Psychosis during Pregnancy. Antioxidants 2023, 12, 179. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Rodríguez-Martín, S.; Funes Moñux, R.M.; Pekarek, L.; Bravo, C.; De Leon-Luis, J.A.; Saez, M.A.; Guijarro, L.G.; et al. Women with Psychotic Episodes during Pregnancy Show Increased Markers of Placental Damage with Tenney-Parker Changes. Histol. Histopathol. 2023, 38, 1109–1118. [Google Scholar] [CrossRef]
- Aouache, R.; Biquard, L.; Vaiman, D.; Miralles, F. Oxidative Stress in Preeclampsia and Placental Diseases. Int. J. Mol. Sci. 2018, 19, 1496. [Google Scholar] [CrossRef]
- Mukherjee, I.; Dhar, R.; Singh, S.; Sharma, J.B.; Nag, T.C.; Mridha, A.R.; Jaiswal, P.; Biswas, S.; Karmakar, S. Oxidative Stress-Induced Impairment of Trophoblast Function Causes Preeclampsia through the Unfolded Protein Response Pathway. Sci. Rep. 2021, 11, 18415. [Google Scholar] [CrossRef]
- Phoswa, W.N.; Khaliq, O.P. The Role of Oxidative Stress in Hypertensive Disorders of Pregnancy (Preeclampsia, Gestational Hypertension) and Metabolic Disorder of Pregnancy (Gestational Diabetes Mellitus). Oxid. Med. Cell Longev. 2021, 2021, 5581570. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Gan, J.; Zhang, M.; Du, Y.; Zhao, H. Ferroptosis and Its Emerging Role in Pre-Eclampsia. Antioxidants 2022, 11, 1282. [Google Scholar] [CrossRef] [PubMed]
- Yang, N.; Wang, Q.; Ding, B.; Gong, Y.; Wu, Y.; Sun, J.; Wang, X.; Liu, L.; Zhang, F.; Du, D.; et al. Expression Profiles and Functions of Ferroptosis-Related Genes in the Placental Tissue Samples of Early- and Late-Onset Preeclampsia Patients. BMC Pregnancy Childbirth 2022, 22, 87. [Google Scholar]
- Gupta, S.; Aziz, N.; Sekhon, L.; Agarwal, R.; Mansour, G.; Li, J.; Agarwal, A. Lipid Peroxidation and Antioxidant Status in Preeclampsia: A Systematic Review. Obs. Gynecol. Surv. 2009, 64, 750–759. [Google Scholar] [CrossRef]
- Marín, R.; Chiarello, D.I.; Abad, C.; Rojas, D.; Toledo, F.; Sobrevia, L. Oxidative Stress and Mitochondrial Dysfunction in Early-Onset and Late-Onset Preeclampsia. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2020, 1866, 165961. [Google Scholar] [CrossRef] [PubMed]
- Yun, H.R.; Jo, Y.H.; Kim, J.; Shin, Y.; Kim, S.S.; Choi, T.G. Roles of Autophagy in Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 3289. [Google Scholar] [CrossRef] [PubMed]
- McGarry, T.; Biniecka, M.; Veale, D.J.; Fearon, U. Hypoxia, Oxidative Stress and Inflammation. Free Radic. Biol. Med. 2018, 125, 15–24. [Google Scholar] [CrossRef] [PubMed]
- Sriyanti, R.; Mose, J.C.; Masrul, M.; Suharti, N. The Difference in Maternal Serum Hypoxia-Inducible Factors-1α Levels between Early Onset and Late-Onset Preeclampsia. Open Access Maced. J. Med. Sci. 2019, 7, 2133. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Puente, L.M.; García-Montero, C.; Fraile-Martinez, O.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; López-González, L.; Díaz-Pedrero, R.; Álvarez-Mon, M.; et al. Exploring the Importance of Differential Expression of Autophagy Markers in Term Placentas from Late-Onset Preeclamptic Pregnancies. Int. J. Mol. Sci. 2024, 25, 2029. [Google Scholar] [CrossRef]
- Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. [Google Scholar] [CrossRef]
- Vermot, A.; Petit-Härtlein, I.; Smith, S.M.E.; Fieschi, F. NADPH Oxidases (NOX): An Overview from Discovery, Molecular Mechanisms to Physiology and Pathology. Antioxidants 2021, 10, 890. [Google Scholar] [CrossRef]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Sola, M.; Álavrez-Rocha, M.J.; Sainz, F.; Álavrez-Mon, M.; Buján, J.; García-Honduvilla, N. Patients with Incompetent Valves in Chronic Venous Insufficiency Show Increased Systematic Lipid Peroxidation and Cellular Oxidative Stress Markers. Oxid Med Cell Longev. 2019, 10, 5164576. [Google Scholar] [CrossRef] [PubMed]
- Nayernia, Z.; Jaquet, V.; Krause, K.H. New Insights on NOX Enzymes in the Central Nervous System. Antioxid. Redox Signal. 2014, 20, 2815. [Google Scholar] [CrossRef]
- Sirokmány, G.; Donkó, Á.; Geiszt, M. Nox/Duox Family of NADPH Oxidases: Lessons from Knockout Mouse Models. Trends Pharmacol. Sci. 2016, 37, 318–327. [Google Scholar] [CrossRef]
- Hernandez, I.; Fournier, T.; Chissey, A.; Therond, P.; Slama, A.; Beaudeux, J.L.; Zerrad-Saadi, A. NADPH Oxidase Is the Major Source of Placental Superoxide in Early Pregnancy: Association with MAPK Pathway Activation. Sci. Rep. 2019, 9, 13962. [Google Scholar] [CrossRef]
- Poinsignon, L.; Chissey, A.; Ajjaji, A.; Hernandez, I.; Vignaud, M.L.; Ferecatu, I.; Fournier, T.; Beaudeux, J.L.; Zerrad-Saadi, A. Placental Cartography of NADPH Oxidase (NOX) Family Proteins: Involvement in the Pathophysiology of Preeclampsia. Arch. Biochem. Biophys. 2023, 749, 109787. [Google Scholar] [CrossRef]
- Williamson, R.D.; McCarthy, C.; McCarthy, F.P.; Kenny, L.C. Oxidative Stress in Pre-Eclampsia; Have We Been Looking in the Wrong Place? Pregnancy Hypertens. Int. J. Women’s Cardiovasc. Health 2017, 8, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.L.; Brockman, D.; Campos, B.; Myatt, L. Expression of NADPH Oxidase Isoform 1 (Nox1) in Human Placenta: Involvement in Preeclampsia. Placenta 2006, 27, 422. [Google Scholar] [CrossRef]
- Polettini, J.; Silva, M.G.; Kacerovsky, M.; Syed, T.A.; Saade, G.; Menon, R. Expression Profiles of Fetal Membrane Nicotinamide Adenine Dinucleotide Phosphate Oxidases (NOX) 2 and 3 Differentiates Spontaneous Preterm Birth and PPROM Pathophysiologies. Placenta 2014, 35, 188–194. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Martínez-Vivero, C.; Sainz, F.; Bravo, C.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Pregnancy-Associated Venous Insufficiency Course with Placental and Systemic Oxidative Stress. J. Cell Mol. Med. 2020, 24, 4157–4170. [Google Scholar] [CrossRef]
