Transcriptomic Profile of Genes Encoding Proteins Involved in Pathogenesis of Sjögren’s Syndrome Related Xerostomia—Molecular and Clinical Trial
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Groups
2.2. Labial Salivary Gland Specimens
2.3. RNA Extraction
2.4. Microarray Expression Analysis
2.5. Quantitative Real-Time PCR Validation
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Tickotsky, N.; Ofran, Y. Integrating genomic data from high-throughput studies with computational modeling reveals differences in the molecular basis of hyposalivation between type 1 and type 2 diabetes. Clin. Oral Investig. 2018, 22, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Błochowiak, K.; Olewicz-Gawlik, A.; Polańska, A.; Nowak-Gabryel, M.; Kocięcki, J.; Witmanowski, H.; Sokalski, J. Oral mucosal manifestations in primary and secondary Sjögren’s syndrome and dry mouth syndrome. Adv. Dermatol. Allergol. 2016, 33, 23–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teos, L.Y.; Zhang, Y.; Cotrim, A.P.; Swaim, W.; Won, J.H.; Ambrus, J.; Shen, L.; Bebris, L.; Grisius, M.; Jang, S.; et al. IP3R deficit underlies loss of salivary fluid secretion in Sjögren’s syndrome. Sci. Rep. 2015, 5, 13953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hjelmervik, T.O.R.; Petersen, K.; Jonassen, I.; Jonsson, R.; Bolstad, A.I. Gene expression profiling of minor salivary glands clearly distinguishes primary Sjögren’s syndrome patients from healthy control subjects. Arthritis Rheum. 2005, 52, 1534–1544. [Google Scholar] [CrossRef]
- Shah, N.R.; Noll, B.D.; Stevens, C.B.; Brennan, M.T.; Mougeot, F.B.; Mougeot, J.L. Biosemantics guided gene expression profiling of Sjögren’s syndrome: A comparative analysis with systemic lupus erythematosus and rheumatoid arthritis. Arthritis Res. Ther. 2017, 19, 192. [Google Scholar] [CrossRef] [Green Version]
- Bhattarai, K.R.; Junjappa, R.; Handigund, M.; Kim, H.R.; Chae, H.J. The imprint of salivary secretion in autoimmune disorders and related pathological conditions. Autoimmun. Rev. 2018, 17, 376–390. [Google Scholar] [CrossRef]
- Shiboski, C.H.; Shiboski, S.C.; Seror, R.; Criswell, L.A.; Labetoulle, M.; Lietman, T.M.; Rasmussen, A.; Scofield, H.; Vitali, C.; Bowman, S.J.; et al. International Sjögren’s Syndrome Criteria Working Group. Classification Criteria for Primary Sjögren’s Syndrome. A Consensus and Data-Driven Methodology Involving Three International Patient Cohorts. Ann. Rheum. Dis. 2017, 76, 9–16. [Google Scholar] [CrossRef]
- Shiboski, C.H.; Shiboski, S.C.; Seror, R.; Criswell, L.A.; Labetoulle, M.; Lietman, T.M.; Rasmussen, A.; Scofield, H.; Vitali, C.; Bowman, S.J.; et al. International Sjögren’s Syndrome Criteria Working Group. 2016 American College of Rheumatology/European League against Rheumatism Classification Criteria for primary Sjögren’s syndrome. Arthritis Rheumatol. 2017, 69, 35–45. [Google Scholar] [CrossRef]
- Hernández-Molina, G.; Avila-Casado, C.; Nuñez-Alvarez, C. Utility of the Americam-European Consensus Group and American College of Rheumatology Classification Criteria for Sjögren’s syndrome in patients with systemic autoimmune diseases in the clinical setting. Rheumatology 2015, 54, 441–448. [Google Scholar] [CrossRef] [Green Version]
- Franceschini, F.; Cavazzana, I.; Andreoli, L.; Tincani, A. The 2016 classification criteria for primary Sjogren’s syndrome: What’s new? BMC Med. 2017, 15, 69. [Google Scholar] [CrossRef] [Green Version]
