A Polysaccharide of Ganoderma lucidum Enhances Antifungal Activity of Chemical Fungicides against Soil-Borne Diseases of Wheat and Maize by Induced Resistance

Abstract

Ganoderma lucidum polysaccharide (GLP), which is the primary active ingredient in G. lucidum, has been widely used in functional food and clinical medicine. However, it is rarely reported in the prevention and control of plant diseases. In this study, we found that the GLP can increase the germination rates and seedling heights of maize and wheat. We also found that the combination of GLP and chemical fungicides as a seed coating chemical compound has a control effect of more than 75% on the primary soil-borne diseases of the wheat and maize growing areas in both greenhouse and field trials. Furthermore, the combination of GLP and chemical fungicides prolongs the lasting period and reduces the application dosage of the chemical fungicides by half. In addition, GLP seed dressing could increase the resistance-related gene expression of the TPS and WRKY53 in maize and WMS533, NbPR1a, and RS33 in wheat. The combination of GLP and low-dose chemical fungicides proved to be an effective way to effectively prevent wheat sharp eyespot, root rot, and maize stalk rot in the wheat and maize continuous cropping areas in the North China Plain and to reduce pesticide use and increase crop yield.

1. Introduction

The North China Plain is an important grain production base in China. The annual production of maize and wheat accounts for approximately 40% and 60% of China’s total output, respectively. Therefore, it is also referred as China’s bread basket [1]. However, with the change in climate and the popularization of returning straw to the soil, soil-borne diseases, such as wheat sharp eyespot, wheat root rot, and maize stalk rot in wheat and maize rotation regions has increased yearly and seriously threatened crop yield and quality [2,3,4,5]. The pathogens of the three diseases can live through the winter through mycelium attached to the remnants of the diseased plant. In addition, the mycelium of wheat sheath blight and root rot can also live through the winter in the soil and inside and outside the seeds, respectively. Wheat sharp eyespot caused by Rhizoctonia cerealis van der Hoeven and root rot by Bipolaris sorokiniana are important typical soil-borne diseases threatening wheat production worldwide [6]. Wheat sharp eyespot can infect the stems and sheaths of wheat plants, leading to a block in nutrient transportation. Sharp eyespot is common in China, New Zealand, the United States, and other places, and has become an important disease on wheat. The yield loss and quality reduction caused by this disease exceeded $15 million per year in China [7]. Wheat root rot causes black lesions on the roots and bases and white heads that could even have empty spikes, resulting in a serious loss of wheat yield [8,9]. Maize stalk rot caused by Fusarium graminearum is a systemic soil-borne disease that seriously damages maize production [10]. Its outbreak is sudden and dramatic, which can directly affect the absorption of water and nutrients in maize plants and destruct their metabolic function, thus causing serious losses in maize yield and quality [11,12,13].

Traditionally, the management of soil-borne diseases primarily depends on disease-resistant breeding and chemical agents [14,15]. However, the current agronomic practices are not sufficiently effective, and breeding resistant varieties is time consuming [16]. In addition, research on the use of pesticides in the production of maize and wheat in China has shown that the increased use of pesticides in agriculture results in adverse effects on human and animal health, environmental pollution in water and soil, and side effects on beneficial organisms, including pollinators, decomposers, and natural enemies [17]. In recent years, the increased use of EBIs (ergosterol biosynthesis inhebitors, EBIs), particularly the azole antifungals, has resulted in the development of drug resistance, and there is cross-resistance between the agents [18,19]. The repeated application had also brought about a serious problem of pesticide resistance. Fungicides in the soil could also affect subsequent crop growth through winter wheat seed dressing experiments [20]. Zaller reported that fungicidal seed dressings could increase the number of protozoa, reduce the plant decomposition rate, and affect soil microbial activity [21]. China has implemented a strategic target for pesticide reduction [22]. It focused on how to reduce the use dosage of pesticides, find environmentally friendly alternatives, and safeguard crop production [23]. The use of immune inducers to protect plants against pests by activating host resistance has become a research hotspot in recent years.

Ganoderma lucidum is a basidiomycetes polyporaceous fungus that contains many types of bioactive components, of which the key components are G. lucidum polysaccharide (GLP) [24,25]. Its primary structural feature is a β-1,3-D-linear, which is consistent with many reported structures of fungal polysaccharides, and belongs to the β-1,3-glucans (Figure 1) [26]. The main chain structure of polysaccharides is β-(1→3)-linked d-glucopyranose residue, and the side chain is linked with single, disaccharide, and oligosaccharide at the C-6 position of the main chain. GLP has been used to prevent intestinal disorders and obesity-related metabolic disorders in obese individuals, regulate insulin production, and inhibit cancer cell growth [27,28,29]. However, the application prospects of GLP in agriculture are not clear. In this study, we evaluated the prevention and control effects of GLP and chemical agents combined with reduced dosage on three soil-borne diseases in greenhouse and field trials. The purpose is to study the control effect of GLP on the main soil-borne diseases in the wheat and maize rotation areas in the North China Plain and to explore the possibility of reducing the use of chemicals by inducing plant disease resistance, so as to provide references for the wide application of GLP in disease control and providing a basis for evaluation of biopesticide efficacy.

2. Materials and Methods

2.1. Fungal Isolates, Culture Media, Fungicides and Varieties Tested

The strains used in this study, R. cerealis, B. sorokiniana, and F. graminearum, were all provided by the Microbe Provincial Key Laboratory of Shandong Agricultural University and used after activation and purification steps. They were cultivated in potato dextrose agar (PDA) media (200 g potato, 20 g dextrose and 20 g agar per 1 L). The liquid media excluded agar.

The fungicides used, difenoconazole (96%), fludioxonil (98%), prochloraz (97%), thiram (96%), hexaconazole (95%), metalaxyl (98%), and fluopimomide (98%) were all technical grade. Stock solutions (1 × 10⁴ μg/mL) were prepared in acetone and stored at 4 °C.

The wheat cultivated varieties tested included Shannong 23, Jimai 22 and Luyuan 502. The maize cultivated varieties tested included Zhengdan 958, Xianyu 335 and Luning 202. These cultivated varieties are widely planted in the wheat and maize areas of the North China Plain.

2.2. Extraction and Purification of GLP

Fruiting bodies of G. lucidum were obtained from the Jiangsu Alphay Biological Technology Co., Ltd. (Nantong, China). GLP was obtained using water extraction and alcohol precipitation. The Ganoderma lucidum fruiting body was dried at 50 °C and crushed, and 95% ethanol was used to remove impurities and small lipophilic molecules for 24 h. The solution was degreased with petroleum ether and extracted with distilled water at 80 °C for 8–10 h in several batches. The filtered residue was extracted three times. The extraction solution was mixed, and vacuum concentration was performed. The polysaccharides (crude polysaccharides) were precipitated again with ethanol. The precipitate obtained was lyophilized and combined. (Figure 2) After quantified with the phenol–sulfuric acid method [30], the extraction rate of GLP (w/w) was 25.8%.

