The Selenoprotein MsrB1 Instructs Dendritic Cells to Induce T-Helper 1 Immune Responses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. Generating Splenocyte Preparations
2.3. Generating Bone Marrow-Derived Dendritic Cell Cultures
2.4. In Vitro Stimulation of OT-II Cells with OVA-Pulsed BMDCs
2.5. Western Blot
2.6. RNA Extraction and Quantitative Real-Time PCR (qPCR)
2.7. Flow Cytometry
2.8. LPS Challenge, Adoptive Transfer, and Sheep Red Blood Cell Immunization
2.9. Enzyme-Linked ImmunoSorbent Assay (ELISA)
2.10. Statistical Analysis
3. Results
3.1. MsrB1 Promotes DC Maturation
3.2. MsrB1 in DCs Controls Antigen-Specific Proliferation of T-Cells In Vitro
3.3. MsrB1 Is Needed for STAT6 Activation in BMDCs
3.4. MsrB1 Potentiates IL-12 Production by BMDC In Vitro
3.5. MsrB1 Promotes the Production of IL-12 by Classical Splenic DCs on LPS Challenge In Vivo
3.6. MsrB1 in DCs Promotes DC-Induced Differentiation of Th1 Cells
3.7. MsrB1 Deficiency Associates with Defective Differentiation of Tfh Cells In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Celi, P.; Gabai, G. Oxidant/Antioxidant Balance in Animal Nutrition and Health: The Role of Protein Oxidation. Front. Vet. Sci. 2015, 2, 48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharov, V.S.; Ferrington, D.A.; Squier, T.C.; Schoneich, C. Diastereoselective reduction of protein-bound methionine sulfoxide by methionine sulfoxide reductase. FEBS Lett. 1999, 455, 247–250. [Google Scholar] [CrossRef] [Green Version]
- Brot, N.; Weissbach, L.; Werth, J.; Weissbach, H. Enzymatic reduction of protein-bound methionine sulfoxide. Proc. Natl. Acad. Sci. USA 1981, 78, 2155–2158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hatfield, D.L.; Gladyshev, V.N. How selenium has altered our understanding of the genetic code. Mol. Cell Biol. 2002, 22, 3565–3576. [Google Scholar] [CrossRef] [Green Version]
- Lee, B.C.; Dikiy, A.; Kim, H.Y.; Gladyshev, V.N. Functions and evolution of selenoprotein methionine sulfoxide reductases. Biochim. Biophys. Acta 2009, 1790, 1471–1477. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.Y.; Gladyshev, V.N. Methionine sulfoxide reductases: Selenoprotein forms and roles in antioxidant protein repair in mammals. Biochem. J. 2007, 407, 321–329. [Google Scholar] [CrossRef] [Green Version]
- Jiang, B.; Moskovitz, J. The Functions of the Mammalian Methionine Sulfoxide Reductase System and Related Diseases. Antioxidants 2018, 7, 122. [Google Scholar] [CrossRef] [Green Version]
- Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Buck, M.D.; O’Sullivan, D.; Pearce, E.L. T cell metabolism drives immunity. J. Exp. Med. 2015, 212, 1345–1360. [Google Scholar] [CrossRef] [Green Version]
- Jackson, S.H.; Devadas, S.; Kwon, J.; Pinto, L.A.; Williams, M.S. T cells express a phagocyte-type NADPH oxidase that is activated after T cell receptor stimulation. Nat. Immunol. 2004, 5, 818–827. [Google Scholar] [CrossRef]
