Roles of 670 nm Photobiomodulation on Rat Anterior Ischemic Optic Neuropathy: Enhancing RGC Survival, Mitochondrial Function, and Anti-Inflammatory Response
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Animals
2.3. AION Induction of Rat
2.4. 670 nm Light Source Device and Treatment
2.5. Retrograde Labeling of RGCs with FluoroGold and Morphometry of the RGCs
2.6. Flash Visual Evoked Potentials (FVEPs)
2.7. Sample Section Preparation
2.8. In Situ TdT-dUTP Nick End-Labeling (TUNEL) Assay
2.9. Immunohistochemical Staining
2.10. ATP Assay
2.11. Retinal RNA Isolation and Real-Time PCR
2.12. Western Blotting Analysis
2.13. Statistical Analysis
3. Results
3.1. Treatment with 670 nm Light for 10 Min Program Preserves Visual Function
3.2. Treatment with 670 nm Light for 10 Min Program Promotes Survival of RGCs
3.3. Treatment with 670 nm Light for 10 Min Program Inhibits RGCs Apoptosis and Reduces the Expressions of Apoptotic Markers in the Retina
3.4. Treatment with 670 nm Light for 10 Min Program Inhibits Macrophage Infiltration and Reduces Inflammation in the Optic Nerve and Retina
3.5. Treatment with 670 nm Light for 10 Min Program Decreased Oxidative Damage and Increased ATP Production by Increasing Mitochondria in the Retina
3.6. Treatment with 670 nm Light for 10 Min Program Reduced Inflammation and Promoted Antioxidative Pathways by Increasing Mitochondrial Metabolism in the Retina
4. Discussion
4.1. Neuroprotection
4.2. RGC Survival
4.3. Apoptosis Inhibition
4.4. Anti-Inflammatory Effects
4.5. Mitochondrial Function
4.6. Clinical Implications
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Swartz, N.G.; Beck, R.W.; Savino, P.J.; Sergott, R.C.; Bosley, T.M.; Lam, B.L.; Drucker, M.; Katz, B. Pain in anterior ischemic optic neuropathy. J. Neuro-Ophthalmol. 1995, 15, 9–10. [Google Scholar] [CrossRef]
- Kerr, N.M.; Chew, S.S.; Danesh-Meyer, H.V. Non-arteritic anterior ischaemic optic neuropathy: A review and update. J. Clin. Neurosci. 2009, 16, 994–1000. [Google Scholar] [CrossRef]
- Bernstein, S.L.; Johnson, M.A.; Miller, N.R. Nonarteritic anterior ischemic optic neuropathy (NAION) and its experimental models. Prog. Retin. Eye Res. 2011, 30, 167–187. [Google Scholar] [CrossRef] [PubMed]
- Arnold, A.C. Pathogenesis of nonarteritic anterior ischemic optic neuropathy. J. Neuro-Ophthalmol. 2003, 23, 157–163. [Google Scholar] [CrossRef]
- Lee, Y.C.; Wang, J.H.; Huang, T.L.; Tsai, R.K. Increased Risk of Stroke in Patients with Nonarteritic Anterior Ischemic Optic Neuropathy: A Nationwide Retrospective Cohort Study. Am. J. Ophthalmol. 2016, 170, 183–189. [Google Scholar] [CrossRef]
- Yang, Y.; Xu, C.; Chen, Y.; Liang, J.J.; Xu, Y.; Chen, S.L.; Huang, S.; Yang, Q.; Cen, L.P.; Pang, C.P.; et al. Green Tea Extract Ameliorates Ischemia-Induced Retinal Ganglion Cell Degeneration in Rats. Oxidative Med. Cell. Longev. 2019, 2019, 8407206. [Google Scholar] [CrossRef]
- Park, J.W.; Sung, M.S.; Ha, J.Y.; Guo, Y.; Piao, H.; Heo, H.; Park, S.W. Neuroprotective Effect of Brazilian Green Propolis on Retinal Ganglion Cells in Ischemic Mouse Retina. Curr. Eye Res. 2020, 45, 955–964. [Google Scholar] [CrossRef]
