Impact of Myeloid p38α/MAPK on Orthodontic Tooth Movement
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Experimental Animals
2.2. µCT Analysis
2.3. Histological Analysis
2.4. TRAP5b ELISA
2.5. RNA Isolation, Reverse Transcription and RT-qPCR Analysis
2.6. Data Analysis and Statistics
3. Results
3.1. Impact of Myeloid p38α/MAPK on Bone Parameters
3.2. Impact of Myeloid p38α/MAPK on the Expression of Inflammatory Genes
3.3. Impact of Myeloid p38α/MAPK and Orthodontic Treatment on Genes Involved in Bone Remodelling
3.4. Impact of Myeloid p38α/MAPKs and Orthodontic Treatment on Periodontal Bone Loss and Extent of the Orthodontic Tooth Movement
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Y.; Zhan, Q.; Bao, M.; Yi, J.; Li, Y. Biomechanical and biological responses of periodontium in orthodontic tooth movement: Up-date in a new decade. Int. J. Oral Sci. 2021, 13, 20. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, V.; Davidovitch, Z. On a path to unfolding the biological mechanisms of orthodontic tooth movement. J. Dent. Res. 2009, 88, 597–608. [Google Scholar] [CrossRef] [PubMed]
- Kanzaki, H.; Chiba, M.; Shimizu, Y.; Mitani, H. Periodontal ligament cells under mechanical stress induce osteoclastogenesis by receptor activator of nuclear factor kappaB ligand up-regulation via prostaglandin E2 synthesis. J. Bone Miner. Res. 2002, 17, 210–220. [Google Scholar] [CrossRef] [Green Version]
- Meikle, M.C. The tissue, cellular, and molecular regulation of orthodontic tooth movement: 100 years after Carl Sandstedt. Eur. J. Orthod. 2006, 28, 221–240. [Google Scholar] [CrossRef] [PubMed]
- Wolf, M.; Lossdörfer, S.; Marciniak, J.; Römer, P.; Kirschneck, C.; Craveiro, R.; Deschner, J.; Jäger, A. CD8+ T cells mediate the regenerative PTH effect in hPDL cells via Wnt10b signaling. Innate Immun. 2016, 22, 674–681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schröder, A.; Käppler, P.; Nazet, U.; Jantsch, J.; Proff, P.; Cieplik, F.; Deschner, J.; Kirschneck, C. Effects of Compressive and Tensile Strain on Macrophages during Simulated Orthodontic Tooth Movement. Mediat. Inflamm. 2020, 2020, 2814015. [Google Scholar] [CrossRef]
- He, D.; Kou, X.; Yang, R.; Liu, D.; Wang, X.; Luo, Q.; Song, Y.; Liu, F.; Yan, Y.; Gan, Y.; et al. M1-like Macrophage Polarization Promotes Orthodontic Tooth Movement. J. Dent. Res. 2015, 94, 1286–1294. [Google Scholar] [CrossRef]
- Schröder, A.; Leikam, A.; Käppler, P.; Neubert, P.; Jantsch, J.; Neuhofer, W.; Deschner, J.; Proff, P.; Kirschneck, C. Impact of salt and the osmoprotective transcription factor NFAT-5 on macrophages during mechanical strain. Immunol. Cell Biol. 2021, 99, 84–96. [Google Scholar] [CrossRef]
- Jiang, L.; Tang, Z. Expression and regulation of the ERK1/2 and p38 MAPK signaling pathways in periodontal tissue remodeling of orthodontic tooth movement. Mol. Med. Rep. 2018, 17, 1499–1506. [Google Scholar] [CrossRef] [Green Version]
- Gaestel, M. MAPK-Activated Protein Kinases (MKs): Novel Insights and Challenges. Front. Cell Dev. Biol. 2015, 3, 88. [Google Scholar] [CrossRef] [Green Version]