2.3. Fungicide Amended-Agar Assay

Gradient dilutions of the chemical fungicides (difenoconazole, fludioxonil, prochloraz, thiram, hexaconazol, metalaxyl, and fluopimomide) and GLP were conducted with acetone and sterile water at an ultra-clean bench; acetone control was used as a control. 1 mL of each diluted solution was mixed with 49 mL of sterilized PDA medium before pouring in plates. A 7 mm mycelial plug cut from the edge of the activated strain was inoculated in the center of each PDA plate. Each treatment was repeated three times, and the culture was grown at 25 °C in dark. When the colony diameter of the control group reached approximately 70 mm, the diameter of the colonies was determined using the cross method (measuring the colony diameter in two vertical directions), and the average value was used to calculate the inhibition rate (%) of each concentration of the agent [31]. The data obtained were analyzed using SPSS 22.0 to calculate the EC₅₀ value of the agent against various pathogens.

2.4. Effects of GLP Seed Dressing on Wheat and Maize Germination and Seedling Growth

Maize and wheat seeds were surface-disinfected for 3 min in 1% (w/v) NaOCl followed by 3 min in 70% (v/v) ethanol and rinsed three times in sterile distilled water before the experiment. Wheat germination and seedling growth were conducted as described by Zhang [4].

The main components of seed coating are as follows: Fungicides (1) 4% GLP, (2) 8% GLP, (3) 0.5% hexaconazole, (4) 1% hexaconazole, (5) 2% hexaconazole, (6) 4% GLP + 0.5% hexaconazole, (7) 15% GLP, (8) 30% GLP, (9) 20% prochloraz, (10) 40% prochloraz, (11) 80% prochloraz, (12) 15% GLP + 20% prochloraz), 3.1% BY140, 4% NNO, 3% Polyacrylamide + CMC, 4% Ethylene glycol, 0.2% Gelatin, 6% Pigment red, and water is used to make up 100%.

In all tests, the coating agent was applied at doses of 100 mL per 100 kg of seeds. The wheat seeds were subjected to 7 treatments: (1) 4% GLP; (2) 8% GLP; (3) 0.5% hexaconazole; (4) 1% hexaconazole; (5) 2% hexaconazole; (6) 4% GLP + 0.5% hexaconazole, and (7) sterile water treatment (control).

The maize seeds were subjected to the following 7 treatments: (1) 15% GLP; (2) 30% GLP; (3) 20% prochloraz; (4) 40% prochloraz; (5) 80% prochloraz; (6) 15% GLP + 20% prochloraz, and (7) sterile water treatment (control).

2.5. Effects of GLP on Wheat Sharp Eyespot, Wheat Root Rot and Maize Stem Rot

The seed treatment in this experiment is completely consistent with the above-mentioned treatments of wheat and corn seed germination and seedling growth, except that the highest dose of fungicide treatment is removed. Then we coated seeds (100 kg) with different doses of GLP or fungicide or the same volume of sterile water (control). The treated seeds are used after being dried in the air. The soil was collected from fields infested with wheat sharp eyespot, root rot and maize stem rot and filled in plastic pots with a diameter of approximately 30 cm. Then each pot received 20 mL of pathogenic bacteria (R. cerealis, D. sorokiniana and F. graminearum) suspension (OD₄₂₀ = 0.56), and 10 treated seeds were sown in. It was cultured in a greenhouse with temperature of 20 ± 2 °C, relative humidity of 70 ± 5%, and light-dark ratio (L:D) = 14:10. Each pot was one replicate, and each treatment was repeated three times.

The disease incidence and severity in each treatment were investigated at 7 d, 14 d and 21 d after seedlings sprout. The classification criteria of wheat sharp eyespot disease are as follows [32]: grade 0, no onset; grade 1, leaf-based point-like disease; grade 3, lesion circle ring stem less than 1/2; grade 5, stem-based lesions more than 1/2; and grade 7, dead, lodging. The wheat root rot classification criteria were as follows: 0, no visible lesions; level 1, local sensation of the stem base, brown small lesions, light color; level 2, deep brown spots visible at the base of the stem and visible lesions. The width is 1/5 or less of the circumference of the base of the stem; level 3, the lesion at the base of the stem is connected to the growth strip, and the width of the lesion is less than 1/3 of the circumference of the base of the stem, which has an influence on yield; level 4, the lesion is 1/2 or less of the circumference of the base of the stem, which has a heavier effect on the yield, and at level 5, the lesion at the base of the stem is more than 3/5 of the circumference of the base of the stem, which has a serious impact on the yield. The grading criteria of maize stem rot disease were as follows: 0 indicated healthy plants with a well-developed root and coleoptile; 1 indicated plants with 25% of the radicle and coleoptile exhibiting decay symptoms; 2 indicated >25% to 50% of the radicle and coleoptile exhibiting decay symptoms; 3 indicated >50 to 75% of the radicle and coleoptile exhibiting decay symptoms; and 4 indicated radicles and coleoptiles with ≥75% decay. The disease severity index (%) and the control effect (%) of each treatment were calculated according to the formulas (1) and (2), respectively [13,33,34].

Disease severity index = [∑ (number of diseased plants with a certain index value × index value)/(total number of plants investigated × highest disease index)] × 100%.

(1)

Control = [(disease severity index in the control group − disease severity index in the treated group)/disease severity index in the control group] × 100%.

(2)

2.6. Field Trials

Field tests of efficacy were conducted in the experimental field of Taian, Shandong, China (36.17° N, 117.17° E) from 2017 to 2019. This area belongs to temperate monsoon climate zone with moderate rainfall, annual average temperature is about 13 °C and annual average precipitation is about 670 mm. It belongs to fertile brown soil. Due to long-term wheat and maize rotation, wheat sharp eyespot, wheat root rot, and maize stem rot are severe in this region. The experimental field for each treatment covered 150 m² with three replications. Maize plants at the test site were planted each year on approximately 5 June. We investigated the incidence of maize stalk rot and its control effect each year on 30 July and 20 August. Wheat was planted in the autumn after the seed dressing treatment, and the incidence and control effect of wheat sharp eyespot were investigated in the wintering, jointing and filling stages of the wheat. The control effect of wheat root rot was examined at the wheat seedling stage.

2.7. RNA Extraction and Real-Time Quantitative RT-PCR

Leaves of maize grown from seeds exposed to 15% and 30% GLP and wheat grown from seeds exposed to 4% and 8% GLP was collected 7 d after seedling emergence and stored at −80 °C. Total RNA was extracted using Plant Total RNA Kits (Omega, Norcross, GA, USA) according to the manufacturer’s instructions. First-strand cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific, Waltham, MA, USA). The qRT-PCR reactions were performed in triplicate on each of three replicates. The qRT-PCR was performed on a Quantitative PCR Q6 Thermal Cycler (ABI, Carlsbad, CA, USA) using a SYBR Green-based PCR reaction mixture and 8 ng template cDNA. Specific primers were designed using the Primer Express software (Sandon Biotech, Shanghai, China) (

Table 1. Groups of real-time quantitative PCR (RT-qPCR) primers used to amplify genes pecific regions.

