A Delta–Omicron Bivalent Subunit Vaccine Elicited Antibody Responses in Mice against Both Ancestral and Variant Strains of SARS-CoV-2

Round 1

Reviewer 1 Report

The manuscript entitled "A Delta-Omicron bivalent subunit vaccine elicited antibody responses against both ancestral and variant strains of SARS-CoV-2" reports findings on the development of a recombinant protein vaccine composed of RBD proteins of SARS-CoV-2 delta and omicron variants. The immune responses were evaluated in mice, and the neutralization capacity of the collected sera was tested. The manuscript needs some amendments:

- The title should contain the word "mice" to indicate that the in vivo experiments were performed in mice.

- Line 89: BA.2 should be added in "The SARS-CoV-2 Delta, BA.1, RBD genes..."

- In Part 2.5, the amount of adjuvants in the vaccine formulations should be specified. The volume of the injections should be given. Also, the nucleotide sequence of the CpG adjuvant should be given. 

- Why were the blood samples not collected before the first immunizations?

- Lines 198-201: The comment on IgG1 and IgG2a should be revised because all formulations provided these responses. Also, there is no experiment showing the Th1-biased immune response was provided by CpG adjuvant.

- "3.5. Figures". The figures should not be a title.

- Antibody titres should be g/L?

- The Discussion part is weak. The results should be discussed with the previous literature.

- Line 82: "was previously" should be used instead of "has ever".

- "P. pastoris" should not be written italic in Line 177 but it should be italic in Line 180.

Author Response

The main textual changes made to the manuscript based on answering these comments are colored red in the manuscript.

Point-by-point responses to the comments raised by the reviewers are detailed below.

1.The title should contain the word "mice" to indicate that the in vivo experiments were performed in mice.

Response:

Thank you for your comment. The title was modified to " A Delta-Omicron bivalent subunit vaccine elicited antibody responses in mice against both ancestral and variant strains of SARS-CoV-2 ".

2.Line 89: BA.2 should be added in "The SARS-CoV-2 Delta, BA.1, RBD genes..."

Thank you for your comment. This sentence was modified to " The SARS-CoV-2 Delta, BA.1, BA.2 RBD genes were prepared and then integrated into the pPICZαA vector at the XhoI/NotI sites, resulting in the creation of the expression plasmids pPICZαA-Delta, pPICZαA-BA.1 and pPICZαA-BA.2 RBD" in line 88.

3.In Part 2.5, the amount of adjuvants in the vaccine formulations should be specified. The volume of the injections should be given. Also, the nucleotide sequence of the CpG adjuvant should be given.

Thank you for your comment. The relevant data you proposed has been added to Part 2.5. The sentence was modified to “The recombinant RBD protein vaccines were each administered intramuscularly with two adjuvants—100 µg of Al(OH)₃ (CRODA, Denmark) and 50 µg of CpG2006 (TGCTCGTTTTGTGCTTTTGTGCTT)—for immunization. Mice were immunized with 100 μL in their hind leg muscles on days 0 and 14” in Part 2.5.

4.Why were the blood samples not collected before the first immunizations?

We collected the blood of pre-immunized mice as blank controls in the ELISA test for antibody titer determination, and set up three repeat holes, but it was not mentioned in the article that the negative control was the 8-group adjuvant group. The following sentence has been added：“Blood samples were collected of pre-immunized mice as blank controls in the ELISA test for antibody titer determination, and set up three repeat holes” in line 125.

5.Lines 198-201: The comment on IgG1 and IgG2a should be revised because all formulations provided these responses. Also, there is no experiment showing the Th1-biased immune response was provided by CpG adjuvant.

The following text has been added：“In our previous study, we found that antibody typing of mice sera showed that the RBD-WT and RBD-Beta bivalent vaccine elicited robust IgG1, IgG2a, IgG2b, and IgG3 responses, and spleen cells from mice 10 days after the second immunization were removed and assayed for IFN-γ and IL-2 secreted by Th1 cells and for IL-4 secreted by Th2 cells using ELISpot. IFN-γ and IL-2 were higher, and IL-4 were lower in the adjuvant CpG group than in the non-CpG group, suggesting that the vaccine may have induced cytokine levels more in favor of the Th1 response” in line 209.