- Chen, J.; Gao, Q.; Jiang, L.; Feng, X.; Zhu, X.; Fan, X.; Mao, C.; Xu, Z. The NOX2-Derived Reactive Oxygen Species Damaged Endothelial Nitric Oxide System via Suppressed BKCa/SKCa in Preeclampsia. Hypertens. Res. 2017, 40, 457–464. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhu, M.; Zu, Y.; Wang, G.; Li, X.; Yan, J. Nox2 Inhibition Reduces Trophoblast Ferroptosis in Preeclampsia via the STAT3/GPX4 Pathway. Life Sci. 2024, 343, 122555. [Google Scholar] [CrossRef]
- Zhou, B.; Liu, J.; Kang, R.; Klionsky, D.J.; Kroemer, G.; Tang, D. Ferroptosis Is a Type of Autophagy-Dependent Cell Death. Semin. Cancer Biol. 2020, 66, 89–100. [Google Scholar] [CrossRef]
- Masoumi, Z.; Hansson, L.R.; Hansson, E.; Ahlm, E.; Mezey, E.; Erlandsson, L.; Hansson, S.R. Assessing Erythroferrone and Iron Homeostasis in Preeclamptic and Normotensive Pregnancies: A Retrospective Study. Placenta 2023, 133, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Fraile-Martinez, O.; García-Montero, C.; Funes Moñux, R.M.; Rodriguez-Martín, S.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Saez, M.A.; Guijarro, L.G.; et al. The Placentas of Women Who Suffer an Episode of Psychosis during Pregnancy Have Increased Lipid Peroxidation with Evidence of Ferroptosis. Biomolecules 2023, 13, 120. [Google Scholar] [CrossRef]
- Feng, H.; Schorpp, K.; Jin, J.; Yozwiak, C.E.; Hoffstrom, B.G.; Decker, A.M.; Rajbhandari, P.; Stokes, M.E.; Bender, H.G.; Csuka, J.M.; et al. Transferrin Receptor Is a Specific Ferroptosis Marker. Cell Rep. 2020, 30, 3411. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular Mechanisms and Health Implications. Cell Res. 2020, 31, 107–125. [Google Scholar] [CrossRef]
- Shimbara-Matsubayashi, S.; Kuwata, H.; Tanaka, N.; Kato, M.; Hara, S. Analysis on the Substrate Specificity of Recombinant Human Acyl-CoA Synthetase ACSL4 Variants. Biol. Pharm. Bull. 2019, 42, 850–855. [Google Scholar] [CrossRef] [PubMed]
- Kuwata, H.; Hara, S. Role of Acyl-CoA Synthetase ACSL4 in Arachidonic Acid Metabolism. Prostaglandins Other Lipid Mediat. 2019, 144, 106363. [Google Scholar] [CrossRef]
- Xie, Y.; Kang, R.; Klionsky, D.J.; Tang, D. GPX4 in Cell Death, Autophagy, and Disease. Autophagy 2023, 19, 2621. [Google Scholar] [CrossRef]
- Maiorino, M.; Conrad, M.; Ursini, F. GPx4, Lipid Peroxidation, and Cell Death: Discoveries, Rediscoveries, and Open Issues. Antioxid. Redox Signal 2018, 29, 61–74. [Google Scholar] [CrossRef] [PubMed]
- Conrad, M.; Friedmann Angeli, J.P. Glutathione Peroxidase 4 (Gpx4) and Ferroptosis: What’s so Special about It? Mol. Cell Oncol. 2015, 2, e995047. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; Su, Z.; Kon, N.; Chu, B.; Li, H.; Jiang, X.; Luo, J.; Stockwell, B.R.; Gu, W. ALOX5-Mediated Ferroptosis Acts as a Distinct Cell Death Pathway upon Oxidative Stress in Huntington’s Disease. Genes Dev. 2023, 37, 204–217. [Google Scholar] [PubMed]
- Seibt, T.M.; Proneth, B.; Conrad, M. Role of GPX4 in Ferroptosis and Its Pharmacological Implication. Free Radic. Biol. Med. 2019, 133, 144–152. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Du, J.; Zhang, Y.; Wang, Y.; Wang, B.; Zhang, T. GPX4-Independent Ferroptosis—A New Strategy in Disease’s Therapy. Cell Death Discovery 2022, 8, 434. [Google Scholar] [CrossRef] [PubMed]
