A Novel Strategy of US3 Codon De-Optimization for Construction of an Attenuated Pseudorabies Virus against High Virulent Chinese Pseudorabies Virus Variant
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.1.1. Virus and Cells
2.1.2. Plasmids and Strains
2.1.3. Main Reagents
2.1.4. Test Animals
2.2. Methods
2.2.1. Construction of Bacterial Artificial Chromosomes (BACs) with US3 Codon De-Optimization
2.2.2. Acquisition of Recombinant Viruses with US3 Codon De-Optimization
2.2.3. Detection of US3 Gene Expression from the Virus Background
2.2.4. Detection of US3 Protein Expression of Eukaryotic Plasmids with Codon De-Optimized US3
2.2.5. Cytopathic Effect
2.2.6. Plaque Assay
2.2.7. Virus Growth Kinetics
2.2.8. Genetic Stability Test
2.2.9. Pathogenicity and Immunological Experiments in Mice
2.2.10. Pathogenicity and Immunological Experiments in Piglets
2.3. Statistical Analysis
3. Results
3.1. Generation of Recombinant BAC with US3 Codon De-Optimization
3.2. Construction and Identification of Recombinant Viruses with US3 Codon De-Optimization
3.3. Growth Characteristics of Recombinant Viruses with US3 Codon De-Optimization
3.4. Safety and Immunogenicity in Mice
3.5. Safety and Immunogenicity in Piglets
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mettenleiter, T.C. Aujeszky’s disease (pseudorabies) virus: The virus and molecular pathogenesis—State of the art, June 1999. Vet. Res. 2000, 31, 99–115. [Google Scholar] [CrossRef]
- Zheng, H.; Fu, P.; Chen, H.; Wang, Z. Pseudorabies virus: From pathogenesis to prevention strategies. Viruses 2022, 14, 1638. [Google Scholar] [CrossRef]
- Gu, Z.; Hou, C.; Sun, H.; Yang, W.; Dong, J.; Bai, J.; Jiang, P. Emergence of highly virulent pseudorabies virus in southern China. Can. J. Vet. Res. 2015, 79, 221–228. [Google Scholar] [PubMed]
- Bo, Z.; Miao, Y.; Xi, R.; Gao, X.; Miao, D.; Chen, H.; Jung, Y.S.; Qian, Y.; Dai, J. Emergence of a novel pathogenic recombinant virus from Bartha vaccine and variant pseudorabies virus in China. Transbound Emerg. Dis. 2020, 68, 1454–1464. [Google Scholar] [CrossRef] [PubMed]
- Tan, L.; Yao, J.; Lei, L.; Xu, K.; Liao, F.; Yang, S.; Yang, L.; Shu, X.; Duan, D.; Wang, A. Emergence of a novel recombinant pseudorabies virus derived from the field virus and its attenuated vaccine in China. Front. Vet. Sci. 2022, 9, 872002. [Google Scholar] [CrossRef]
- Wang, J.; Song, Z.; Ge, A.; Guo, R.; Qiao, Y.; Xu, M.; Wang, Z.; Liu, Y.; Zheng, Y.; Fan, H.; et al. Safety and immunogenicity of an attenuated Chinese pseudorabies variant by dual deletion of TK&gE genes. BMC Vet. Res. 2018, 14, 287. [Google Scholar]
- Chen, F.; Wu, P.; Deng, S.; Zhang, H.; Hou, Y.; Hu, Z.; Zhang, J.; Chen, X.; Yang, J.R. Dissimilation of synonymous codon usage bias in virus-host coevolution due to translational selection. Nat. Ecol. Evol. 2020, 4, 589–600. [Google Scholar] [CrossRef] [PubMed]