- Chisholm, D.M.; Mason, D.K. Labial salivary gland biopsy in Sjögren’s disease. J. Clin. Pathol. 1968, 21, 656–660. [Google Scholar] [CrossRef] [PubMed]
- Kroese, F.; Haacke, E.; Bombardieri, M. The role of salivary gland histopathology in primary Sjögren’s syndrome: Promises and pitfalls. Clin. Exp. Rheumatol. 2018, 112, 222–233. [Google Scholar]
- Löfgren, C.D.; Wickström, C.; Sonesson, M.; Lagunas, P.T.; Christersson, C. A systematic review of methods to diagnose oral dryness and salivary gland function. BMC Oral Health 2012, 12, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, A.; Chin, H.T.; Hwang, Y.H.; Hsiao, C.H.; Chen, H.C. Severity of dry eye syndrome in related to anti-dsDNA autoantibody in systemic lupus erythrematosus patients without secondary Sjögren syndrome. Medicine 2016, 95, 4218. [Google Scholar] [CrossRef] [PubMed]
- Najafi, L.; Malek, M.; Valojerdi, A.E.; Khamsch, M.E.; Abhaei, H. Dry eye disease in type 2 diabetes mellitus; comparison of the tear osmolarity test with other common diagnostic test. A diagnostic accuracy study using STARD standard. J. Diabetes Metab. Disord. 2015, 14, 39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collela, G.; Canavale, R.; Vicidomini, A.; Intro, A. Salivary gland biopsy: A comprehensive review of techniques and related complications. Rheumatology 2010, 49, 2117–2121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Budna, J.; Bryja, A.; Celichowski, P.; Kahan, R.; Kranc, W.; Ciesiółka, S.; Rybska, M.; Borys, S.; Jeseta, M.; Bukowska, D.; et al. Genes of cellular components of morphogenesis in porcine oocytes before and after IVM. Reproduction 2017, 4, 535–545. [Google Scholar] [CrossRef]
- Jopek, K.; Celichowski, P.; Szyszka, M.; Tyczewska, M.; Milecka, P.; Malendowicz, L.K.; Rucinski, M. Transcriptome profile of rat adrenal evoked by gonadectomy and testosterone or estradiol replacement. Front. Endocrinol. 2017, 8, 26. [Google Scholar] [CrossRef] [Green Version]
- Celichowski, P.; Nawrocki, M.J.; Dyszkiewicz-Konwińska, M.; Jankowski, M.; Budna, J.; Bryja, A.; Kranc, W.; Borys, S.; Knap, S.; Ciesiółka, S.; et al. Positive regulation of RNA metabolic process ontology group highly regulated in porcine oocytes matured in vitro: A microarray approach. BioMed. Res. Int. 2018, 2018, 2863068. [Google Scholar] [CrossRef] [Green Version]
- Von Mering, C.; Jensen, L.J.; Snel, B. STRING: Known and predicted protein-protein associations, integrated and transferred across organisms. Nucleic Acids Res. 2005, 33 (Suppl. 1), 433–437. [Google Scholar] [CrossRef]
- Aqrawi, L.A.; Gultung, H.K.; Vestad, B.; Øvstebø, R.; Thiede, B.; Rusthen, S.; Young, A.; Guerreiro, E.M.; Paaske Utheim, T.; Chen, X.; et al. Identification of potential saliva and tear biomarkers in primary Sjögren’s syndrome, utilising the extraction of extracellular vesicles and proteomics analysis. Arthritis Res. Ther. 2017, 19, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barrera, M.J.; Aguilera, S.; Castro, I.; González, S.; Carvajal, P.; Molina, C.; Hermoso, M.A.; González, M.J. Endoplasmic reticulum stress in autoimmune diseases: Can altered protein quality control and/or unfolded protein response contribute to autoimmunity? A critical review on Sjögren’s syndrome. Autoimmun. Rev. 2018, 17, 796–808. [Google Scholar] [CrossRef] [PubMed]