- Guan, L.; Li, C.; Zhang, Y.; Gong, J.; Wang, G.; Tian, P.; Shen, N. Puerarin ameliorates retinal ganglion cell damage induced by retinal ischemia/reperfusion through inhibiting the activation of TLR4/NLRP3 inflammasome. Life Sci. 2020, 256, 117935. [Google Scholar] [CrossRef]
- Wen, Y.T.; Huang, T.L.; Huang, S.P.; Chang, C.H.; Tsai, R.K. Early applications of granulocyte colony-stimulating factor (G-CSF) can stabilize the blood-optic-nerve barrier and ameliorate inflammation in a rat model of anterior ischemic optic neuropathy (rAION). Dis. Models Mech. 2016, 9, 1193–1202. [Google Scholar] [CrossRef]
- Georgiou, T.; Wen, Y.T.; Chang, C.H.; Kolovos, P.; Kalogerou, M.; Prokopiou, E.; Neokleous, A.; Huang, C.T.; Tsai, R.K. Neuroprotective Effects of Omega-3 Polyunsaturated Fatty Acids in a Rat Model of Anterior Ischemic Optic Neuropathy. Investig. Ophthalmol. Vis. Sci. 2017, 58, 1603–1611. [Google Scholar] [CrossRef]
- Salgado, C.; Vilson, F.; Miller, N.R.; Bernstein, S.L. Cellular inflammation in nonarteritic anterior ischemic optic neuropathy and its primate model. Arch. Ophthalmol. 2011, 129, 1583–1591. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Cho, H.; Hartsock, M.J.; Mitchell, K.L.; Gong, J.; Wu, L.; Wei, Y.; Wang, S.; Thimmulappa, R.K.; Sporn, M.B.; et al. Neuroprotective role of Nrf2 for retinal ganglion cells in ischemia-reperfusion. J. Neurochem. 2015, 133, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Wen, P.; Sun, Z.; Gou, F.; Wang, J.; Fan, Q.; Zhao, D.; Yang, L. Oxidative stress and mitochondrial impairment: Key drivers in neurodegenerative disorders. Ageing Res. Rev. 2025, 104, 102667. [Google Scholar] [CrossRef] [PubMed]
- Jurcau, A. Insights into the Pathogenesis of Neurodegenerative Diseases: Focus on Mitochondrial Dysfunction and Oxidative Stress. Int. J. Mol. Sci. 2021, 22, 11847. [Google Scholar] [CrossRef]
- Kim, G.H.; Kim, J.E.; Rhie, S.J.; Yoon, S. The Role of Oxidative Stress in Neurodegenerative Diseases. Exp. Neurobiol. 2015, 24, 325–340. [Google Scholar] [CrossRef]
- Federico, A.; Cardaioli, E.; Da Pozzo, P.; Formichi, P.; Gallus, G.N.; Radi, E. Mitochondria, oxidative stress and neurodegeneration. J. Neurol. Sci. 2012, 322, 254–262. [Google Scholar] [CrossRef]
- Bernstein, S.L.; Guo, Y.; Kelman, S.E.; Flower, R.W.; Johnson, M.A. Functional and cellular responses in a novel rodent model of anterior ischemic optic neuropathy. Investig. Ophthalmol. Vis. Sci. 2003, 44, 4153–4162. [Google Scholar] [CrossRef]
- Wen, Y.T.; Huang, C.W.; Liu, C.P.; Chen, C.H.; Tu, C.M.; Hwang, C.S.; Chen, Y.H.; Chen, W.R.; Lin, K.L.; Ho, Y.C.; et al. Inhibition of Retinal Ganglion Cell Loss by a Novel ROCK Inhibitor (E212) in Ischemic Optic Nerve Injury Via Antioxidative and Anti-Inflammatory Actions. Investig. Ophthalmol. Vis. Sci. 2021, 62, 21. [Google Scholar] [CrossRef]
- Liu, P.K.; Wen, Y.T.; Lin, W.; Kapupara, K.; Tai, M.; Tsai, R.K. Neuroprotective effects of low-dose G-CSF plus meloxicam in a rat model of anterior ischemic optic neuropathy. Sci. Rep. 2020, 10, 10351. [Google Scholar] [CrossRef]