	Accession No.	Genes	Left Primer 5′-3′	Right Primer 5′-3′
Maize	GRMZM2G103342	POD	AGTAGATGATCCCTGTCCGC	GCCGCCACCCTCTTATTAGA
	GRMZM2G112488	PR-10	TGAAGGTGGACTCGACGTAC	CGATCGCATGCATGGTCTAC
	GRMZM2G127087	TPS	GACCAGACAAGAGCTACCGA	CCCATTCCAACAAACGCAGA
	GRMZM2G402613	PR-5	CGGCAACAGCAACTACCAAG	GCACACAAATCCAGCTACGT
	GRMZM2G453805	CHCTc	CGTGCAGAACAACTACAGCA	ATGCGTCTTTGTCTCCCGAT
	GRMZM2G162505	CHIT	ACCTCCACCAATCCAACCAA	CAACAGCCGCTACAAGTACC
	GRMZM2G336824	OMT	CCACCCTTCTCCAGATCCTC	AGACTCACAAAGGGAGCCAA
	AC205502.4_FG004	TPS21	AGAGGTCACACGCTTCATGA	GCCATGCTCACTGATGTAGC
	GRMZM2G148904	EA	CACGTACCCCATCTTCCTCA	GATCATCAATCGTCGGAGCG
	GRMZM2G028306	TPC	AGAGAAAAGGCTGGAGTGCT	GATTTAGTCGCTGCAGGGTG
	GRMZM2G136372	PR5	CTCCAGCCAACTTCTTTCTTTG	GGGGTGAACATCATCGTCTTAT
	GRMZM2G449681	WRKY53	GACATTGTGGTCCCATCTGAT	GAGAGGGGGAGAGAAGAGAT
	GRMZM2G079112	JA-COL1	TGGAACCCCTAAAAATTTCCCT	GATCTGTTTCCCTCCTCGAC
	GRMZM2G091276	JAR1	TCCTCTCTATTGCGAAAAGGTT	AGTGCCAGTAAGAAAGTTCAGA
	GRMZM2G001930	JA-MYC2	AATCCGCATTCTGAACCATTTC	GAAAGAGGAGGAGAAATGGTGG
	U76259	EF1A	GCCTGGTATGGTTGTTACT	CATACCCACGCTTCAGATCC
Wheat	AK455337.1	IR5	GCCGTTCGCATAGTCAATC	CGCACCATTATTCGCTTGT
	AK332579.1	IR2	GACATCCATTTCCAGGGGC	GCGGTCTGGGCATTCATC
	JF718349.1	DQ-GLU	GCTGGAAAGGATGTTGCT	TGCCCGTTACACTTGGAT
	HG670306.1	IR6	CACTGGGTCGTGACACTTCT	CCTCCTCTTCCTTGTATGCTG
	HG670306.1	WMC44	GGTCTTCTGGGCTTTGATCCTG	TGTTGCTAGGGACCCGTAGTGG
	AK446945.1	csGS	AAGATTGTTCACAGATCCATGTCA	GAGTATTCCGGCTCAAAAAGG
	AK448410.1	WMS533	AAGGCGAATCAAACGGAATA	GTTGCTTTAGGGGAAAAGCC
	XM_016633336.1	NbPR1a	CGTTGAGATGTGGGTCAATG	CCTAGCACATCCAACACGAA
	AK449901.1	NbrbohB	GTGATGCTCGTTCTGCTCTT	CTTTAGCCTCAGGGTGGTTG
	XM_013385118.1	Xgwm526	CAATAGTTCTGTGAGAGCTGCG	CCAACCCAAATACACATTCTCA
	AK449144.1	Xwmc364	ATCACAATGCTGGCCCTAAAAC	CAGTGCCAAAATGTCGAAAGTC
	HG670306.1	RS33	TGGAGAGGACAGCCCATGGAGTTGGTAGTAGGTGC	GCCCTTGCTCACCATGCTGCTGATAACATGATCCA
	AK450528.1	Actin	CACTGGAATGGTCAAGGCTG	CTCCATGTCATCCCAGTTG

).

2.8. Data Processing and Analysis

In this paper, in fungicide amended-agar assay, the percentage of inhibition were calculated using the following excel formula, and the half maximal effective concentration (EC₅₀) values was determined by the one-way ANOVA log-probability regression analysis of SPSS 22.0 software.

Inhibition growth (%) = (Diameter of fungal hyphae colony in the control − Diameter of fungal hyphae colony under fungicide effect)/Diameter of fungal hyphae colony in the control) × 100

The test data of diameter of fungal hyphae, greenhouse and field were subjected to the Shapiro–Wilk’s and Levene’s tests (p > 0.05) to confirm normal distribution and homoscedasticity, and statistically analyzed by Duncan’s new complex range method (DMRT) of different treatments, and the test results were evaluated (p < 0.05).

3. Results

3.1. In Vivo Assays Test of GLP and Fungicides against Fusarium graminearum, Drechslera sorokiniana and Rhizoctonia cerealis

The results indicated that prochloraz, fludioxonil and hexaconazole had higher toxicity than metalaxyl and fluopimomide on the hyphal growth of F. graminearum. The fungicidal effect of prochloraz was best with EC₅₀ value 0.088 mg·L⁻¹ (

Table 2. In vivo assays test of GLP and fungicides on Fusarium graminearum.

Treatments	Regression Equation	R2	EC50 Value (mg·L−1)	95%Confidence Interval (mg·L−1)
Prochloraz	Y = 5.794 + 0.750 X	0.974	0.088	0.072~0.106
Fludioxonil	Y = 5.170 + 0.750 X	0.962	0.593	0.442~0.795
Hexaconazole	Y = 5.095 + 0.814 X	0.980	0.764	0.594~0.981
Metalaxyl	Y = 3.102 + 1.014 X	0.960	5.927	4.419~7.650
Fluopimomide	Y = 5.195 + 1.045 X	0.969	6.137	5.643~6.983
GLP	/	/	/	/

Note: GLP has no inhibitory effect on Fusarium graminearum.

). Hexaconazole, prochloraz and fludioxonil had higher toxicity than the other treatment on the hyphal growth of D. sorokiniana, with EC₅₀ values all lower than 1.0 mg·L⁻¹. Hexaconazole had the strongest fungicidal effect, and its EC₅₀ value is only 0.144 mg·L⁻¹ (

Table 3. In vivo assays test of GLP and fungicides on Drechslera sorokiniana.

Treatments	Regression Equation	R2	EC50 Value (mg·L−1)	95%Confidence Interval (mg·L−1)
Hexaconazole	Y = 1.29 + 1.54 X	0.988	0.144	0.111~0.176
Prochloraz	Y = 1.06 + 1.40 X	0.983	0.182	0.125~0.229
Fludioxonil	Y = 0.28 + 1.98 X	0.981	0.766	0.624~0.908
Difenoconazole	Y = 0.92 + 1.57 X	0.968	3.259	2.635~3.913
Thiram	Y = −1.74 + 2.51 X	0.973	6.915	5.526~8.314
Fluopimomide	Y = −5.28 + 3.22 X	0.985	43.33	38.21~48.45
GLP	/	/	/	/

Note: GLP has no inhibitory effect on Drechslera sorokiniana.

). Hexaconazole and fludioxonil had higher toxicity on the hyphal growth of R. cerealis, with EC₅₀ values of 0.094 mg·L⁻¹ and 0.312 mg·L⁻¹, respectively (

Table 4. In vivo assays test of GLP and fungicides on Rhizoctonia cerealis.