- Girón, S.H.; Sanz, J.M.; Ortega, M.A.; Garcia-Montero, C.; Fraile-Martínez, O.; Gómez-Lahoz, A.M.; Boaru, D.L.; de Leon-Oliva, D.; Guijarro, L.G.; Atienza-Perez, M.; et al. Prognostic Value of Malondialdehyde (MDA) in the Temporal Progression of Chronic Spinal Cord Injury. J. Pers. Med. 2023, 13, 626. [Google Scholar] [CrossRef]
- Alvarez-Mon, M.A.; Ortega, M.A.; García-Montero, C.; Fraile-Martinez, O.; Lahera, G.; Monserrat, J.; Gomez-Lahoz, A.M.; Molero, P.; Gutierrez-Rojas, L.; Rodriguez-Jimenez, R.; et al. Differential Malondialdehyde (MDA) Detection in Plasma Samples of Patients with Major Depressive Disorder (MDD): A Potential Biomarker. J. Int. Med. Res. 2022, 50, 030006052210949. [Google Scholar] [CrossRef]
- Ortega, M.A.; Sánchez-Trujillo, L.; Bravo, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Alvarez-Mon, M.A.; Sainz, F.; Alvarez-Mon, M.; Bujan, J.; et al. Newborns of Mothers with Venous Disease during Pregnancy Show Increased Levels of Lipid Peroxidation and Markers of Oxidative Stress and Hypoxia in the Umbilical Cord. Antioxidants 2021, 10, 980. [Google Scholar] [CrossRef]
- Gohil, J.T.; Patel, P.K.; Priyanka, G. Evaluation of Oxidative Stress and Antioxidant Defence in Subjects of Preeclampsia. J. Obs. Gynaecol. India 2011, 61, 638. [Google Scholar] [CrossRef]
- Freire, V.A.F.; de Melo, A.D.; de Lima Santos, H.; Barros-Pinheiro, M. Evaluation of Oxidative Stress Markers in Subtypes of Preeclampsia: A Systematic Review and Meta-Analysis. Placenta 2023, 132, 55–67. [Google Scholar] [CrossRef]
- Afrose, D.; Chen, H.; Ranashinghe, A.; Liu, C.C.; Henessy, A.; Hansbro, P.M.; McClements, L. The Diagnostic Potential of Oxidative Stress Biomarkers for Preeclampsia: Systematic Review and Meta-Analysis. Biol. Sex. Differ. 2022, 13, 26. [Google Scholar] [CrossRef] [PubMed]
- Kwiatkowska, E.; Stefańska, K.; Zieliński, M.; Sakowska, J.; Jankowiak, M.; Trzonkowski, P.; Marek-Trzonkowska, N.; Kwiatkowski, S. Podocytes—The Most Vulnerable Renal Cells in Preeclampsia. Int. J. Mol. Sci. 2020, 21, 5051. [Google Scholar] [CrossRef] [PubMed]
- Mesfine, B.B.; Vojisavljevic, D.; Kapoor, R.; Watson, D.; Kandasamy, Y.; Rudd, D. Urinary nephrin-a potential marker of early glomerular injury: A systematic review and meta-analysis. J. Nephrol. 2024, 37, 39–51. [Google Scholar] [CrossRef] [PubMed]
- Avendanha, R.A.; Campos, G.F.C.; Branco, B.C.; Ishii, N.C.; Gomes, L.H.N.; de Castro, A.J.; Leal, C.R.V.; e Silva, A.C.S. Potential urinary biomarkers in preeclampsia: A narrative review. Mol. Biol. Rep. 2024, 51, 172. [Google Scholar] [CrossRef]
- Phipps, E.A.; Thadhani, R.; Benzing, T.; Karumanchi, S.A. Pre-eclampsia: Pathogenesis, novel diagnostics and therapies. Nat. Rev. Nephrol. 2019, 15, 275–289. [Google Scholar] [CrossRef]
HC (n = 43) | LO-PE (n = 68) | p-Value | |
---|---|---|---|
Maternal age (years) Mean ± SD | 31.35 ± 5.12 | 29.02 ± 4.82 | p = 0.0154 (*) |
Nulliparity (%) Total number | 14 (32.56) | 53 (77.94) | p < 0.0001 (***) |