- Huang, S.P.; Fang, K.T.; Chang, C.H.; Huang, T.L.; Wen, Y.T.; Tsai, R.K. Autocrine protective mechanisms of human granulocyte colony-stimulating factor (G-CSF) on retinal ganglion cells after optic nerve crush. Exp. Eye Res. 2016, 143, 132–140. [Google Scholar] [CrossRef]
- Chen, T.W.; Wu, P.Y.; Wen, Y.T.; Desai, T.D.; Huang, C.T.; Liu, P.K.; Tsai, R.K. Vitamin B3 Provides Neuroprotection via Antioxidative Stress in a Rat Model of Anterior Ischemic Optic Neuropathy. Antioxidants 2022, 11, 2422. [Google Scholar] [CrossRef]
- Lin, W.N.; Kapupara, K.; Wen, Y.T.; Chen, Y.H.; Pan, I.H.; Tsai, R.K. Haematococcus pluvialis-Derived Astaxanthin Is a Potential Neuroprotective Agent against Optic Nerve Ischemia. Mar. Drugs 2020, 18, 85. [Google Scholar] [CrossRef]
- Kapupara, K.; Wen, Y.T.; Tsai, R.K.; Huang, S.P. Soluble P-selectin promotes retinal ganglion cell survival through activation of Nrf2 signaling after ischemia injury. Cell Death Dis. 2017, 8, e3172. [Google Scholar] [CrossRef] [PubMed]
- Chung, H.; Dai, T.; Sharma, S.K.; Huang, Y.Y.; Carroll, J.D.; Hamblin, M.R. The nuts and bolts of low-level laser (light) therapy. Ann. Biomed. Eng. 2012, 40, 516–533. [Google Scholar] [CrossRef]
- Karu, T. Primary and secondary mechanisms of action of visible to near-IR radiation on cells. J. Photochem. Photobiol. B Biol. 1999, 49, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Karu, T.I.; Kolyakov, S.F. Exact action spectra for cellular responses relevant to phototherapy. Photomed. Laser Surg. 2005, 23, 355–361. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Y.; Chen, C.H.; Wang, C.Z.; Ho, M.L.; Yeh, M.L.; Wang, Y.H. Low-power laser irradiation suppresses inflammatory response of human adipose-derived stem cells by modulating intracellular cyclic AMP level and NF-κB activity. PLoS ONE 2013, 8, e54067. [Google Scholar] [CrossRef] [PubMed]
- Hamblin, M.R. Mechanisms and Mitochondrial Redox Signaling in Photobiomodulation. Photochem. Photobiol. 2018, 94, 199–212. [Google Scholar] [CrossRef]
- Wong-Riley, M.T.; Liang, H.L.; Eells, J.T.; Chance, B.; Henry, M.M.; Buchmann, E.; Kane, M.; Whelan, H.T. Photobiomodulation directly benefits primary neurons functionally inactivated by toxins: Role of cytochrome c oxidase. J. Biol. Chem. 2005, 280, 4761–4771. [Google Scholar] [CrossRef]
- Shen, W.; Teo, K.Y.C.; Wood, J.P.M.; Vaze, A.; Chidlow, G.; Ao, J.; Lee, S.R.; Yam, M.X.; Cornish, E.E.; Fraser-Bell, S.; et al. Preclinical and clinical studies of photobiomodulation therapy for macular oedema. Diabetologia 2020, 63, 1900–1915. [Google Scholar] [CrossRef]
- Natoli, R.; Valter, K.; Barbosa, M.; Dahlstrom, J.; Rutar, M.; Kent, A.; Provis, J. 670nm photobiomodulation as a novel protection against retinopathy of prematurity: Evidence from oxygen induced retinopathy models. PLoS ONE 2013, 8, e72135. [Google Scholar] [CrossRef]
- Eells, J.T.; Henry, M.M.; Summerfelt, P.; Wong-Riley, M.T.; Buchmann, E.V.; Kane, M.; Whelan, N.T.; Whelan, H.T. Therapeutic photobiomodulation for methanol-induced retinal toxicity. Proc. Natl. Acad. Sci. USA 2003, 100, 3439–3444. [Google Scholar] [CrossRef]