- Cuadrado, A.; Nebreda, A.R. Mechanisms and functions of p38 MAPK signalling. Biochem. J. 2010, 429, 403–417. [Google Scholar] [CrossRef] [Green Version]
- Cong, Q.; Jia, H.; Li, P.; Qiu, S.; Yeh, J.; Wang, Y.; Zhang, Z.-L.; Ao, J.; Li, B.; Liu, H. p38α MAPK regulates proliferation and differentiation of osteoclast progenitors and bone remodeling in an aging-dependent manner. Sci. Rep. 2017, 7, 45964. [Google Scholar] [CrossRef] [Green Version]
- Cong, Q.; Jia, H.; Biswas, S.; Li, P.; Qiu, S.; Deng, Q.; Guo, X.; Ma, G.; Ling Chau, J.F.; Wang, Y.; et al. p38α MAPK Regulates Lineage Commitment and OPG Synthesis of Bone Marrow Stromal Cells to Prevent Bone Loss under Physiological and Pathological Conditions. Stem Cell Rep. 2016, 6, 566–578. [Google Scholar] [CrossRef] [Green Version]
- Han, J.; Sun, P. The pathways to tumor suppression via route p38. Trends Biochem. Sci. 2007, 32, 364–371. [Google Scholar] [CrossRef]
- Li, L.; Han, M.; Li, S.; Wang, L.; Xu, Y. Cyclic tensile stress during physiological occlusal force enhances osteogenic differentiation of human periodontal ligament cells via ERK1/2-Elk1 MAPK pathway. DNA Cell Biol. 2013, 32, 488–497. [Google Scholar] [CrossRef] [Green Version]
- Tsutsumi, T.; Kajiya, H.; Fukawa, T.; Sasaki, M.; Nemoto, T.; Tsuzuki, T.; Takahashi, Y.; Fujii, S.; Maeda, H.; Okabe, K. The potential role of transient receptor potential type A1 as a mechanoreceptor in human periodontal ligament cells. Eur. J. Oral Sci. 2013, 121, 538–544. [Google Scholar] [CrossRef]
- Kirschneck, C.; Thuy, M.; Leikam, A.; Memmert, S.; Deschner, J.; Damanaki, A.; Spanier, G.; Proff, P.; Jantsch, J.; Schröder, A. Role and Regulation of Mechanotransductive HIF-1α Stabilisation in Periodontal Ligament Fibroblasts. Int. J. Mol. Sci. 2020, 21, 9530. [Google Scholar] [CrossRef]
- Waldo, C.M.; Rothblatt, J.M. Histologic response to tooth movement in the laboratory rat; procedure and preliminary observations. J. Dent. Res. 1954, 33, 481–486. [Google Scholar] [CrossRef]
- Kirschneck, C.; Bauer, M.; Gubernator, J.; Proff, P.; Schröder, A. Comparative assessment of mouse models for experimental orthodontic tooth movement. Sci. Rep. 2020, 10, 12154. [Google Scholar] [CrossRef]
- Kirschneck, C.; Proff, P.; Fanghaenel, J.; Behr, M.; Wahlmann, U.; Roemer, P. Differentiated analysis of orthodontic tooth movement in rats with an improved rat model and three-dimensional imaging. Ann. Anat. 2013, 195, 539–553. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Proff, P.; Römer, P. The molecular mechanism behind bone remodelling: A review. Clin. Oral Investig. 2009, 13, 355–362. [Google Scholar] [CrossRef]
- Schröder, A.; Gubernator, J.; Leikam, A.; Nazet, U.; Cieplik, F.; Jantsch, J.; Neubert, P.; Titze, J.; Proff, P.; Kirschneck, C. Dietary Salt Accelerates Orthodontic Tooth Movement by Increased Osteoclast Activity. Int. J. Mol. Sci. 2021, 22, 596. [Google Scholar] [CrossRef]