Gestation time (weeks) | 39.07 ± 1.49 | 38.63 ± 1.43 | NS |
Cesarean (%) Total number | 8 (18.60) | 15 (22.06) | NS, p = 0.27 |
Placental weight (g) | 500.98 ± 65.33 | 370.25 ± 61.65 | p < 0.0001 (***) |
Gene | Sequence Fwd (5′ → 3′) | Sequence Rev (5′ → 3′) | Temp |
---|---|---|---|
NOX-1 | GTTTTACCGCTCCCAGCAGAA | GGATGCCATTCCAGGAGAGAG | 55 °C |
NOX-2 | TCCGCATCGTTGGGGACTGGA | CCAAAGGGCCCATCAACCGCT | 60 °C |
GPX4 | ATTGGTCGGCTGGACGAG | CCGAACTGGTTACACGGGAA | 59 °C |
TFRC | GAACTACACCGACCCTCGTG | GTGCTGTCCAGTTTCTCCGA | 60 °C |
ACSL-4 | GCTGGGACAGTTACTGAAGGT | AGAGATACATACTCTCCTGCTTGT | 58 °C |
ALOX-5 | TGGCGCGGTGGATTCATAC | AGGGGTCTGTTTTGTTGGCA | 60 °C |
Antigen | Species | Dilution | Provider | Protocol Specifications |
---|---|---|---|---|
NOX-1 | Rabbit polyclonal | 1:250 | Abcam (ab78016) | 10 mM sodium citrate pH = 6 before incubation with blocking solution |
NOX-2 | Goat polyclonal | 1:500 | Abcam (ab111175) | 0.1% Triton X-100 in PBS, 10 min, before incubation with blocking solution |
GPX4 | Rabbit monoclonal | 1:100 | Abcam (ab125066) | 10 mM sodium citrate pH = 6, before incubation with blocking solution |
TFRC | Rabbit monoclonal | 1:500 | Abcam (ab185550) | EDTA pH = 9, before incubation with blocking solution |
ACSL-4 | Rabbit monoclonal | 1:100 | Abcam (ab155282) | 100% Triton, 0.1% in PBS for 10 min, before incubation with blocking solution |
ALOX-5 | Rabbit monoclonal | 1:250 | Abcam (ab169755) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ortega, M.A.; Garcia-Puente, L.M.; Fraile-Martinez, O.; Pekarek, T.; García-Montero, C.; Bujan, J.; Pekarek, L.; Barrena-Blázquez, S.; Gragera, R.; Rodríguez-Rojo, I.C.; et al. Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants 2024, 13, 591. https://doi.org/10.3390/antiox13050591
Ortega MA, Garcia-Puente LM, Fraile-Martinez O, Pekarek T, García-Montero C, Bujan J, Pekarek L, Barrena-Blázquez S, Gragera R, Rodríguez-Rojo IC, et al. Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants. 2024; 13(5):591. https://doi.org/10.3390/antiox13050591
Chicago/Turabian StyleOrtega, Miguel A., Luis M. Garcia-Puente, Oscar Fraile-Martinez, Tatiana Pekarek, Cielo García-Montero, Julia Bujan, Leonel Pekarek, Silvestra Barrena-Blázquez, Raquel Gragera, Inmaculada C. Rodríguez-Rojo, and et al. 2024. "Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia" Antioxidants 13, no. 5: 591. https://doi.org/10.3390/antiox13050591
APA StyleOrtega, M. A., Garcia-Puente, L. M., Fraile-Martinez, O., Pekarek, T., García-Montero, C., Bujan, J., Pekarek, L., Barrena-Blázquez, S., Gragera, R., Rodríguez-Rojo, I. C., Rodríguez-Benitez, P., López-González, L., Díaz-Pedrero, R., Álvarez-Mon, M., García-Honduvilla, N., De León-Luis, J. A., Bravo, C., & Saez, M. A. (2024). Oxidative Stress, Lipid Peroxidation and Ferroptosis Are Major Pathophysiological Signatures in the Placental Tissue of Women with Late-Onset Preeclampsia. Antioxidants, 13(5), 591. https://doi.org/10.3390/antiox13050591