6. "3.5. Figures". The figures should not be a title.

Thank you for your comment. The title "3.5. Figures" was deleted.

7. Antibody titres should be g/L?

The antibody titer was the log value of corresponding serum dilution which 2.1 times higher than absorbance detected on a 450nm microplate reader of the blank control serum wells. Lg is short for Log.

8.The Discussion part is weak. The results should be discussed with the previous literature.

Thank you for your comment. The following text has been added：“BALB/c mice typically respond to subunit vaccines with a Th2-type immune response, which is associated with the stimulation of IgG1 antibodies，inducing cellular immune response. However, the major antibody isotype present in the sera of mice that survive viral infections is IgG2a, which is stimulated during Th1-type immune responses, inducing humoral immune response. Antibody typing of specific antibodies in mouse serum showed that the RBD bivalent vaccine could induce robust both IgG1 and IgG2a antibodies The specific IgG1 and IgG2a antibody titers induced by Delta-Omicron bivalent subunit vaccine were over 106 This indicates that both humoral and cellular immunity are induced. Antibody responses against the SARS-CoV-2 pseudo virus and authentic variants were compared. The Delta pseudo virus neutralizing antibody titer induced in the high-dose Delta/BA.2 RBD group was 68.7-fold obviously higher compared the BA.2 group (P < 0.01), and the corresponding groups antibody titer of authentic Delta virus was 14.2-fold. The neutralizing antibody titer of the authentic viruses were generally lower than the pseudo viruses variants, therefore the difference of neutralizing antibody against authentic viruses were smaller than that of the pseudo virus. The BA.1 pseudo virus neutralizing antibody titer induced in the high-dose Delta/BA.2 RBD group was 8.1-fold obviously higher compared the Delta group (P < 0.01), and the corresponding groups antibody titer of authentic BA.1 virus was no significant difference. The BA.2 and BA2.12.2 pseudo virus neutralizing antibody titer induced in the high-dose Delta/BA.2 RBD group was no significant difference compared the Delta group, and the trend of the difference in antibody titers between the authentic viruses was consistent” in line 316.

 

Comments on the Quality of English Language

- Line 82: "was previously" should be used instead of "has ever".

Thank you for your comment. This sentence was modified to " The approach used for constructing glycoengineered P. pastoris was previously reported " in line 79.

- "P. pastoris" should not be written italic in Line 177 but it should be italic in Line 180.

Thank you for your comment. The font of "P. pastoris" has been corrected in line 186 and line.189.

 

Reviewer 2 Report

This is an interesting study demonstrating that the Delta/BA.2 vaccine combined with adjuvants of Al(OH)3 and CpG exhibited a broad response against SARS-CoV-2 variants Delta, Beta, and Omicron sublineages BA.1, BA.2, BA.5. The introduction, methods, and results sections are well described; however, discussion section needs in-depth description.

 

1) Brief discussion on the response of anti-RBD IgG classes 1 and 2 (Figures 2c and 2d) is appreciated. They showed identical responses.

2) Another point of discussion would be the differences in the responses between SARS-CoV-2 pseudoviruses variants (Figure 3a−f) and authentic viruses (Figure 4a−f).

 

3) What are the advantages and disadvantages/limitations of glycoengineered yeast production for mass delivery of vaccines?

 

Author Response

The main textual changes made to the manuscript based on answering these comments are colored red in the manuscript.

Point-by-point responses to the comments raised by the reviewers are detailed below.

1) Brief discussion on the response of anti-RBD IgG classes 1 and 2 (Figures 2c and 2d) is appreciated. They showed identical responses.

Thank you for your comment. The following text has been added：“BALB/c mice typically respond to subunit vaccines with a Th2-type immune response, which is associated with the stimulation of IgG1 antibodies，inducing cellular immune response. However, the major antibody isotype present in the sera of mice that survive viral infections is IgG2a, which is stimulated during Th1-type immune responses, inducing humoral immune response.Antibody typing of specific antibodies in mouse serum showed that the RBD bivalent vaccine could induce robust both IgG1 and IgG2a antibodies The specific IgG1 and IgG2a antibody titers induced by Delta-Omicron bivalent subunit vaccine were over 106 This indicates that both humoral and cellular immunity are induced” in line 316.