- Montibeller, L.; de Belleroche, J. Amyotrophic lateral sclerosis (ALS) and Alzheimer’s disease (AD) are characterised by differential activation of ER stress pathways: Focus on UPR target genes. Cell Stress Chaperones 2018, 23, 897–912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sepúlveda, D.; Barrera, M.J.; Castro, I.; Aguilera, S.; Carvajal, P.; Lagos, C.; González, S.; Albornoz, N.; Bahamondes, V.; Quest, A.F.G.; et al. Impaired IRE1α/XBP-1 pathway associated to DNA methylation might contribute to salivary gland dysfunction in Sjögren’s syndrome patients. Rheumatology 2018, 57, 1021–1032. [Google Scholar] [CrossRef] [Green Version]
- Bogaert, S.; De Vos, M.; Olievier, K.; Peeters, H.; Elewaut, D.; Lambrecht, B.; Pouliot, P.; Laukens, D. Involvement of endoplasmic reticulum stress in inflammatory bowel disease: A different implication for colonic and ileal disease? PLoS ONE 2011, 6, e25589. [Google Scholar] [CrossRef] [Green Version]
- Morito, D.; Nagata, K. ER stress proteins in autoimmune and inflammatory diseases. Front. Immunol. 2012, 3, 48. [Google Scholar] [CrossRef] [Green Version]
- Chong, W.C.; Shastri, M.; Eri, R. Endoplasmic reticulum stress and oxidative stress: A vicious nexus implicated in bowel disease pathophysiology. Int. J. Mol. Sci. 2017, 18, 771. [Google Scholar] [CrossRef]
- Ambudkar, I. Calcium signaling defects underlying salivary gland dysfunction. BBA Moll. Cell. Res. 2018, 1865, 1771–1777. [Google Scholar] [CrossRef]
- Fisher, A.; Pittel, Z.; Haring, R.; Bar-Ner, N.; Kliger-Spatz, M.; Natan, N.; Egozi, I.; Sonego, H.; Marcovitch, I.; Brandeis, R. M1 Muscarinic Agonists can modulate some of the hallmarks in Alzheimer’s disease. J. Mol. Neurosci. 2003, 20, 349–356. [Google Scholar] [CrossRef]
- Hoshino, T.; Nakaya, T.; Araki, W.; Suzuki, K.; Suzuki, T.; Mizushima, T. Endoplasmic reticulum chaperones inhibit the production of amyloid-βpeptides. Biochem. J. 2007, 402, 581–589. [Google Scholar] [CrossRef] [Green Version]
- Gerber, H.; Mosser, S.; Boury-Jamot, B.; Stumpe, M.; Piersigilli, A.; Goepfert, C.; Dengjel, J.; Albrecht, U.; Magara, F.; Fraering, P.C. The APMAP interactome reveals new modulators of APP processing and beta-amyloid production that are altered in Alzheimer’s disease. Acta Neuropathol. Commun. 2019, 7, 13. [Google Scholar] [CrossRef] [PubMed]
- Skopouli, F.N.; Katsiougiannis, S. How stress contributes to autoimmunity-lessons from Sjögren’s syndrome. FEBS Lett. 2018, 592, 5–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shin, J.H.; Park, S.J.; Jo, D.S.; Park, N.Y.; Kim, J.B.; Bae, J.E.; Jo, Y.K.; Hwang, J.J.; Lee, J.A.; Jo, D.G.; et al. Down-regulated TMED10 in Alzheimer disease induces autophagy via ATG4B activation. Autophagy 2019, 15, 1495–1505. [Google Scholar] [CrossRef] [PubMed]
- Katsiougiannis, S.; Tenta, R.; Skopouli, F.N. Endoplasmic reticulum stress causes autophagy and apoptosis leading to cellular redistribution of the autoantigens Ro/Sjögren’s syndrome related antygen A (SSA) and La/SSB in salivary gland epithelial cells. Clin. Exp. Immunol. 2015, 181, 244–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rojas-Rivera, D.; Armisén, R.; Colombo, A.; Martínez, G.; Eguiguren, A.L.; Díaz, A.; Kiviluoto, S.; Rodríguez, D.; Patron, M.; Rizzuto, R.; et al. TMBIM3/GRINA is a novel unfolded protein response (UPR) target gene that controls apoptosis through the modulation of ER calcium homeostasis. Cell Death Differ. 2012, 19, 1013–1026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doycheva, D.; Kaur, H.; Tang, J.; Zhang, J.H. The characteristics of the ancient cell death suppressor, TMBIM6, and its related signaling pathways after endoplasmic reticulum stress. J. Neurosci. Res. 2020, 98, 77–86. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Amyloid Beta Precursor Protein (APP) | ggccctggagaactacatca | aatcacacggaggtgtgtca |