- Kirschneck, C.; Straßmair, N.; Cieplik, F.; Paddenberg, E.; Jantsch, J.; Proff, P.; Schröder, A. Myeloid HIF1α Is Involved in the Extent of Orthodontically Induced Tooth Movement. Biomedicines 2021, 9, 796. [Google Scholar] [CrossRef]
- Guan, Z.; Baier, L.D.; Morrison, A.R. p38 mitogen-activated protein kinase down-regulates nitric oxide and up-regulates prostaglandin E2 biosynthesis stimulated by interleukin-1beta. J. Biol. Chem. 1997, 272, 8083–8089. [Google Scholar] [CrossRef] [Green Version]
- Schröder, A. Expression kinetics of human periodontal ligament fibroblasts in the early phases of orthodontic tooth movement. J. Orofac. Orthop. 2018, 79, 337–351. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Udagawa, N.; Takahashi, N. Action of RANKL and OPG for osteoclastogenesis. Crit. Rev. Eukaryot. Gene Expr. 2009, 19, 61–72. [Google Scholar] [CrossRef]
- Zhao, Y.; Li, J.; Liu, Y.; Yu, K.-Q.; Zhang, J.; Chen, X.-G. Gu Ling Pian, a traditional Chinese medicine, regulates function and OPG/RANKL synthesis of osteoblasts via the p38 MAPK pathway. J. Pharm. Pharmacol. 2007, 59, 1167–1173. [Google Scholar] [CrossRef]
- Matsumoto, M.; Sudo, T.; Saito, T.; Osada, H.; Tsujimoto, M. Involvement of p38 mitogen-activated protein kinase signaling pathway in osteoclastogenesis mediated by receptor activator of NF-kappa B ligand (RANKL). J. Biol. Chem. 2000, 275, 31155–31161. [Google Scholar] [CrossRef] [Green Version]
Gene | Gene Name | 5′-Forward Primer-3′ | 5′-Reverse Primer-3′ |
---|---|---|---|
Acp5 | Acid Phosphatase 5, Tartrate-Resistant | ATACGGGGTCACTGCCTACC | TCGTTGATGTCGCACAGAGG |
Alpl | Alkaline Phosphatase | GGGTACAAGGCTAGATGGC | AGTTCAGTGCGGTTCCAGAC |
Eef1a1 | Eukaryotic Translation Elongation Factor 1 Alpha 1 | AAAACATGATTACAGGCACATCCC | GCCCGTTCTTGGAGATACCAG |
Il1b | Interleukin 1 beta | GTGTAATGAAAGACGGCACACC | ACCAGTTGGGGAACTCTGC |
Il6 | Interleukin 6 | ACAAAGCCAGAGTCCTTCAGAG | GAGCATTGGAAATTGGGGTAGG |
Opg | Osteoprotegerin | CCTTGCCCTGACCACTCTTAT | CACACACTCGGTTGTGGGT |
Ptgs2 | Prostaglandin-Endoperoxide Synthase 2 | TCCCTGAAGCCGTACACATC | TCCCCAAAGATAGCATCTGGAC |
Rankl | Receptor Activator of NF-κB Ligand | AAACGCAGATTTGCAGGACTC | CCCCACAATGTGTTGCAGTTC |
Tnf | Tumor Necrosis Factor | ACAAGCCTGTAGCCCACGTC | TTGTTGTCTTTGAGATCCATGCC |
Ywhaz | Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta | AATGCTTCGCAACCAGAAAGC | TGGTATGCTTGCTGTGACTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kirschneck, C.; Nusser, H.; Jantsch, J.; Proff, P.; Schröder, A. Impact of Myeloid p38α/MAPK on Orthodontic Tooth Movement. J. Clin. Med. 2022, 11, 1796. https://doi.org/10.3390/jcm11071796
Kirschneck C, Nusser H, Jantsch J, Proff P, Schröder A. Impact of Myeloid p38α/MAPK on Orthodontic Tooth Movement. Journal of Clinical Medicine. 2022; 11(7):1796. https://doi.org/10.3390/jcm11071796
Chicago/Turabian StyleKirschneck, Christian, Hendrik Nusser, Jonathan Jantsch, Peter Proff, and Agnes Schröder. 2022. "Impact of Myeloid p38α/MAPK on Orthodontic Tooth Movement" Journal of Clinical Medicine 11, no. 7: 1796. https://doi.org/10.3390/jcm11071796