- Tsai, R.K.; Lin, K.L.; Huang, C.T.; Wen, Y.T. Transcriptomic Analysis Reveals That Granulocyte Colony-Stimulating Factor Trigger a Novel Signaling Pathway (TAF9-P53-TRIAP1-CASP3) to Protect Retinal Ganglion Cells after Ischemic Optic Neuropathy. Int. J. Mol. Sci. 2022, 23, 8359. [Google Scholar] [CrossRef]
- Beirne, K.; Freeman, T.J.; Rozanowska, M.; Votruba, M. Red Light Irradiation In Vivo Upregulates DJ-1 in the Retinal Ganglion Cell Layer and Protects against Axotomy-Related Dendritic Pruning. Int. J. Mol. Sci. 2021, 22, 8380. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.S.; Johnson, M.A.; Flower, R.A.; Slater, B.J.; Miller, N.R.; Bernstein, S.L. A primate model of nonarteritic anterior ischemic optic neuropathy. Investig. Ophthalmol. Vis. Sci. 2008, 49, 2985–2992. [Google Scholar] [CrossRef] [PubMed]
- Albarracin, R.; Valter, K. 670 nm red light preconditioning supports Müller cell function: Evidence from the white light-induced damage model in the rat retina. Photochem. Photobiol. 2012, 88, 1418–1427. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.Z.; Fernando, N.; Natoli, R.; Madigan, M.; Valter, K. 670 nm light treatment following retinal injury modulates Müller cell gliosis: Evidence from in vivo and in vitro stress models. Exp. Eye Res. 2018, 169, 1–12. [Google Scholar] [CrossRef]
- Marco, F.D.; Romeo, S.; Nandasena, C.; Purushothuman, S.; Adams, C.; Bisti, S.; Stone, J. The time course of action of two neuroprotectants, dietary saffron and photobiomodulation, assessed in the rat retina. Am. J. Neurodegener. Dis. 2013, 2, 208–220. [Google Scholar]
- Begum, R.; Powner, M.B.; Hudson, N.; Hogg, C.; Jeffery, G. Treatment with 670 nm light up regulates cytochrome C oxidase expression and reduces inflammation in an age-related macular degeneration model. PLoS ONE 2013, 8, e57828. [Google Scholar] [CrossRef]
- Huang, C.T.; Wen, Y.T.; Desai, T.D.; Tsai, R.K. Intravitreal Injection of Long-Acting Pegylated Granulocyte Colony-Stimulating Factor Provides Neuroprotective Effects via Antioxidant Response in a Rat Model of Traumatic Optic Neuropathy. Antioxidants 2021, 10, 1934. [Google Scholar] [CrossRef]
- Milligan, C.E.; Cunningham, T.J.; Levitt, P. Differential immunochemical markers reveal the normal distribution of brain macrophages and microglia in the developing rat brain. J. Comp. Neurol. 1991, 314, 125–135. [Google Scholar] [CrossRef] [PubMed]
- Chan, C.K.; Cheng, A.C.; Leung, C.K.; Cheung, C.Y.; Yung, A.Y.; Gong, B.; Lam, D.S. Quantitative assessment of optic nerve head morphology and retinal nerve fibre layer in non-arteritic anterior ischaemic optic neuropathy with optical coherence tomography and confocal scanning laser ophthalmoloscopy. Br. J. Ophthalmol. 2009, 93, 731–735. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Xu, Y.; Liang, J.J.; Zhuang, X.; Ng, T.K. Longitudinal and simultaneous profiling of 11 modes of cell death in mouse retina post-optic nerve injury. Exp. Eye Res. 2022, 222, 109159. [Google Scholar] [CrossRef] [PubMed]
- Masland, R.H. The fundamental plan of the retina. Nat. Neurosci. 2001, 4, 877–886. [Google Scholar] [CrossRef]