Treatments	Regression Equation	R2	EC50 Value (mg·L−1)	95%Confidence Interval (mg·L−1)
Hexaconazole	Y = 2.79 + 2.30 X	0.952	0.094	0.032~1.255
Fludioxonil	Y = 0.76 + 1.47 X	0.985	0.312	0.081~0.574
Fluopimomide	Y = −1.00 + 1.62 X	0.986	4.169	3.125~4.852
Prochloraz	Y = −1.17 + 1.54 X	0.983	5.738	5.112~6.312
GLP	/	/	/	/

Note: GLP has no inhibitory effect on Rhizoctonia cerealis.

). In addition, GLP, a biological resistance-inducing agent, showed no direct fungicidal effect on these pathogens.

3.2. Effects of Seed Dressing on Wheat and Maize Germination

It can be seen from

Table 5. Effects of seed dressing on wheat germination.

Wheat Cultivated Variety	Treatment	Dosage (mL/100 kg Seed)	Germination Rate (%)
			Control Germination 50%	Control Total Germination	3 Days after Control Total Germination
Jimai 22	CK	100	50.00 b	95.00 bc	97.00 b
	4% GLP	100	52.25 a	97.25 a	98.25 a
	8% GLP	100	53.25 a	96.25 ab	97.25 ab
	0.5% Hexaconazole	100	50.00 b	95.00 bc	95.75 c
	1% Hexaconazole	100	46.75 c	94.00 c	95.75 c
	2% Hexaconazole	100	44.75 d	91.75 d	95.50 c
	0.5% H + 4% GLP	100	50.25 b	96.75 ab	97.00 b
Shannong 23	CK	100	48.75 b	96.00 b	97.00 b
	4% GLP	100	50.00 ab	96.75 ab	97.75 ab
	8% GLP	100	51.75 a	98.25 a	98.25 a
	0.5% Hexaconazole	100	48.75 b	95.00 b	95.75 c
	1% Hexaconazole	100	47.25 b	92.75 c	95.75 c
	2% Hexaconazole	100	44.00 c	90.50 d	96.75 bc
	0.5% H + 4% GLP	100	49.00 b	95.00 b	97.00 b
Luyuan 502	CK	100	48.00 b	95.00 bc	96.50 ab
	4% GLP	100	48.25 b	96.25 ab	97.00 a
	8% GLP	100	49.25 ab	97.25 a	97.25 a
	0.5% Hexaconazole	100	50.25 a	96.00 ab	96.00 b
	1% Hexaconazole	100	45.75 c	94.25 c	96.00 b
	2% Hexaconazole	100	42.75 d	91.75 d	94.75 c
	0.5% H + 4% GLP	100	48.00 b	96.00 ab	96.00 b

Note: CK means that seeds are treated with sterile water. 0.5% H + 4% GLP stands for the combination of hexaconazole with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests. Table 6, Table 7, Table 8, Table 9, Table 10, Table 11, Table 12, Table 13 and Table 14 are the same.

that the germination rate of wheat seeds treated with GLP was higher than that of the control, while the germination rate of wheat seeds treated with hexaconazole was significantly lower than that of the control. The difference is that there is no significant difference in the germination rate with different doses of GLP treatment, while the germination rate decreases with the increase of the hexaconazole dose. Three days after complete germination, the germination rate of the seeds treated with each dose of hexaconazole was equal to that of the control, indicating that the inhibitory effect of high-dose hexaconazole on germination can be quickly restored. And the combination of GLP and hexaconazole has no significant difference compared with the control, indicating that the compound GLP can alleviate the inhibitory effect of low-dose hexaconazole on germination. In addition, from the numerical point of view, there is no significant difference in the effect of each treatment on the germination rate of different cultivated varieties of wheat.

The results in

Table 6. Effects of seed dressing on maize germination.

Maize Cultivated Variety	Treatment	Dosage (mL/100 kg Seed)	Germination Rate (%)
			Control Germination 50%	Control Total Germination	3 Days after Control Total Germination
Zhengdan 958	CK	100	49.00 b	96.75 a	97.50 b
	15% GLP	100	51.25 a	97.00 a	97.75 b
	30% GLP	100	51.75 a	97.25 a	99.25 a
	20% Prochloraz	100	49.00 b	96.75 a	97.75 b
	40% Prochloraz	100	47.75 c	95.75 b	98.00 b
	80% Prochloraz	100	47.25 c	94.50 c	99.25 a
	20% P + 15% GLP	100	49.75 b	97.00 a	97.75 b
Xianyu 335	CK	100	49.00 b	95.75 c	98.75 a
	15% GLP	100	52.25 a	97.00 b	97.75 b
	30% GLP	100	53.75 a	98.25 a	99.00 a
	20% Prochloraz	100	48.00 b	97.00 b	97.75 b
	40% Prochloraz	100	46.00 c	95.75 c	97.50 b
	80% Prochloraz	100	45.25 c	94.50 d	97.50 b
	20% P + 15% GLP	100	49.00 b	96.75 b	99.00 a
Luning 202	CK	100	49.00 b	96.75 b	98.75 a
	15% GLP	100	50.25 ab	96.75 b	99.00 a
	30% GLP	100	51.25 a	98.25 a	99.25 a
	20% Prochloraz	100	48.75 b	98.00 a	99.00 a
	40% Prochloraz	100	46.50 c	94.50 d	97.75 b
	80% Prochloraz	100	46.00 c	95.75 c	97.50 b
	20% P + 15% GLP	100	48.75 b	97.75 a	99.00 a

Note: 20% P + 15% GLP stands for the combination of prochloraz with GLP. Different lower-cases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

indicated that the germination rate of Zhengdan 958, Xianyu 335 and Luning 202 treated with GLP is higher than 50% when the control germination is 50%, but the induction effect has no significant increase with the treatment dose. Fungicide prochloraz showed a slight decrease in the germination rate of the three cultivated varieties of maize seeds compared with the control. When the control was completely germinated, the three cultivated varieties of maize seeds treated with 40% and 80% prochloraz were lower than the control, and the higher the treatment dose, the lower the germination rate. Therefore, prochloraz has an inhibitory effect on the early germination of maize, and its effect on Xianyu 335 is the most obvious. Three days after the complete germination, the germination rates of the three cultivated varieties of maize seeds treated with GLP and prochloraz were the same as the control. This indicated that the inhibitory effect of prochloraz on the germination of the maize seeds was temporary, and it had no effect on the final emergence rate of each cultivated variety. After treatment of wheat seeds with 20% prochloraz and 15% GLP, the germination rate of the three cultivated varieties of maize was not significantly different with the control.

3.3. Effects of Seed Dressing on the Growth of Wheat and Maize Seedlings

The effect of the GLP on the promotion of the wheat seedling growth and the inhibitory effect of hexaconazole on the plant height of the wheat were more significant in the early stage (

Table 7. Effects of seed dressing on the growth of wheat seedlings.