2) Another point of discussion would be the differences in the responses between SARS-CoV-2 pseudoviruses variants (Figure 3a−f) and authentic viruses (Figure 4a−f).

Thank you for your comment. The following text has been added：“Antibody responses against the SARS-CoV-2 pseudovirus and authentic variants were compared. The Delta pseudovirus neutralizing antibody titer induced in the high-dose Delta/BA.2 RBD group was 68.7-fold obviously higher compared the BA.2 group (P < 0.01), and the corresponding groups antibody titer of authentic Delta viruse was 14.2-fold. The neutralizing antibody titer of the authentic viruses were generally lower than the pseudoviruses variants, therefore the difference of neutralizing antibody against authentic viruses were smaller than that of the pseudovirus. The BA.1 pseudovirus neutralizing antibody titer induced in the high-dose Delta/BA.2 RBD group was 8.1-fold obviously higher compared the Delta RBD group (P < 0.01), but the antibody titer of Delta/BA.2 RBD group and Delta RBD group against authentic BA.1 virus was no significant difference. The BA.2 and BA2.12.2 pseudovirus neutralizing antibody titers were no significant differences between Delta/BA.2 RBD group and Delta RBD, which consistent with authentic viruses.” in line 325.

3) What are the advantages and disadvantages/limitations of glycoengineered yeast production for mass delivery of vaccines?

Thank you for your comment. The following text has been added：“In this study, we used glycoengineered Pichia pastoris to express SARS-CoV-2 variants RBD. In previous study, the H7N9 influenza virus hemagglutinin (HA) subunit particle vaccine prepared by means of glycosylation-modified humanized yeast, which has mammalian N-glycosylation ability, has been shown to have good immunogenicity and protected mice from the H7N9 virus. The limitation of glycoengineered yeast production for mass vaccines was maybe Low expression of proteins with complex structures” in line 338.

Reviewer 3 Report

The authors developed bivalent vaccine and measured the antibody responses against wild-type SARS-CoV-2 strain, Delta, BA.1.1, BA.2.2, 28 BA2.3, and BA.2.12.1 viruses. It is encouraged to develop and evaluate vaccines against to variants of SARS-CoV-2. Improvement according to the comments is necessary.

1. Introduction: Please cite the references for the following sentence.

"Because previous research found that the serum of mice immunized with a Delta RBD vaccine had a certain broad-spectrum protective activity against wild-type (WT) SARS-CoV-2, Beta, BA.1 pseudoviruses"

 

2. Word spacing as well as minor editing of English language should be checked. 

line 87: "The RBD gene sequences of SARS CoV 2 variantswere obtained"

 

3. Line 93: 5'-AOX forward primers and 3'-AOX primers --> Please provide the sequence of primers.

4. Line 126: Provide the evidence for the study design of the immunization on days 0 and 14.

5. Were commercial and widely used kits for IgG and neutralization assays not available? Generalization for the effect (antibody response) is critical.

6. Is there any correlation between the neutralizing antibody and IgG antibody? Please discuss about the relation.

7. Discussion: Please discuss more about the widely used bivalent vaccines and their antibody responses compared to the vaccine developed in this study.

 

 

 

 

 

Word spacing as well as minor editing of English language should be checked. 

Author Response

The main textual changes made to the manuscript based on answering these comments are colored red in the manuscript.

Point-by-point responses to the comments raised by the reviewers are detailed below.

1. Introduction: Please cite the references for the following sentence.

"Because previous research found that the serum of mice immunized with a Delta RBD vaccine had a certain broad-spectrum protective activity against wild-type (WT) SARS-CoV-2, Beta, BA.1 pseudoviruses"

This is our previous research conclusion, and the figure S1 was added to prove it. The following text has been added：“The titers of neutralizing antibodies against wild-type (WT) SARS-CoV-2, Beta, BA.1 pseudoviruses of RBD-Delta group was higher than RBD-WT group” in line 219.

2. Word spacing as well as minor editing of English language should be checked.

line 87: "The RBD gene sequences of SARS CoV 2 variantswere obtained"

Thank you for your comment. This sentence was modified to "The RBD gene sequences of SARS-CoV-2 variants were obtained from the NCBI database with the GenBank accession numbers OM858819.1, OX315743.1, and OX315675.1, respectively. " in line 86.