- Groenke, N.; Trimpert, J.; Merz, S.; Conradie, A.M.; Wyler, E.; Zhang, H.W.; Hazapis, O.G.; Rausch, S.; Landthaler, M.; Osterrieder, N.; et al. Mechanism of virus attenuation by codon pair deoptimization. Cell Rep. 2020, 31, 107586. [Google Scholar] [CrossRef]
- Lorenzo, M.M.; Nogales, A.; Chiem, K.; Blasco, R.; Martinez-Sobrido, L. Vaccinia virus attenuation by codon deoptimization of the A24R gene for vaccine development. Microbiol. Spectr. 2022, 10, e0027222. [Google Scholar] [CrossRef]
- Vaz, P.K.; Armat, M.; Hartley, C.A.; Devlin, J.M. Codon pair bias deoptimization of essential genes in infectious laryngotracheitis virus reduces protein expression. J. Gen. Virol. 2023, 104, 1836. [Google Scholar] [CrossRef]
- Broadbent, A.J.; Santos, C.P.; Anafu, A.; Wimmer, E.; Mueller, S.; Subbarao, K. Evaluation of the attenuation, immunogenicity, and efficacy of a live virus vaccine generated by codon-pair bias de-optimization of the 2009 pandemic H1N1 influenza virus, in ferrets. Vaccine 2016, 34, 563–570. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Ye, C.; Cheng, B.; Nogales, A.; Iwasaki, M.; Yu, S.; Cooper, K.; Liu, D.X.; Hart, R.; Adams, R.; et al. A Lassa fever live-attenuated vaccine based on codon deoptimization of the viral glycoprotein gene. mBio 2020, 11, e00039-20. [Google Scholar] [CrossRef] [PubMed]
- Konopka-Anstadt, J.L.; Campagnoli, R.; Vincent, A.; Shaw, J.; Wei, L.; Wynn, N.T.; Smithee, S.E.; Bujaki, E.; Te Yeh, M.; Laassri, M.; et al. Development of a new oral poliovirus vaccine for the eradication end game using codon deoptimization. NPJ Vaccines 2020, 5, 26. [Google Scholar] [CrossRef] [PubMed]
- Mueller, S.; Stauft, C.B.; Kalkeri, R.; Koidei, F.; Kushnir, A.; Tasker, S.; Coleman, J.R.; Mueller, S.; Stauft, C.B.; Kalkeri, R.; et al. A codon-pair deoptimized live-attenuated vaccine against respiratory syncytial virus is immunogenic and efficacious in non-human primates. Vaccine 2020, 450, 132–139. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.W.; Yang, L.; Santos, C.; Hassan, S.A.; Collins, P.L.; Buchholz, U.J.; Le Nouen, C. Reversion mutations in phosphoprotein P of a codon-pair-deoptimized human respiratory syncytial virus confer increased transcription, immunogenicity, and genetic stability without loss of attenuation. PLoS Pathog. 2021, 17, e1010191. [Google Scholar] [CrossRef]
- Lee, M.H.P.; Tan, C.W.; Tee, H.K.; Ong, K.C.; Sam, I.C.; Chan, Y.F. Vaccine candidates generated by codon and codon pair deoptimization of enterovirus A71 protect against lethal challenge in mice. Vaccine 2021, 39, 1708–1720. [Google Scholar] [CrossRef]
- Jacob, T.; Van den Broeke, C.; Favoreel, H.W. Viral serine/threonine protein kinases. J. Virol. 2011, 85, 1158–1173. [Google Scholar] [CrossRef]
- Xu, M.; Zhang, C.; Liu, Y.; Chen, S.; Zheng, Y.; Wang, Z.; Cao, R.; Wang, J. A noval strategy of deletion in PK gene for construction of a vaccine candidate with exellent safety and complete protection efficiency against high virulent Chinese pseudorabies virus variant. Virus Res. 2022, 313, 198740. [Google Scholar] [CrossRef]