Wheat Cultivated Variety	Treatment	Dosage (mL/ 100 kg Seed)	Height (cm)
			7 d	14 d	21 d
Jimai 22	CK	100	7.35 c	18.50 b	27.50 b
	4% GLP	100	9.03 b	20.56 a	28.02 b
	8% GLP	100	9.81 a	21.18 a	30.96 a
	0.5% Hexaconazole	100	7.18 c	18.95 b	26.96 c
	1% Hexaconazole	100	6.25 d	15.94 c	26.35 c
	2% Hexaconazole	100	5.28 e	15.29 c	26.02 c
	0.5% H + 4% GLP	100	7.22 c	18.75 b	28.55 b
Shannong 23	CK	100	6.28 c	15.50 b	26.50 b
	4% GLP	100	7.50 b	16.80 a	27.00 b
	8% GLP	100	8.75 a	18.06 a	28.50 a
	0.5% Hexaconazole	100	6.39 c	15.0 bc	26.96 b
	1% Hexaconazole	100	5.47 d	14.33 c	26.03 c
	2% Hexaconazole	100	4.84 d	13.91 c	25.78 c
	0.5% H + 4% GLP	100	6.52 c	15.85 b	27.12 b
Luyuan 502	CK	100	7.01 d	17.50 c	26.50 b
	4% GLP	100	9.84 b	20.75 b	28.22 a
	8% GLP	100	11.96 a	24.33 a	27.85 a
	0.5% Hexaconazole	100	6.50 e	16.96 c	26.35 b
	1% Hexaconazole	100	6.06 e	16.34 d	25.96 b
	2% Hexaconazole	100	5.43 e	16.02 d	25.78 b
	0.5% H + 4% GLP	100	7.44 d	17.69 c	26.86 b

Note: Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

). 7 d after emergence, the plant heights of the three wheat cultivars treated with at 4% g and 8% GLP were significantly higher than the control, and the effect of induction increased in parallel with the treatment dose. The plant height of the three cultivated varieties treated with 0.5%, 1% and 2% hexaconazole was lower than that of the control, and the significance of the inhibition increased in parallel with the dose of the drug, particularly in Jimai 22. The performance of Luyuan 502 on these two cultivated varieties is more pronounced. After treatment with 0.5% hexaconazole and 4% GLP, the plant heights of the three cultivated varieties were 7.22, 6.52 and 7.44 cm, respectively. They were significantly higher than the single dose of hexaconazole. This shows that when the bioinhibitor GLP and hexaconazole are used in combination for seed treatment, it can alleviate the seedling growth inhibition of the triazole fungicides. On the 21st day after emergence, the induction of GLP and the inhibition of hexaconazole were lower than those of the first two determination periods, and the difference between the treatments was significantly reduced, but the high dose of fungicide treatment still had a significant effect on the wheat plant height with the effect on Jimai 22 and Luyuan 502 more pronounced.

Seven days after the emergence of maize, the plant heights of Zhengdan 958, Xianyu 335 and Luning 202 treated with 15% GLP were 7.88, 7.50 and 6.48 cm, respectively, which were significantly higher than the control of 7.23, 6.52 and 5.36 cm. The induction effect of 30% GLP treatment was more pronounced. Treatment of the three cultivated varieties of maize seeds with 20%, 40%, and 80% prochloraz had no effect on maize plant height. Seed treatment with 20% prochloraz and 15% GLP resulted in a plant height of maize that was significantly higher than that of the control and the same dose of prochloraz. On the 21st day after emergence, the difference in plant height between the treatments was reduced. There was no significant difference in the plant height of each dose of GLP and prochloraz-treated Zhengdan 958. The only significant difference observed was from the 30% GLP treatment. The height of the treated Xianyu 335 was significantly higher than that of the control, and there was no significant difference between the other treatments (

Table 8. Effects of seed dressing on the growth of maize seedlings.

Maize Cultivated Variety	Treatment	Dosage (mL/100 kg Seed)	Height (cm)
			7 d	14 d	21 d
Zhengdan 958	CK	100	7.23 c	28.50 b	55.50 a
	15% GLP	100	7.88 b	30.56 a	58.22 a
	30% GLP	100	8.31 a	31.18 a	58.56 a
	20% Prochloraz	100	7.18 c	28.31 b	56.39 a
	40% Prochloraz	100	7.06 c	28.25 b	55.29 a
	80% Prochloraz	100	6.89 c	27.96 b	55.18 a
	20% P + 15% GLP	100	7.83 b	30.47 b	55.49 a
Xianyu 335	CK	100	6.52 c	26.50 b	55.50 b
	15% GLP	100	7.50 b	27.00 b	56.78 b
	30% GLP	100	8.57 a	28.50 a	58.06 a
	20% Prochloraz	100	6.48 c	27.12 b	56.23 b
	40% Prochloraz	100	6.29 c	26.51 b	55.85 b
	80% Prochloraz	100	6.37 c	26.02 b	54.95 b
	20% P + 15% GLP	100	7.35 b	26.94 b	56.17 b
Luning 202	CK	100	5.36 b	24.50 c	47.50 a
	15% GLP	100	6.48 a	25.22 b	47.75 a
	30% GLP	100	6.96 a	25.85 b	48.33 a
	20% Prochloraz	100	5.22 b	24.35 c	47.88 a
	40% Prochloraz	100	5.08 b	24.12 c	46.89 a
	80% Prochloraz	100	5.11 b	23.98 c	46.85 a
	20% P + 15% GLP	100	6.44 a	25.29 c	47.69 a

Note: 20% P + 15% GLP stands for the combination of prochloraz with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

).

3.4. Control Effect of The Seed Treatment on 3 Soil-Borne Diseases in Wheat and Maize Continuous Cropping Areas

As seen results in

Table 9. Control effect of the seed treatment on wheat sharp eyespot.

Wheat Cultivated Variety	Agentia	Dosage (mL/100 kg Seed)	Control Effect (%)
			7 d	14 d	21 d
Jimai 22	4% GLP	100	28.1 ± 1.7 d	24.5 ± 2.1 d	22.9 ± 1.9 d
	8% GLP	100	32.7 ± 2.6 b	31.4 ± 2.4 b	29.6 ± 3.7 c
	0.5% Hexaconazole	100	50.3 ± 4.9 c	43.7 ± 1.8 c	40.1 ± 2.5 b
	1% Hexaconazole	100	79.7 ± 7.4 a	69.8 ± 7.1 a	64.3 ± 3.7 a
	0.5% H + 4% GLP	100	75.8 ± 2.7 a	68.1 ± 1.9 a	66.6 ± 2.4 a
Shannong 23	4% GLP	100	24.5 ± 0.6 d	21.9 ± 0.4 e	19.6 ± 1.1 d
	8% GLP	100	30.8 ± 1.5 bc	27.9 ± 1.3 d	26.2 ± 3.7 c
	0.5% Hexaconazole	100	43.4 ± 3.2 c	38.6 ± 1.6 c	30.8 ± 2.2 c
	1% Hexaconazole	100	72.0 ± 4.3 a	66.5 ± 3.9 a	59.4 ± 2.5 b
	0.5% H + 4% GLP	100	67.1 ± 5.3 b	65.7 ± 1.3 a	65.2 ± 2.8 a
Luyuan 502	4% GLP	100	30.5 ± 1.8 d	27.9 ± 2.7 d	26.0 ± 1.6 d
	8% GLP	100	36.0 ± 3.1 c	32.4 ± 1.3 c	29.6 ± 0.8 c
	0.5% Hexaconazole	100	51.6 ± 3.7 b	47.7 ± 2.5 b	42.2 ± 1.2 b
	1% Hexaconazole	100	77.3 ± 8.3 a	71.5 ± 2.9 a	63.6 ± 2.0 a
	0.5% H + 4% GLP	100	73.4 ± 4.1 a	68.7 ± 2.6 a	65.2 ± 1.2 a