Calnexin (CANX) | tgtagcccttcctgtgttcc | ttgactgacagtgccaccat |
Protein Disulfide Isomerase Family A Member 4 (PDIA4) | gagagtggggaggatgtcaa | gtcaaaggtctttcccacca |
Transmembrane P24 Trafficking Protein 10 (TMED10) | gtggaggcgaaaaattacga | aagaagcgtcgcaggtagaa |
Transmembrane BAX Inhibitor Motif Containing 6 (TMBIM6) | ttggatccatttggcttttc | ggctggatggtcacttcatt |
Parameters | Healthy Subjects (HS) | SS Patients | ||
---|---|---|---|---|
SS (Sicca) | SS (Non-Sicca) | |||
Number of individuals | 9 | 3 | 8 | |
Gender, Female/Male, n | 8/1 | 3/0 | 7/1 | |
Age, mean ± SD years | 40.0 ± 18.4 | 57.3 ± 1.2 | 48.3 ± 10.1 | |
Age, median (range), years | 33 (21–60) | 58 (56–58) | 51.5 (35–59) | |
Xerophtalmia, n | 0 | 1 | 3 | |
Focus score a, n | ||||
1 | 0 | 1 | 2 | |
2 | 0 | 1 | 2 | |
3 | 0 | 3 | ||
4 | 0 | 1 | 1 | |
Ro/SSA antibodies positive, n | 0 | 3 | 6 | |
La/SSB antibodies positive, n | 0 | 1 | 5 | |
Antinuclear antibodies positive, n | 0 | 2 | 8 | |
Rheumatoid factor, n | 0 | 1 | 3 | |
USWSF, mean ± SD ml/15 min | 4.17 ± 1.54 | 0.7 ± 0.3 | 3.1 ± 0.9 |
Gene Symbol | Entrez Gene ID | SS (Non-Sicca) Fold Change | SS (Sicca) Fold Change | SS (Non-Sicca) Adjusted p Value | SS (Sicca) Adjusted p Value |
---|---|---|---|---|---|
APP | 351 | −1.230085 | −4.00201 | 0.9824056 | 0.00029089 |
CANX | 821 | −1.226044 | −2.8748997 | 0.896879335 | 0.036051034 |
TMBIM6 | 7009 | −1.230474 | −4.248253 | 0.9453528 | 0.02556178 |
TMED10 | 10972 | −1.590254 | −2.6071216 | 0.839470532 | 0.005202518 |
PDIA4 | 9601 | −1.341286 | −3.9323753 | 0.922175914 | 0.000558442 |
Parameters | SS (Sicca) | SS (Non-Sicca) |
---|---|---|
Number of individuals | 11 | 11 |
Gender, n | ||
Female/Male | 9/2 | 10/1 |
Age, mean ± SD, years | 52.8 ± 11.1 | 50.9 ± 9.9 |
Age, median (range), years | 56 (34–71) | 52 (35–64) |
Xerophtalmia, n (%) | 9 (81.8) | 2 (18.18) |
Focus score a, n | ||
1 | 2 | 4 |
2 | 3 | 2 |
3 | 3 | 3 |
4 | 3 | 2 |
Ro/SSA antibodies positive, n | 6 | 8 |
La/SSB antibodies positive, n | 6 | 2 |
Antinuclear antibodies positive, n | 9 | 8 |
Rheumatoid factor, n | 7 | 4 |
USWSF, mean ± SD ml/15 min | 0.5 ± 0.5 | 3.4 ± 0.9 |
APP | TMBIM6 | TMED10 | CANX | PDIA4 | |
---|---|---|---|---|---|
Kruskal Wallis | 0.32 | 0.54 | 0.0033 | 0.03 | 0.02 |
Dunn test SS (sicca) vs HS | 0.0735 | 0.3417 | 0.0008 | 0.0192 | 0.0176 |
Dunn test SS (non-sicca) vs HS | 0.2121 | 0.2618 | 0.0019 | 0.0072 | |
Dunn test SS (sicca) vs SS (non-sicca) | 0.1863 | 0.1352 | 0.3819 | 0.3451 | 0.2502 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Błochowiak, K.; Celichowski, P.; Kempisty, B.; Iwanik, K.; Nowicki, M. Transcriptomic Profile of Genes Encoding Proteins Involved in Pathogenesis of Sjögren’s Syndrome Related Xerostomia—Molecular and Clinical Trial. J. Clin. Med. 2020, 9, 3299. https://doi.org/10.3390/jcm9103299
Błochowiak K, Celichowski P, Kempisty B, Iwanik K, Nowicki M. Transcriptomic Profile of Genes Encoding Proteins Involved in Pathogenesis of Sjögren’s Syndrome Related Xerostomia—Molecular and Clinical Trial. Journal of Clinical Medicine. 2020; 9(10):3299. https://doi.org/10.3390/jcm9103299
Chicago/Turabian StyleBłochowiak, Katarzyna, Piotr Celichowski, Bartosz Kempisty, Katarzyna Iwanik, and Michał Nowicki. 2020. "Transcriptomic Profile of Genes Encoding Proteins Involved in Pathogenesis of Sjögren’s Syndrome Related Xerostomia—Molecular and Clinical Trial" Journal of Clinical Medicine 9, no. 10: 3299. https://doi.org/10.3390/jcm9103299