- An, T.; Peng, J.; Tian, Z.; Zhao, H.; Li, N.; Liu, Y.; Chen, J.; Leng, C.; Sun, Y.; Chang, D.; et al. Pseudorabies virus variant in Bartha-K61-vaccinated pigs, China, 2012. Emerg. Infect. Dis. 2013, 19, 1749–1755. [Google Scholar] [CrossRef]
- Sun, Y.; Zhao, L.; Fu, Z. Effective cross-protection of a lyophilized live gE/gI/TK-deleted pseudorabies virus (PRV) vaccine against classical and variant PRV challenges. Vet. Microbiol. 2022, 267, 109387. [Google Scholar] [CrossRef]
- Jiang, C.; Ma, Z.; Bai, J.; Sun, Y.; Cao, M.; Wang, X.; Jiang, P.; Liu, X. Comparison of the protective efficacy between the candidate vaccine ZJ01R carrying gE/gI/TK deletion and three commercial vaccines against an emerging pseudorabies virus variant. Vet. Microbiol. 2023, 276, 109623. [Google Scholar] [CrossRef]
- Cong, X.; Lei, J.; Xia, S.; Wang, Y.; Li, Y.; Li, S.; Luo, Y.; Sun, Y.; Qiu, H. Pathogenicity and immunogenicity of a gE/gI/TK gene-deleted pseudorabies virus variant in susceptible animals. Vet. Microbiol. 2016, 182, 170–177. [Google Scholar] [CrossRef]
- Li, L.; Du, Y.; Zhang, Y.; Li, P.; Liu, X.; Zhang, X.; Li, J.; Zhang, T.; Li, X.; Xiao, D.; et al. Comprehensive evaluation of the safety and immunogenicity of a gene-deleted variant pseudorabies virus attenuated vaccine. Vet. Res. 2022, 53, 73. [Google Scholar] [CrossRef]
- Sun, L.; Tang, Y.; Yan, K.; Zhang, H.; Sun, L.; Tang, Y.; Yan, K.; Zhang, H. Construction of a quadruple gene-deleted vaccine confers complete protective immunity against emerging PRV variant challenge in piglets. Virol. J. 2022, 19, 19. [Google Scholar] [CrossRef]
- Eschke, K.; Trimpert, J.; Osterrieder, N.; Kunec, D. Attenuation of a very virulent Marek’s disease herpesvirus (MDV) by codon pair bias deoptimization. PLoS Pathog. 2018, 14, e1006857. [Google Scholar] [CrossRef]
- Sehl, J.; Portner, S.; Klupp, B.G.; Granzow, H.; Franzke, K.; Teifke, J.P.; Mettenleiter, T.C. Roles of the Different isoforms of the pseudorabies virus protein kinase pUS3 in nuclear egress. J. Virol. 2020, 94, e02029-19. [Google Scholar] [CrossRef]
- Olsen, L.M.; Ch’ng, T.H.; Card, J.P.; Enquist, L.W. Role of pseudorabies virus Us3 protein kinase during neuronal infection. J. Virol. 2006, 80, 6387–6398. [Google Scholar] [CrossRef]
- Esteves, A.D.; Koyuncu, O.O.; Enquist, L.W. A pseudorabies virus serine/threonine kinase, US3, promotes retrograde transport in axons via Akt/mToRC1. J. Virol. 2022, 96, e0175221. [Google Scholar] [CrossRef]
- Granzow, H.; Klupp, B.G.; Mettenleiter, T.C. The pseudorabies virus US3 protein is a component of primary and of mature virions. J. Virol. 2004, 78, 1314–1323. [Google Scholar] [CrossRef]
- Van den Broeke, C.; Deruelle, M.; Nauwynck, H.J.; Coller, K.E.; Smith, G.A.; Van Doorsselaere, J.; Favoreel, H.W. The kinase activity of pseudorabies virus US3 is required for modulation of the actin cytoskeleton. Virology 2009, 385, 155–160. [Google Scholar] [CrossRef]