- Sena, L.A.; Li, S.; Jairaman, A.; Prakriya, M.; Ezponda, T.; Hildeman, D.A.; Wang, C.R.; Schumacker, P.T.; Licht, J.D.; Perlman, H.; et al. Mitochondria are required for antigen-specific T cell activation through reactive oxygen species signaling. Immunity 2013, 38, 225–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- West, A.P.; Brodsky, I.E.; Rahner, C.; Woo, D.K.; Erdjument-Bromage, H.; Tempst, P.; Walsh, M.C.; Choi, Y.; Shadel, G.S.; Ghosh, S. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature 2011, 472, 476–480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsue, H.; Edelbaum, D.; Shalhevet, D.; Mizumoto, N.; Yang, C.; Mummert, M.E.; Oeda, J.; Masayasu, H.; Takashima, A. Generation and function of reactive oxygen species in dendritic cells during antigen presentation. J. Immunol. 2003, 171, 3010–3018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mantegazza, A.R.; Savina, A.; Vermeulen, M.; Perez, L.; Geffner, J.; Hermine, O.; Rosenzweig, S.D.; Faure, F.; Amigorena, S. NADPH oxidase controls phagosomal pH and antigen cross-presentation in human dendritic cells. Blood 2008, 112, 4712–4722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lewis, C.J.; Cobb, B.A. Carbohydrate oxidation acidifies endosomes, regulating antigen processing and TLR9 signaling. J. Immunol. 2010, 184, 3789–3800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.C.; Peterfi, Z.; Hoffmann, F.W.; Moore, R.E.; Kaya, A.; Avanesov, A.; Tarrago, L.; Zhou, Y.; Weerapana, E.; Fomenko, D.E.; et al. MsrB1 and MICALs regulate actin assembly and macrophage function via reversible stereoselective methionine oxidation. Mol. Cell 2013, 51, 397–404. [Google Scholar] [CrossRef] [Green Version]
- Lee, B.C.; Lee, S.G.; Choo, M.K.; Kim, J.H.; Lee, H.M.; Kim, S.; Fomenko, D.E.; Kim, H.Y.; Park, J.M.; Gladyshev, V.N. Selenoprotein MsrB1 promotes anti-inflammatory cytokine gene expression in macrophages and controls immune response in vivo. Sci. Rep. 2017, 7, 5119. [Google Scholar] [CrossRef]
- Fomenko, D.E.; Novoselov, S.V.; Natarajan, S.K.; Lee, B.C.; Koc, A.; Carlson, B.A.; Lee, T.H.; Kim, H.Y.; Hatfield, D.L.; Gladyshev, V.N. MsrB1 (methionine-R-sulfoxide reductase 1) knock-out mice: Roles of MsrB1 in redox regulation and identification of a novel selenoprotein form. J. Biol. Chem. 2009, 284, 5986–5993. [Google Scholar] [CrossRef] [Green Version]
- Murphy, K.M.; Heimberger, A.B.; Loh, D.Y. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 1990, 250, 1720–1723. [Google Scholar] [CrossRef]
- Hogquist, K.A.; Jameson, S.C.; Heath, W.R.; Howard, J.L.; Bevan, M.J.; Carbone, F.R. T cell receptor antagonist peptides induce positive selection. Cell 1994, 76, 17–27. [Google Scholar] [CrossRef]
- Krutzik, P.O.; Nolan, G.P. Intracellular phospho-protein staining techniques for flow cytometry: Monitoring single cell signaling events. Cytom. A 2003, 55, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, H.; Wilson, C.A.; Lee, S.J.; Zhao, X.; Benveniste, E.N. LPS induces CD40 gene expression through the activation of NF-kappaB and STAT-1alpha in macrophages and microglia. Blood 2005, 106, 3114–3122. [Google Scholar] [CrossRef] [Green Version]
- Lu, L.; McCaslin, D.; Starzl, T.E.; Thomson, A.W. Bone marrow-derived dendritic cell progenitors (NLDC 145+, MHC class II+, B7-1dim, B7-2-) induce alloantigen-specific hyporesponsiveness in murine T lymphocytes. Transplantation 1995, 60, 1539–1545. [Google Scholar] [CrossRef] [Green Version]
- Vento-Tormo, R.; Company, C.; Rodriguez-Ubreva, J.; de la Rica, L.; Urquiza, J.M.; Javierre, B.M.; Sabarinathan, R.; Luque, A.; Esteller, M.; Aran, J.M.; et al. IL-4 orchestrates STAT6-mediated DNA demethylation leading to dendritic cell differentiation. Genome Biol. 2016, 17, 4. [Google Scholar] [CrossRef] [Green Version]