- Famiglietti, E.V., Jr.; Kolb, H. Structural basis for ON-and OFF-center responses in retinal ganglion cells. Science 1976, 194, 193–195. [Google Scholar] [CrossRef]
- Milosavljevic, N.; Storchi, R.; Eleftheriou, C.G.; Colins, A.; Petersen, R.S.; Lucas, R.J. Photoreceptive retinal ganglion cells control the information rate of the optic nerve. Proc. Natl. Acad. Sci. USA 2018, 115, E11817–E11826. [Google Scholar] [CrossRef]
- Tang, J.; Du, Y.; Lee, C.A.; Talahalli, R.; Eells, J.T.; Kern, T.S. Low-intensity far-red light inhibits early lesions that contribute to diabetic retinopathy: In vivo and in vitro. Investig. Ophthalmol. Vis. Sci. 2013, 54, 3681–3690. [Google Scholar] [CrossRef]
- Saliba, A.; Du, Y.; Liu, H.; Patel, S.; Roberts, R.; Berkowitz, B.A.; Kern, T.S. Photobiomodulation Mitigates Diabetes-Induced Retinopathy by Direct and Indirect Mechanisms: Evidence from Intervention Studies in Pigmented Mice. PLoS ONE 2015, 10, e0139003. [Google Scholar] [CrossRef]
- Yu, D.Y.; Cringle, S.J.; Balaratnasingam, C.; Morgan, W.H.; Yu, P.K.; Su, E.N. Retinal ganglion cells: Energetics, compartmentation, axonal transport, cytoskeletons and vulnerability. Prog. Retin. Eye Res. 2013, 36, 217–246. [Google Scholar] [CrossRef]
- Coubard, O.; Kapoula, Z.; Müri, R.; Rivaud-Péchoux, S. Effects of TMS over the right prefrontal cortex on latency of saccades and convergence. Investig. Ophthalmol. Vis. Sci. 2003, 44, 600–609. [Google Scholar] [CrossRef][Green Version]
- Indo, H.P.; Davidson, M.; Yen, H.C.; Suenaga, S.; Tomita, K.; Nishii, T.; Higuchi, M.; Koga, Y.; Ozawa, T.; Majima, H.J. Evidence of ROS generation by mitochondria in cells with impaired electron transport chain and mitochondrial DNA damage. Mitochondrion 2007, 7, 106–118. [Google Scholar] [CrossRef]
- Muste, J.C.; Russell, M.W.; Singh, R.P. Photobiomodulation Therapy for Age-Related Macular Degeneration and Diabetic Retinopathy: A Review. Clin. Ophthalmol. 2021, 15, 3709–3720. [Google Scholar] [CrossRef] [PubMed]
- Eells, J.T.; Wong-Riley, M.T.; VerHoeve, J.; Henry, M.; Buchman, E.V.; Kane, M.P.; Gould, L.J.; Das, R.; Jett, M.; Hodgson, B.D.; et al. Mitochondrial signal transduction in accelerated wound and retinal healing by near-infrared light therapy. Mitochondrion 2004, 4, 559–567. [Google Scholar] [CrossRef] [PubMed]
- Cui, G.; Luk, S.C.; Li, R.A.; Chan, K.K.; Lei, S.W.; Wang, L.; Shen, H.; Leung, G.P.; Lee, S.M. Cytoprotection of baicalein against oxidative stress-induced cardiomyocytes injury through the Nrf2/Keap1 pathway. J. Cardiovasc. Pharmacol. 2015, 65, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Hikisz, P.; Kiliańska, Z.M. PUMA, a critical mediator of cell death--one decade on from its discovery. Cell. Mol. Biol. Lett. 2012, 17, 646–669. [Google Scholar] [CrossRef]
- Liu, M.; Bai, X.; Yu, S.; Zhao, W.; Qiao, J.; Liu, Y.; Zhao, D.; Wang, J.; Wang, S. Ginsenoside Re Inhibits ROS/ASK-1 Dependent Mitochondrial Apoptosis Pathway and Activation of Nrf2-Antioxidant Response in Beta-Amyloid-Challenged SH-SY5Y Cells. Molecules 2019, 24, 2687. [Google Scholar] [CrossRef]