- Xie, J.; Zhang, X.; Chen, L.; Bi, Y.; Idris, A.; Xu, S.; Li, X.; Zhang, Y.; Feng, R. Pseudorabies virus US3 protein inhibits IFN-beta production by interacting with IRF3 to block its activation. Front. Microbiol. 2021, 12, 761282. [Google Scholar] [CrossRef]
- Bouma, A.; Zwart, R.J.; De Bruin, M.G.; De Jong, M.C.; Kimman, T.G.; Bianchi, A.T. Immunohistological characterization of the local cellular response directed against pseudorabies virus in pigs. Vet. Microbiol. 1997, 58, 145–154. [Google Scholar] [CrossRef]
- van Rooij, E.M.; de Bruin, M.G.; de Visser, Y.E.; Middel, W.G.; Boersma, W.J.; Bianchi, A.T. Vaccine-induced T cell-mediated immunity plays a critical role in early protection against pseudorabies virus (suid herpes virus type 1) infection in pigs. Vet. Immunol. Immunopathol. 2004, 99, 113–125. [Google Scholar] [CrossRef] [PubMed]






| Primers | Sequence (5′–3′) | Aim |
|---|---|---|
| PRV US3deop-1-Kan F | CCCATCGATGGCGATGGCGATAGCAGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-1-Kan |
| PRV US3deop-1-Kan R | CCCATCGATGATGATTTCATCATCGCTGGGTAATGCCAGTGTTACAACCA | |
| PRV US3deop-2-Kan F | TCCCCCGGGGCCCGGTGACGTGTCTGGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-2-Kan |
| PRV US3deop-2-Kan R | TCCCCCGGGCGAGCATCTGCTTCAGGGGGTAATGCCAGTGTTACAACCA | |
| PRV US3deop-3-Kan F | CCCATCGATCTCATCCGCGCCCTCAGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-3-Kan |
| PRV US3deop-3-Kan R | CCCATCGATCAGATGCATCTCCCCGTTGGGTAATGCCAGTGTTACAACCA | |
| US3deop-1-Kan ide F | CCGATGAAATCCTGTATTCG | Identification of US3deop-1-Kan |
| US3deop-1-Kan ide R | GCTCATAACACCCCTTGTAT | |
| US3deop-2-Kan ide F | GACGTGTCTGGTCCTGCCGCATTT | Identification of US3deop-2-Kan |
| US3deop-2-Kan ide R | AATCGCGGCCTCGAGCAAGA | |
| US3deop-3-Kan ide F | GGGGTGCATCCCGAAGAATTTC | Identification of US3deop-3-Kan |
| US3deop-3-Kan ide R | CGCGAGCCCATTTATACCCA | |
| PRV gI+gE’ F | GTCGTGGGCATCGTCATCAT | Amplification of gI and part of gE |
| PRV gI+gE’ R | TAGGAGATGGTACATCGCGG | |
| H1-US3deop-1-Kan-H2 F | CTTGCCGGGCTCAGCAGGGGGTTGTCGCGCGTCCACGCCCAGCGCTCGCACGCAGCAACA | Amplification of US3deop-1-Kan with homologous arms |
| H1-US3deop-1-Kan-H2 R | GTACAGATCGCACCGAAAGTGCGGCAGGACCAGGCACGTCACCGGGCCCCGGGCGAGCAT | |
| H1-US3deop-2-Kan-H2 F | CTGATGGAGGGCATGCTGCTGAAGCGCCTGGCCCACGATAACGTCATGAGCCTGAAGCAG | Amplification of US3deop-2-Kan with homologous arms |
| H1-US3deop-2-Kan-H2 R | GGGCGGGAACTCCTCGGGGTGCACCCCGCGGAGGGCGCGGATGAGGTCGATCAGGTGCAT | |
| H1-US3deop-3-Kan-H2 F | GAGACGCTGGCCTACCCCAAGACGATCACCGGCGGGGACGAGCCCGCGATCAACGGGGAG | Amplification of US3deop-3-Kan with homologous arms |
| H1-US3deop-3-Kan-H2 R | TTGTTGAGCTGTGGAGATGCGCAAAGGTGTGTGTGTCCTACCGCTCGGAGCCGGGCCGTT | |
| PRV US3 check F | AGCGCTCGCACGCAGCAACA | Identification of US3 |
| PRV US3 check R | CTTTGGAATGTGGACCGTAT | |
| PRV ΔTK check F | CGCACCCCGAG GTTGACTTCAA | Identification of partial deletion of TK gene |