- Welte, T.; Koch, F.; Schuler, G.; Lechner, J.; Doppler, W.; Heufler, C. Granulocyte-macrophage colony-stimulating factor induces a unique set of STAT factors in murine dendritic cells. Eur. J. Immunol. 1997, 27, 2737–2740. [Google Scholar] [CrossRef] [PubMed]
- Lutz, M.B.; Schnare, M.; Menges, M.; Rossner, S.; Rollinghoff, M.; Schuler, G.; Gessner, A. Differential functions of IL-4 receptor types I and II for dendritic cell maturation and IL-12 production and their dependency on GM-CSF. J. Immunol. 2002, 169, 3574–3580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacobson, N.G.; Szabo, S.J.; Weber-Nordt, R.M.; Zhong, Z.; Schreiber, R.D.; Darnell, J.E., Jr.; Murphy, K.M. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 1995, 181, 1755–1762. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, N.; Morita, R.; Bourdery, L.; Bentebibel, S.E.; Zurawski, S.M.; Banchereau, J.; Ueno, H. Human dendritic cells induce the differentiation of interleukin-21-producing T follicular helper-like cells through interleukin-12. Immunity 2009, 31, 158–169. [Google Scholar] [CrossRef] [Green Version]
- Nakayamada, S.; Kanno, Y.; Takahashi, H.; Jankovic, D.; Lu, K.T.; Johnson, T.A.; Sun, H.W.; Vahedi, G.; Hakim, O.; Handon, R.; et al. Early Th1 cell differentiation is marked by a Tfh cell-like transition. Immunity 2011, 35, 919–931. [Google Scholar] [CrossRef] [Green Version]
- Yu, D.; Rao, S.; Tsai, L.M.; Lee, S.K.; He, Y.; Sutcliffe, E.L.; Srivastava, M.; Linterman, M.; Zheng, L.; Simpson, N.; et al. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity 2009, 31, 457–468. [Google Scholar] [CrossRef] [PubMed]
- Crotty, S. T follicular helper cell differentiation, function, and roles in disease. Immunity 2014, 41, 529–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaya, A.; Lee, B.C.; Gladyshev, V.N. Regulation of protein function by reversible methionine oxidation and the role of selenoprotein MsrB1. Antioxid Redox Signal. 2015, 23, 814–822. [Google Scholar] [CrossRef] [Green Version]
- Fang, F.C. Antimicrobial actions of reactive oxygen species. mBio 2011, 2, e00141-11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corzo, C.A.; Cotter, M.J.; Cheng, P.; Cheng, F.; Kusmartsev, S.; Sotomayor, E.; Padhya, T.; McCaffrey, T.V.; McCaffrey, J.C.; Gabrilovich, D.I. Mechanism regulating reactive oxygen species in tumor-induced myeloid-derived suppressor cells. J. Immunol. 2009, 182, 5693–5701. [Google Scholar] [CrossRef] [PubMed]
- Ohl, K.; Tenbrock, K. Reactive Oxygen Species as Regulators of MDSC-Mediated Immune Suppression. Front. Immunol. 2018, 9, 2499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zeng, H. Selenium as an essential micronutrient: Roles in cell cycle and apoptosis. Molecules 2009, 14, 1263. [Google Scholar] [CrossRef] [Green Version]
- Zeng, H.; Combs, G.F., Jr. Selenium as an anticancer nutrient: Roles in cell proliferation and tumor cell invasion. J. Nutr. Biochem. 2008, 19, 1–7. [Google Scholar] [CrossRef]
- Hoffmann, P.R.; Berry, M.J. The influence of selenium on immune responses. Mol. Nutr. Food Res. 2008, 52, 1273–1280. [Google Scholar] [CrossRef]
- Suzuki, K.; Nakajima, H.; Kagami, S.; Suto, A.; Ikeda, K.; Hirose, K.; Hiwasa, T.; Takeda, K.; Saito, Y.; Akira, S.; et al. Proteolytic processing of Stat6 signaling in mast cells as a negative regulatory mechanism. J. Exp. Med. 2002, 196, 27–38. [Google Scholar] [CrossRef] [Green Version]