- Wang, Z.B.; Liu, Y.Q.; Cui, Y.F. Pathways to caspase activation. Cell Biol. Int. 2005, 29, 489–496. [Google Scholar] [CrossRef]
- Del Dotto, V.; Fogazza, M.; Carelli, V.; Rugolo, M.; Zanna, C. Eight human OPA1 isoforms, long and short: What are they for? Biochim. Biophys. Acta Bioenerg. 2018, 1859, 263–269. [Google Scholar] [CrossRef]
- Brambilla, R.; Dvoriantchikova, G.; Barakat, D.; Ivanov, D.; Bethea, J.R.; Shestopalov, V.I. Transgenic inhibition of astroglial NF-κB protects from optic nerve damage and retinal ganglion cell loss in experimental optic neuritis. J. Neuroinflammation 2012, 9, 213. [Google Scholar] [CrossRef]
- Shi, H.Y.; Yan, S.M.; Guo, Y.M.; Zhang, B.Q.; Guo, X.Y.; Shi, B.L. Vitamin A pretreatment protects NO-induced bovine mammary epithelial cells from oxidative stress by modulating Nrf2 and NF-κB signaling pathways. J. Anim. Sci. 2018, 96, 1305–1316. [Google Scholar] [CrossRef]
- Kalogeris, T.; Bao, Y.; Korthuis, R.J. Mitochondrial reactive oxygen species: A double edged sword in ischemia/reperfusion vs preconditioning. Redox Biol. 2014, 2, 702–714. [Google Scholar] [CrossRef]
- Buja, L.M. The pathobiology of acute coronary syndromes: Clinical implications and central role of the mitochondria. Tex. Heart Inst. J. 2013, 40, 221–228. [Google Scholar] [PubMed]
- Gureev, A.P.; Shaforostova, E.A.; Popov, V.N. Regulation of Mitochondrial Biogenesis as a Way for Active Longevity: Interaction Between the Nrf2 and PGC-1α Signaling Pathways. Front. Genet. 2019, 10, 435. [Google Scholar] [CrossRef] [PubMed]
- Virbasius, J.V.; Scarpulla, R.C. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: A potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis. Proc. Natl. Acad. Sci. USA 1994, 91, 1309–1313. [Google Scholar] [CrossRef] [PubMed]
- Sandhu, J.K.; Sodja, C.; Ribecco-Lutkiewicz, M.; Wu, Y.T.; Ma, Y.S.; Wei, Y.H.; Sikorska, M. Effects of Tolerance-Induced Preconditioning on Mitochondrial Biogenesis in Undifferentiated and Differentiated Neuronal Cells. Front. Biosci. 2022, 27, 115. [Google Scholar] [CrossRef]
- Mishra, P.; Carelli, V.; Manfredi, G.; Chan, D.C. Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Cell Metab. 2014, 19, 630–641. [Google Scholar] [CrossRef]
- Ju, W.K.; Kim, K.Y.; Duong-Polk, K.X.; Lindsey, J.D.; Ellisman, M.H.; Weinreb, R.N. Increased optic atrophy type 1 expression protects retinal ganglion cells in a mouse model of glaucoma. Mol. Vis. 2010, 16, 1331–1342. [Google Scholar]
- Wang, L.; Mao, L.; Huang, Z.; Switzer, J.A.; Hess, D.C.; Zhang, Q. Photobiomodulation: Shining a light on depression. Theranostics 2025, 15, 362–383. [Google Scholar] [CrossRef]
- Beirne, K.; Rozanowska, M.; Votruba, M. Red Light Treatment in an Axotomy Model of Neurodegeneration. Photochem. Photobiol. 2016, 92, 624–631. [Google Scholar] [CrossRef]
- Salehpour, F.; Mahmoudi, J.; Kamari, F.; Sadigh-Eteghad, S.; Rasta, S.H.; Hamblin, M.R. Brain Photobiomodulation Therapy: A Narrative Review. Mol. Neurobiol. 2018, 55, 6601–6636. [Google Scholar] [CrossRef]
- Nairuz, T.; Sangwoo, C.; Lee, J.H. Photobiomodulation Therapy on Brain: Pioneering an Innovative Approach to Revolutionize Cognitive Dynamics. Cells 2024, 13, 966. [Google Scholar] [CrossRef]