Note: 0.5% H + 4% GLP stands for the combination of hexaconazole with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

, the greenhouse control effects of hexaconazole on wheat sharp eyespot increased with the treatment dose. The treatments of Jimai 22, Shannong 23 and Luyuan 502 with 1% hexaconazole treatment, and the control effects on sharp eyespot on the 7 days after the emergence of wheat were 79.7%, 72.0% and 77.3%, respectively. The bioinducing agent GLP was used alone, although the greenhouse effect of the wheat sharp eyespot increased with the treatment dose, but the direct induction effect was still low. The combination of the fungicides and bioinducing agents for wheat seed treatment is much more effective against wheat sharp eyespot than a single agent treatment. After the seed dressing of 0.5% hexaconazole and 4% GLP, the control effects on the three cultivated varieties were 75.8%, 67.1% and 73.4%, respectively. The control effect was not significantly different from the 1% hexaconazole treatment. The 21 d control effect of Shannong 23 was 65.2%, which was 8.9% higher than that of 1% hexaconazole. The treatment group of 1% hexaconazole effectively controlled the wheat root rot, and the control effects on the 7 d of the three cultivated varieties are 76.3%, 80.2% and 80.4%, respectively (

Table 10. Control effect of seed treatment on wheat root rot.

Wheat Cultivated Variety	Agentia	Dosage (g a.i./100 kg Seed)	Control Effect (%)
			7 d	14 d	21 d
Jimai 22	4% GLP	100	29.8 ± 1.9 d	26.3 ± 2.7 d	24.5 ± 1.7 c
	8% GLP	100	35.4 ± 3.1 c	32.7 ± 2.2 c	30.8 ± 1.7 b
	0.5% Hexaconazole	100	46.9 ± 4.5 b	40.3 ± 2.9 b	35.7 ± 3.5 b
	1% Hexaconazole	100	76.3 ± 3.4 a	62.4 ± 4.6 a	55.3 ± 4.1 a
	0.5% H + 4% GLP	100	79.4 ± 3.6 a	70.3 ± 4.1 a	61.5 ± 3.4 a
Shannong 23	4% GLP	100	28.2 ± 1.7 d	25.7 ± 1.6 d	22.9 ± 1.8 d
	8% GLP	100	38.5 ± 2.1 c	34.7 ± 1.9 c	30.5 ± 1.6 c
	0.5% Hexaconazole	100	52.4 ± 2.8 b	46.8 ± 3.1 b	42.5 ± 1.7 b
	1% Hexaconazole	100	80.2 ± 7.9 a	74.5 ± 9.1 a	68.6 ± 5.7 a
	0.5% H + 4% GLP	100	82.6 ± 3.8 a	76.7 ± 4.2 a	74.9 ± 2.5 a
Luyuan 502	4% GLP	100	30.5 ± 2.6 d	29.3 ± 1.8 c	28.6 ± 2.4 c
	8% GLP	100	39.3 ± 2.8 c	35.4 ± 2.3 b	34.7 ± 3.1 b
	0.5% Hexaconazole	100	49.2 ± 2.6 b	41.5 ± 2.5 b	37.8 ± 3.5 b
	1% Hexaconazole	100	80.4 ± 3.5 a	71.5 ± 3.5 a	65.4 ± 2.5 a
	0.5% H + 4% GLP	100	81.5 ± 4.2 a	73.6 ± 3.2 a	67.1 ± 2.9 a

Note: 0.5% H + 4% GLP stands for the combination of hexaconazole with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

). The 21 d control effects still reached 55.3%, 68.6% and 65.4%. The bioinhibitor GLP was used alone to treat the wheat seed, and its effect on the root rot was minimal, respectively. The control effect of the bioinducing agent GLP and the fungicide hexaconazole mixed seed dressing was significantly higher than the single agent treatment. 0.5% hexaconazole and 4% GLP were mixed, and the 7 d control effects on the three cultivated varieties were 79.4%, 82.6% and 81.5%, respectively. The 21 d control effects were 61.5%, 74.9% and 67.1%, respectively. Both were significantly higher than the 0.5% hexaconazole seed dressing.

Zhengdan 958, Xianyu 335 and Luning 202 were treated with 40% prochloraz, the 7 d control effects on the maize stem rot were 88.8%, 82.9% and 76.2%, respectively (

Table 11. Control effect of seed treatment on maize stalk rot.

Maize Cultivated Variety	Agentia	Dosage (g a.i./100 kg Seed)	Control Effect (%)
			7 d	14 d	21 d
Zhengdan 958	15% GLP	100	29.5 ± 3.6 d	27.8 ± 2.1 d	26.2 ± 2.4 d
	30% GLP	100	37.6 ± 1.9 c	34.8 ± 1.9 c	32.2 ± 2.3 c
	20% Prochloraz	100	68.8 ± 3.5 b	55.6 ± 3.4 b	49.3 ± 5.6 b
	40% Prochloraz	100	88.8 ± 7.8 a	75.9 ± 6.9 a	60.6 ± 7.8 a
	20% P + 15% GLP	100	84.2 ± 7.7 a	75.6 ± 2.4 a	67.9 ± 4.1 a
Xianyu 335	15% GLP	100	30.2 ± 1.8 d	26.5 ± 1.7 d	23.2 ± 1.7 d
	30% GLP	100	39.7 ± 2.4 c	37.6 ± 1.2 c	34.9 ± 2.6 c
	20% Prochloraz	100	68.2 ± 3.7 b	53.1 ± 4.2 b	46.2 ± 3.1 b
	40% Prochloraz	100	82.9 ± 3.7 a	74.4 ± 2.7 a	65.2 ± 3.7 a
	20% P + 15% GLP	100	80.8 ± 3.9 a	73.8 ± 6.7 a	65.1 ± 3.4 a
Luning 206	15% GLP	100	27.3 ± 2.5 d	23.2 ± 2.1 c	21.6 ± 2.3 c
	30% GLP	100	38.8 ± 2.3 c	36.4 ± 1.7 b	35.1 ± 1.2 b
	20% Prochloraz	100	53.5 ± 3.8 b	37.6 ± 3.6 b	32.9 ± 3.7 b
	40% Prochloraz	100	76.2 ± 2.1 a	62.5 ± 3.7 a	56.2 ± 4.5 a
	20% P + 15% GLP	100	73.7 ± 3.5 a	70.7 ± 2.6 a	61.9 ± 3.4 a

Note: 20% P + 15% GLP stands for the combination of prochloraz with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

). The 21 d control effects were down to 60.6%, 65.2% and 56.2%. The control efficiency of three maize varieties was less than 40% when treated with biological inhibitor GLP alone. 20% prochloraz and 15% GLP were applied to the seeds of the three cultivated varieties. The 7-day control effect of the disease was 84.2%, 80.8% and 73.7%, respectively, significantly lower than the 40% prochloraz. However, the control effect after 21 days was still 67.9%, 65.1% and 61.9%, respectively, and the duration of effect was longer.