3. Line 93: 5'-AOX forward primers and 3'-AOX primers --> Please provide the sequence of primers.

Thank you for your comment. The sequence of 5'-AOX is "GACTGGTTCCAATTGACAAGC", and the sequence of 3'-AOX is "GGCAAATGGCATTCTGACAT". This sentence was modified to "The AOX I promoter regulates these plasmids, and the proper insertion was verified through PCR and sequencing analysis using 5′-AOX forward primers (5′-GACTGGTTCC AATTGACAAGC-3′) and 3′-AOX (5′-GGCAAATGGCATTCTGACAT-3′) primers" in line 91.

4. Line 126: Provide the evidence for the study design of the immunization on days 0 and 14.

In our previous study, two immunizations of RBD-WT at days 0 and 14; at days 0 and 21; at days 0 and 28; and three immunizations at days 0, 14, and 28 were studies. The results indicate that the “0, 14 d,” “0, 21 d,” or “0, 14, 28 d” schedules could be potential immunization strategies. The following text has been added:"In our previous study, two immunizations of RBD-WT at days 0 and 14; at days 0 and 21; at days 0 and 28; and three immunizations at days 0, 14, and 28 were studies. The results indicate that the “0, 14 d,” “0, 21 d,” or “0, 14, 28 d” schedules could be potential immunization strategies[13]. Mice were immunized with 100 μL (intramuscular injection) in their hind leg muscles on days 0 and 14" in line 129.

5. Were commercial and widely used kits for IgG and neutralization assays not available? Generalization for the effect (antibody response) is critical.

Thank you for your comment. In our study, we opted to develop and employ custom assays for IgG and neutralization assessments. While we recognize the value of utilizing established commercial kits, our decision was driven by the need to tailor the assays to the specific objectives and characteristics of our research. We have taken precautions to validate our custom assays and have provided detailed methodologies to enhance the transparency of our approach. We appreciate your concern for generalizability and assure you that we have undertaken thorough validation steps to ensure the robustness of our findings.

6. Is there any correlation between the neutralizing antibody and IgG antibody? Please discuss about the relation.

Neutralizing antibodies can bind to the RBD region of SARS-CoV-2 and prevent it from binding to the ACE2 receptor on cells, thereby preventing SARS-CoV-2 infection. The IgG antibody produced in this study can specifically bind to the RBD protein after immunization with the RBD subunit vaccine, but may not be able to neutralize the virus. Some neutralizing antibodies in the IgG specific antibodies can neutralize the virus. High titers of IgG binding antibodies were produced in mice immunized with each subunit vaccine group, but the neutralizing antibody titers were still different. For example, after immunization with BA.2 RBD, the IgG binding antibody against the wild-type strain antigen was higher than 10⁵, but the neutralizing antibody of the wild-type authentic viruse was negative, indicating that the IgG antibody did not contain neutralizing antibodies.

7. Discussion: Please discuss more about the widely used bivalent vaccines and their antibody responses compared to the vaccine developed in this study.

Thank you for your comment. The following text has been added:"The enmergence of new SARS-CoV-2 variants driven by immune presure seriously threatens human health.Updating current vaccine can increase breadth of neutralization and protect against the new variants, such as boosting with moderna's bivalent mRNA-1273.214 or mRNA-1273.222 vaccines enhanced protection against BA.1 or BA.4/5 respectively.This study demonstrated RBD-based bivalent subunit vaccine also provide potent pretection against corresponding variants although full length spike-based vaccine prefered, and  Glyco-engineered yeast provide a new platform to upgrade current RBD-based subunit vaccine, which can be produced in one month and possessed excellent safty profile" in line 344.

 

Reviewer 4 Report

In this manuscript, Wang et al described the generation of a Delta-Omicron bivalent protein subunit vaccine and tested its effectiveness in mice. The authors showed that the immunization of this bivalent vaccine in mice successfully induced the production of SARS-CoV-2-specific IgG antibodies. In addition, they also demonstrate the broad-spectrum neutralizing activity presented by the delta-omicron bivalent vaccine using both live- and pseudo- virus neutralization assay. The concern is that this study only discussed the humoral response but not the cellular response to this vaccine. With some edits of the figures and writings, this manuscript can be considered to publish in Vaccines.