| PRV ΔTK check R | TTGTACGCGCCGAAGAGGGTGT | |
| PRV gE site check F | TCTGGAGGGGCCCT CGCCGA | Identification of gE |
| PRV gE site check R | AGAGAGAGGACGGAGGCGTGTCATC | |
| PRV US3deop-1/2 mRNA F | ATGCACCTGATCGACCTCAT | Real time PCR for determination of US3deop-1/2 mRNA |
| PRV US3deop-1/2 mRNA R | TTGTAAATCAGGAAAGCCCC | |
| PRV US3deop-3 mRNA F | GACACGGTGGTGCTGAAGGT | Real time PCR for determination of US3deop-1/2 mRNA |
| PRV US3deop-3 mRNA R | TACAGATCGCACCGAAAGTG | |
| US3deop-1 inred F | ATCTCGAGCTCAAGCTTCGAATTCATGGCCGATGCCGGAATCCCC | Amplification of US3deop-1, US3deop-2, and US3deop-3 |
| US3deop-2/3 inred F | ATCTCGAGCTCAAGCTTCGAATTCATGGCCGACGCCGGAATCCC | |
| US3deop-1/2/3 inred R | GCGGTACCGTCGACTGCAGAATTCTACGGTCCACATTCCAAA | |
| pmKate2-US3 inred F | TTTAGTGAACCGTCAGATCC | Identification of US3deop-1/2/3 in pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3 |
| pmKate2-US3 inred R | ACGGGATCAAACGTCAACAT | |
| gB F | GCGGTCACCTTGTGGTTGTT | Real time PCR for determination of gB mRNA |
| gB R | AACGTCATCGTCACGACCGT |
| Virus Strain | Inoculation Dose (TCID50/mL) | Quantity | Clinical Symptoms | Lethality |
|---|---|---|---|---|
| PRVΔTK&gE-US3deop−1 | 107 | 8 | / | 0 |
| 106 | 8 | / | 0 | |
| 105 | 8 | / | 0 | |
| PRVΔTK&gE-US3deop−2 | 107 | 8 | / | 0 |
| 106 | 8 | / | 0 | |
| 105 | 8 | / | 0 | |
| PRVΔTK&gE-US3deop−3 | 107 | 8 | / | 0 |
| 106 | 8 | / | 0 | |
| 105 | 8 | / | 0 | |
| PRVΔTK&gEAH02 | 107 | 8 | / | 0 |
| 106 | 8 | / | 0 | |
| 105 | 8 | / | 0 | |
| Control group | / | 8 | / | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, M.; Wang, Y.; Liu, Y.; Chen, S.; Zhu, L.; Tong, L.; Zheng, Y.; Osterrieder, N.; Zhang, C.; Wang, J. A Novel Strategy of US3 Codon De-Optimization for Construction of an Attenuated Pseudorabies Virus against High Virulent Chinese Pseudorabies Virus Variant. Vaccines 2023, 11, 1288. https://doi.org/10.3390/vaccines11081288
Xu M, Wang Y, Liu Y, Chen S, Zhu L, Tong L, Zheng Y, Osterrieder N, Zhang C, Wang J. A Novel Strategy of US3 Codon De-Optimization for Construction of an Attenuated Pseudorabies Virus against High Virulent Chinese Pseudorabies Virus Variant. Vaccines. 2023; 11(8):1288. https://doi.org/10.3390/vaccines11081288
Chicago/Turabian StyleXu, Mengwei, Yiwei Wang, Yamei Liu, Saisai Chen, Laixu Zhu, Ling Tong, Yating Zheng, Nikolaus Osterrieder, Chuanjian Zhang, and Jichun Wang. 2023. "A Novel Strategy of US3 Codon De-Optimization for Construction of an Attenuated Pseudorabies Virus against High Virulent Chinese Pseudorabies Virus Variant" Vaccines 11, no. 8: 1288. https://doi.org/10.3390/vaccines11081288
APA StyleXu, M., Wang, Y., Liu, Y., Chen, S., Zhu, L., Tong, L., Zheng, Y., Osterrieder, N., Zhang, C., & Wang, J. (2023). A Novel Strategy of US3 Codon De-Optimization for Construction of an Attenuated Pseudorabies Virus against High Virulent Chinese Pseudorabies Virus Variant. Vaccines, 11(8), 1288. https://doi.org/10.3390/vaccines11081288