- Shen, Q.; Guo, H.; Yan, Y. Photobiomodulation for Neurodegenerative Diseases: A Scoping Review. Int. J. Mol. Sci. 2024, 25, 1625. [Google Scholar] [CrossRef]
- Giacci, M.K.; Wheeler, L.; Lovett, S.; Dishington, E.; Majda, B.; Bartlett, C.A.; Thornton, E.; Harford-Wright, E.; Leonard, A.; Vink, R.; et al. Differential effects of 670 and 830 nm red near infrared irradiation therapy: A comparative study of optic nerve injury, retinal degeneration, traumatic brain and spinal cord injury. PLoS ONE 2014, 9, e104565. [Google Scholar] [CrossRef] [PubMed]
- Detaboada, L.; Ilic, S.; Leichliter-Martha, S.; Oron, U.; Oron, A.; Streeter, J. Transcranial application of low-energy laser irradiation improves neurological deficits in rats following acute stroke. Lasers Surg. Med. 2006, 38, 70–73. [Google Scholar] [CrossRef] [PubMed]
- Stone, J.; Mitrofanis, J.; Johnstone, D.M.; Falsini, B.; Bisti, S.; Adam, P.; Nuevo, A.B.; George-Weinstein, M.; Mason, R.; Eells, J. Acquired Resilience: An Evolved System of Tissue Protection in Mammals. Dose-Response 2018, 16, 1559325818803428. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequences | Product Length (bp) | Annealing Temp (°C) | Gene Accession Number |
---|---|---|---|---|
Tnfa | ACCTTATCTACTCCCAGGTTCT/GGCTGACTTTCTCCTGGTATG | 162 | 60 | NM_012675.3 |
IL1B | TGCTGTCTGACCCATGTGAG/GTCGTTGCTTGTCTCTCCTTG | 147 | 60 | NM_031512.2 |
IL6 | GCCCTTCAGGAACAGCTATGA/TGTCAACAACATCAGTCCCAAGA | 153 | 60 | NM_012589.2 |
CD206 | TCOGTTTGCATTGCCCAGTA/AGAGTCTGTGCCCAAATCAAC | 152 | 60 | NM_001037168.1 |
Casp8 | BGAGEEAGICECAAATCAAL/GCTGCTTCTCTCTTTGCTGAA | 144 | 60 | NM_022277.2 |
Casp9 | AGCTGGCCCAGTGTGAATAC/GCTCCCACCTCAGTCAACTC | 123 | 60 | NM_001106130.1 |
p53 | CACGAGCGCTGCTCAGATAGC/ACAGGCACAAACACGCACAAA | 153 | 60 | NM_030989.3 |
GAPDH | GATTTGGCCGTATCGGAC/GAAGACGCCAGTAGACTC | 87 | 60 | NM_017008.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, T.-W.; Wen, Y.-T.; Liu, P.-K.; Hossen, M.; Tsai, R.-K. Roles of 670 nm Photobiomodulation on Rat Anterior Ischemic Optic Neuropathy: Enhancing RGC Survival, Mitochondrial Function, and Anti-Inflammatory Response. Antioxidants 2025, 14, 886. https://doi.org/10.3390/antiox14070886
Chen T-W, Wen Y-T, Liu P-K, Hossen M, Tsai R-K. Roles of 670 nm Photobiomodulation on Rat Anterior Ischemic Optic Neuropathy: Enhancing RGC Survival, Mitochondrial Function, and Anti-Inflammatory Response. Antioxidants. 2025; 14(7):886. https://doi.org/10.3390/antiox14070886
Chicago/Turabian StyleChen, Tu-Wen, Yao-Tseng Wen, Pei-Kang Liu, Monir Hossen, and Rong-Kung Tsai. 2025. "Roles of 670 nm Photobiomodulation on Rat Anterior Ischemic Optic Neuropathy: Enhancing RGC Survival, Mitochondrial Function, and Anti-Inflammatory Response" Antioxidants 14, no. 7: 886. https://doi.org/10.3390/antiox14070886
APA StyleChen, T.-W., Wen, Y.-T., Liu, P.-K., Hossen, M., & Tsai, R.-K. (2025). Roles of 670 nm Photobiomodulation on Rat Anterior Ischemic Optic Neuropathy: Enhancing RGC Survival, Mitochondrial Function, and Anti-Inflammatory Response. Antioxidants, 14(7), 886. https://doi.org/10.3390/antiox14070886