- Sherman, M.A.; Powell, D.R.; Brown, M.A. IL-4 induces the proteolytic processing of mast cell STAT6. J. Immunol. 2002, 169, 3811–3818. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Sun, X.; Zhou, H.; Zhu, Z.; Zhao, W.; Zhu, C. Interleukin-4 affects the mature phenotype and function of rat bone marrow-derived dendritic cells. Mol. Med. Rep. 2015, 12, 233–237. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Li, W.; Kaplan, M.H.; Chang, C.H. Interleukin (IL)-4 inhibits IL-10 to promote IL-12 production by dendritic cells. J. Exp. Med. 2005, 201, 1899–1903. [Google Scholar] [CrossRef] [Green Version]
- Shrimali, R.K.; Irons, R.D.; Carlson, B.A.; Sano, Y.; Gladyshev, V.N.; Park, J.M.; Hatfield, D.L. Selenoproteins mediate T cell immunity through an antioxidant mechanism. J. Biol. Chem. 2008, 283, 20181–20185. [Google Scholar] [CrossRef] [Green Version]
- Hamilton, J.A. GM-CSF-Dependent Inflammatory Pathways. Front. Immunol. 2019, 10, 2055. [Google Scholar] [CrossRef] [Green Version]
Gene | Accession Number | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|---|
TNF | NM_013693 | ACAGAAAGCATGATCCGCG | GCCCCCCATCTTTTGGG |
IL-1b | NM_008361.4 | GTGGCTGTGGAGAAGCTGTG | GAAGGTCCACGGGAAAGACAC |
IL-6 | NM_031168.2 | CCAGAAACCGCTATGAAGTTCC | TTGTCACCAGCATCAGTCCC |
IL-10 | NM_010548 | ACACCTTGGTCTTGGAGCTT | AGAGAAGCATGGCCCAGAAA |
IL-12a | NM_008351.3 | CAGAAACCTCCTGTGGGAGA | GGAGCTCAGATAGCCCATCA |
IL-12b | NM_001303244.1 | ATCCAGCGCAAGAAAGAAAA | GGAACGCACCTTTCTGGTTA |
Il-23a | NM_031252.2 | CCTCTCCGTTCCAAGATCCT | ACTAAGGGCTCAGTCAGAGTTGCT |
Ppia | NM_008907.1 | ATGGTCAACCCCACCGTGT | TTCTTGCTGTCTTTGGAACTTTGTC |
Antigen | Conjugate | Clone | Company | Catalog |
---|---|---|---|---|
CD3 | PE/Cy7 | 145-2C11 | BioLegend | 100320 |
CD4 | Brilliant violet605 | GK1.5 | BioLegend | 100451 |
CD4 | FITC | GK1.5 | BioLegend | 100406 |
CD8a | PE/Cy7 | 53-6.7 | BioLegend | 100714 |
CD11b | APC | M1/70 | BioLegend | 101212 |
CD11c | PE/Cy7 | N418 | BioLegend | 117318 |
CD11c | Alexa700 | N418 | BioLegend | 117319 |
CD25 | PE/Cy7 | PC61 | BioLegend | 102016 |
CD40 | APC | 3/23 | BioLegend | 124612 |
CD44 | APC | IM7 | BioLegend | 103012 |
CD80 | Pacific blue | 16-10A1 | BioLegend | 104724 |
CD80 | Brilliant violet421 | 16-10A1 | BioLegend | 104726 |
CD86 | PE | GL-1 | BioLegend | 105008 |
I-A/I-E | FITC | M5/114.15.2 | BioLegend | 107605 |
TCRβ | PE | H57-597 | BioLegend | 109208 |
TCRVα2 | PE | B20.1 | BioLegend | 127808 |
CXCR5 | PE | L138D7 | BioLegend | 145504 |
PD-1 | APC | J43 | eBioscience | 17998582 |
PD-L1 | PE | 10F.9G2 | BioLegend | 124308 |
IL-12p40/70 | APC | C15.6 | BD Pharmingen | 554480 |
IFN-γ | PE/Cy7 | XMG1.2 | BioLegend | 505826 |
IL-23 p19 | eFluor 660 | fc23cpg | eBioscience | 50-7023-82 |
Rabbit IgG | Alexa647 | Invitrogen | A32733 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, H.-J.; Park, J.S.; Yoo, H.J.; Lee, H.M.; Lee, B.C.; Kim, J.H. The Selenoprotein MsrB1 Instructs Dendritic Cells to Induce T-Helper 1 Immune Responses. Antioxidants 2020, 9, 1021. https://doi.org/10.3390/antiox9101021
Lee H-J, Park JS, Yoo HJ, Lee HM, Lee BC, Kim JH. The Selenoprotein MsrB1 Instructs Dendritic Cells to Induce T-Helper 1 Immune Responses. Antioxidants. 2020; 9(10):1021. https://doi.org/10.3390/antiox9101021
Chicago/Turabian StyleLee, Ho-Jae, Joon Seok Park, Hyun Jung Yoo, Hae Min Lee, Byung Cheon Lee, and Ji Hyung Kim. 2020. "The Selenoprotein MsrB1 Instructs Dendritic Cells to Induce T-Helper 1 Immune Responses" Antioxidants 9, no. 10: 1021. https://doi.org/10.3390/antiox9101021