Key points to be addressed are listed below:

1. In line 47-49, the description about VOC and VOI is inaccurate. The authors also categorized some of the SARS-CoV-2 variants into VOC and VOI. However, according to the most recent CDC page, no SARS-CoV-2 variants are designated as VOI currently and only omicron is considered as VOC (https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-classifications.html). Please fix the statements and references related to VOI and VOC throughout this paper accordingly.

2. In Figure 2-4, please make sure that the y-axis in ALL individual graphs start from zero (or lowest value possible) to present the full expected range of the numbers. Truncating the y-axis can be misleading sometimes.

3. In Figure 4, please use the same color scheme to represent each vaccination regimen in a-b and c-f.

4. In Figure 2 and 3, authors tested both a high-dose and a low-dose vaccination schema. Can authors add statistical analysis between results of the 2 doses in all related graphs and discuss the results in the manuscript?

5. If possible, experiments to study the cellular immune responses against the bivalent vaccine is recommended due to the complexity of immune response against virus infection. For example, production of IL-2/IL-4/IFN-γ or T-cell responses. If not achievable at all, please explain and add this part into the discussion as a limitation of the study.

Author Response

The main textual changes made to the manuscript based on answering these comments are colored red in the manuscript.

Point-by-point responses to the comments raised by the reviewers are detailed below.

1. In line 47-49, the description about VOC and VOI is inaccurate. The authors also categorized some of the SARS-CoV-2 variants into VOC and VOI. However, according to the most recent CDC page, no SARS-CoV-2 variants are designated as VOI currently and only omicron is considered as VOC (https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-classifications.html). Please fix the statements and references related to VOI and VOC throughout this paper accordingly.

Thank you for your comment. This sentence was modified to " According to the CDC available for public (https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-classifications.html), SARS-CoV-2 variants are classified as either variants being monitored (VBM) or variant of concern (VOC). The SARS-CoV-2 variants from Alpha to Kappa have large numbers of mutation sites, are all VBMs[10]. Numerous Omicron subvariants, e.g., sublineages BA.1.1, BA.2.1, BA.5, have also emerged as VOC” in line 47.

2. In Figure 2-4, please make sure that the y-axis in ALL individual graphs start from zero (or lowest value possible) to present the full expected range of the numbers. Truncating the y-axis can be misleading sometimes.

Thank you for your comment. The y-axis in all individual graphs was modified to start from lowest value in figure 2-4.

3. In Figure 4, please use the same color scheme to represent each vaccination regimen in a-b and c-f.

Thank you for your comment. Each vaccination regimen was modified to the same color in figure 4.

4. In Figure 2 and 3, authors tested both a high-dose and a low-dose vaccination schema. Can authors add statistical analysis between results of the 2 doses in all related graphs and discuss the results in the manuscript?

The statistical analysis was added in figure 2 and 3. The following text has been added：“There were no significant differences between the low-dose and high-dose vaccination groups in either IgG antibody titers or neutralizing activity” in line 244.

5. If possible, experiments to study the cellular immune responses against the bivalent vaccine is recommended due to the complexity of immune response against virus infection. For example, production of IL-2/IL-4/IFN-γ or T-cell responses. If not achievable at all, please explain and add this part into the discussion as a limitation of the study.

Thank you for your comment. The following text has been added：“In our previous study, we found that antibody typing of mice sera showed that the RBD-WT and RBD-Beta bivalent vaccine elicited robust IgG1, IgG2a, IgG2b, and IgG3 responses, and spleen cells from mice 10 days after the second immunization were removed and assayed for IFN-γ and IL-2 secreted by Th1 cells and for IL-4 secreted by Th2 cells using ELISpot. IFN-γ and IL-2 were higher, and IL-4 were lower in the adjuvant CpG group than in the non-CpG group, suggesting that the vaccine may have induced cytokine levels more in favor of the Th1 response” in line 209.

Round 2

Reviewer 3 Report

Thank you for the correction according to the comments.

I hope that the developed vaccine would be effective for the prevention of SARS-CoV-2 infection. 

Some typographic errors should be checked (such as  "immune presure").