3.5. Field Control Effect of Seed Treated on Wheat Sharp Eyespot, Wheat Root Rot and Maize Stalk Rot

Field trials performed through two years demonstrated that all treatments reduced disease severity and provided substantial disease control. We observed that the use of GLP seed dressing had a weak effect on wheat sharp eyespot and wheat root rot, which was approximately 35%. The field control effects of the hexaconazole seed dressing on wheat sharp eyespot and wheat root rot in the early stage of wheat growth was approximately 80%. However, with the gradual reduction of the chemical agent alone over time. The combination of the GLP and a relatively low dose of hexaconazole provided good control of wheat sharp eyespot, and it has a long period of validity. The control effect on wheat sharp eyespot in the early winter wheat period is greater than 77%. In the wheat filling stage, the effect of the combined seed dressing on the sharp eyespot is still more than 40%, which is higher than the double dose of hexaconazole seed dressing (

Table 12. Field control effect of seed treated on wheat sharp eyespot and wheat root rot.

Year	Wheat Cultivated Variety	Agentia Treatment (100 mL/100 kg Seed)	Wheat Sharp Eyespot			Wheat Root Rot
			Before Overwintering	Jointing Stage	Filling Period
2017–2018	Jimai 22	CK	/	/	/
		8% GLP	38.6 ± 1.7 b	28.4 ± 1.9 c	21.3 ± 0.6 d	36.2 ± 2.2 b
		1% Hexaconazole	80.6 ± 2.3 a	58.4 ± 2.1 b	38.6 ± 2.4 b	81.3 ± 4.9 a
		0.5% H + 4% GLP	78.7 ± 2.5 a	68.2 ± 4.2 a	42.4 ± 4.5 a	75.9 ± 3.7 a
	Shannong 23	CK	/	/	/	c
		8% GLP	35.7 ± 1.5 b	26.9 ± 1.1 d	19.8 ± 1.7 d	32.8 ± 11.9 b
		1% Hexaconazole	81.3 ± 2.5 a	62.4 ± 3.2 b	39.2 ± 2.6 b	79.6 ± 3.8 a
		0.5% H + 4% GLP	78.8 ± 2.4 a	67.3 ± 2.7 a	42.8 ± 2.8 a	75.3 ± 4.1 a
	Luyuan 502	CK	/	/	/
		8% GLP	32.7 ± 1.2 b	29.3 ± 1.5 c	20.9 ± 1.2 d	36.4 ± 3.3 b
		1% Hexaconazole	80.5 ± 5.7 a	63.2 ± 4.4 b	30.3 ± 1.8 b	70.6 ± 2.9 a
		0.5% H + 4% GLP	79.6 ± 5.2 a	70.4 ± 1.9 a	41.9 ± 2.3 a	73.3 ± 3.1 a
2018–2019	Jimai 22	CK	/	/	/
		8% GLP	36.3 ± 1.6 b	26.2 ± 1.4 d	20.8 ± 1.7 d	40.2 ± 1.1 b
		1% Hexaconazole	76.9 ± 2.5 a	56.3 ± 2.1 b	35.6 ± 2.3 b	85.8 ± 7.6 a
		0.5% H + 4% GLP	75.8 ± 2.8 a	63.3 ± 2.9 a	41.7 ± 3.2 a	80.5 ± 5.2 a
	Shannong 23	CK	/	/	/	c
		8% GLP	37.9 ± 0.4 b	32.2 ± 1.7 d	24.2 ± 0.9 b	30.4 ± 2.4 b
		1% Hexaconazole	80.3 ± 4.1 a	64.5 ± 3.5 b	40.2 ± 3.3 a	79.2 ± 6.6 a
		0.5% H + 4% GLP	78.9 ± 7.2 a	69.2 ± 4.9 a	43.7 ± 1.7 a	72.4 ± 3.3 a
	Luyuan 502	CK	/	/	/
		8% GLP	35.6 ± 2.1 b	30.2 ± 1.4 c	22.7 ± 1.7 c	34.2 ± 2.9 b
		1% Hexaconazole	81.4 ± 3.8 a	61.2 ± 2.2 b	29.8 ± 1.9 b	75.8 ± 4.1 a
		0.5% H + 4% GLP	77.1 ± 5.1 a	72.7 ± 3.6 a	40.6 ± 1.2 a	70.6 ± 5.2 a

Note: 0.5% H + 4% GLP stands for the combination of hexaconazole with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

).

GLP treatment of maize stalk rot in the field indicated that the GLP treatment has effects on maize stalk rot. For example, the effect of high-dose prochloraz on maize stalk rot was 76~82% on 30 July 2017 and 30 July 2018. On 20 August, the effect of prochloraz on maize stalk rot was approximately 60%. With the passing of time, the effect of prochloraz on the control of maize stem rot was significantly reduced by 21.1~26.8%. A low-dose combination of prochloraz and Ganoderma lucidum is highly effective at controlling maize stem rot, and its effect is not significantly different from the high dose of prochloraz. In summary, GLP has broad application prospects to prevent and control maize diseases (

Table 13. Field control effect of seed treatment on maize stalk rot.

Year	Maize Cultivated Variey	Agentia	Dosage (mL/100 kg Seed)	Control Effect (%)
				30 July	20 August
2017	Zhengdan 958	30% GLP	100	32.5 ± 2.5 b	24.7 ± 1.9 b
		40% Prochloraz	100	76.4 ± 5.2 a	59.8 ± 4.3 a
		20% P + 15%GLP	100	73.2 ± 4.1 a	56.2 ± 5.7 a
	Xianyu 335	30% GLP	100	33.9 ± 2.6 b	25.7 ± 2.4 b
		40% Prochloraz	100	75.5 ± 1.9 a	57.2 ± 4.3 a
		20% P + 15% GLP	100	76.4 ± 2.8 a	60.1 ± 5.3 a
	Luning 206	30% GLP	100	35.9 ± 1.9 b	34.2 ± 1.4 b
		40% Prochloraz	100	75.3 ± 3.5 a	54.4 ± 2.8 a
		20% P + 15% GLP	100	74.1 ± 2.7 a	52.5 ± 1.6 a
2018	Zhengdan 958	30% GLP	100	38.2 ± 1.5 b	29.7 ± 2.1 b
		40% Prochloraz	100	71.6 ± 4.6 a	55.3 ± 3.1 a
		20% P + 15% GLP	100	79.5 ± 6.2 a	61.4 ± 2.8 a
	Xianyu 335	30% GLP	100	36.5 ± 2.9 b	24.7 ± 1.4 b
		40% Prochloraz	100	80.6 ± 7.3 a	60.5 ± 5.2 a
		20% P + 15% GLP	100	73.3 ± 4.8 a	53.2 ± 2.9 a
	Luning 206	30% GLP	100	36.1 ± 1.7 b	25.4 ± 0.6 b
		40% Prochloraz	100	78.2 ± 4.8 a	56.3 ± 2.2 a
		20% P + 15% GLP	100	82.6 ± 2.2 a	50.8 ± 2.7 a

Note: 20% P + 15% GLP stands for the combination of prochloraz with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

).

3.6. Effects of Chemical Seed Treatment on the Yield of Wheat and Maize

After two years of field experiments, we concluded that the yield of wheat and maize could be improved by the combination of the GLP polysaccharide, the chemical fungicides and the combination of the two treatments. The effect of the GLP seed dressing alone on yield was less than that of chemical agent, while the combination of GLP and a low dose of fungicide could significantly increase crop yield and had more pronounced effects on the yield of wheat. 0.5% GLP and 4% prochloraz were combined to treat the wheat seed of the cultivars Jimai 22, Shannon 23 and Luyuan 502. In 2017 and 2018, the yield was 7692.84 and 7128.60, 7910.40 and 6979.35, and 7722.90 and 6535.20 kg·hm⁻², respectively. These values were significantly higher than those of the other treatments (

Table 14. Effects of chemical seed treatment on the yield of wheat and maize.

	Cultivated Variety	Treatment	Dosage (mL/100 kg Seed)	Yield (kg·hm−2)
				2017	2018
Maize	Zhengdan 958	CK	100	8233.80 b	8193.75 c
		30% GLP	100	8344.05 ab	8252.10 bc
		40% Prochloraz	100	8555.70 a	8584.35 a
		20%P + 15% GLP	100	8582.85 a	8526.45 ab
	Xianyu 335	CK	100	8252.25 b	8440.95 b
		30% GLP	100	8406.45 ab	8549.10 b
		40% Prochloraz	100	8631.30 a	8849.10 a
		20%P + 15% GLP	100	8624.25 a	8890.20 a
	Luning 202	CK	100	7596.60 b	7865.55 b
		30% GLP	100	7652.70 ab	8125.80 ab
		40% Prochloraz	100	7931.25 a	8503.80 a
		20%P + 15% GLP	100	7953.90 a	8577.90 a
Wheat	Jimai 22	CK	100	7248.60 b	6253.95 b
		8% GLP	100	7344.45 ab	6604.80 ab
		1% Hexaconazole	100	7554.25 ab	6454.05 b
		0.5% H + 4% GLP	100	7692.84 a	7128.60 a
	Shannong 23	CK	100	7362.45 b	6224.40 b
		8% GLP	100	7492.05 ab	6610.20 ab
		1% Hexaconazole	100	7624.35 ab	6440.55 ab
		0.5% H + 4% GLP	100	7910.40 a	6979.35 a
	Luyuan 502	CK	100	7210.95 b	5950.95 b
		8% GLP	100	7338.75 ab	6318.75 ab
		1% Hexaconazole	100	7522.05 ab	6277.90 ab
		0.5% H + 4% GLP	100	7722.90 a	6535.20 a

Note: 0.5% H + 4% GLP stands for the combination of hexaconazole with GLP. Different lowercases in the same column indicate significantly different at p < 0.05 level according to Duncan’s multiple range tests.

).

3.7. Effect of Seed Treated GLP on Transcript Quantity of Wheat and Maize Disease Resistance-Related Gene

The relative expression level of the broad-spectrum disease resistance-related gene WMS533, resistance to sharp eyespot gene Xwmc364, and the resistance to sharp eyespot related gene RS33 after treatment with 4% GLP was 3.9, 4.5, and 5.8, respectively. 8% GLP-treated of the mitogen-activated protein (MAP) kinase analog gene IR6, the broad-spectrum disease-resistant gene WMS533, resistance to sharp eyespot gene-linked primer Xwmc364, the relative expression levels of the gene NbPR1a and the wheat sharp eyespot resistance gene RS33 were 5.3, 5.8, 3.7, 5.1 and 6.9, respectively, indicating a high level. Different doses of GLP seed dressing have different effects on the expression of resistance genes related to Jimai 22. In general, GLP can induce the expression of the broad-spectrum disease resistant-related gene WMS533 and wheat resistance to the wheat sharp eyespot-related gene RS33. The amount is also significantly increased as the treatment dose is increased. In addition, a high dose of GLP can significantly induce the expression of the mitogen-activated protein (MAP) kinase analog gene IR6 and the pathogenesis-related gene NbPR1a, which may be more significant at inducing wheat resistance to wheat with the high dose of GLP. There is a close relationship between the diseases (Figure 3).

Leaf tissue from 15% and 30% GLP-treated maize seedlings was collected to investigate the expression of resistance-related genes in maize seedlings. The results showed that maize treated with GLP had the greatest influence on the TPS and WRKY53 genes in Zhengdan 958. After seed dressing by 15% and 30% GLP, the relative expression of the TPS and WRKY53 genes was 3.5 and 6.2, and 5.3 and 6.8, respectively. We also detected an increase in the expression levels of genes such as CHITc, TPS21, TPC, and JAR1 (Figure 4).

4. Discussion

The North China Plain is an important grain producing area in China, and the primary planting method is winter wheat and summer maize [35]. Wheat sharp eyespot, which is primarily caused by R. cerealis, wheat root rot, which is primarily caused by D. sorokiniana, and maize stalk rot, which is primarily caused by F. graminearum, are systemic soil-borne diseases that seriously endanger the production of wheat and maize [11,12,36].

Hexaconazole is a triazole fungicide widely used internationally due to its wide spectrum of sterilization and low risk of drug resistance [37]. It is effective at controlling wheat scab and is widely used. Prochloraz is a popular imidazole fungicide that inhibits the biosynthesis of ergosterol, which is part of the cell membrane in many fungi [38]. Due to its high biological activity against F. verticillioides, prochloraz is used as a foliar spray to control maize diseases in the major maize producing regions in China. Our previous research reported a (1~3) β-D-glucan, which can induce the activity of protective enzymes, increase the content of chlorophyll, induce the gene expression of the salicylic acid pathway and act as a broad-spectrum resistance-related pathway to induce resistance against wheat sharp eyespot [32].

Throughout this experiment, we concluded that hexaconazole has strong antifungal effects on wheat sharp eyespot and wheat root rot, and prochloraz is more effective against the maize stem rot pathogen. The seed treatment of the two pesticides has a good control effect on the soil-borne diseases in the seedling stage of plants. Meanwhile, we concluded that the GLP can increase the germination rates and seedling heights of maize and wheat, and exists in all three selected cultivated varieties. When GLP is combined with fungicides to treat wheat and maize seeds, this promotion still exists.

Interestingly, we concluded that GLP does not have any antifungal activity against soil-borne fungi. However, when the seeds are treated with GLP, they can control the soil-borne diseases by approximately 35% in greenhouse potting and field control experiments. Previous studies demonstrated that biological elicitors could control plant diseases by stimulating plants disease resistance, even if they have no obvious fungicidal effect [39]. When the plants are stimulated by biological agonists, they usually change factors, such as the deposition of callose, the synthesis of defense enzymes, reinforcement of the plant cell wall associated with phenyl propanoid compounds, and the accumulation of pathogenesis-related (PR) proteins to protect against pests and diseases [40]. There were reports that seaweed polysaccharides, such as ulvans, alginates, fucans, laminarin, carrageenans, and their derived oligosaccharides, can induce an initial oxidative burst and the activation of SA, JA and/or ethylene signaling pathways in terrestrial plants [1,41]. The activation of these signaling pathways leads to an increase in the expression of PR proteins that have antifungal and antibacterial activities and lead to an increased expression of defense enzymes that participate in the synthesis of PPCs, terpenes, terpenoids and alkaloids with antimicrobial activities [42].

Therefore, we hypothesize that GLP increases resistance to maize stalk rot by affecting the expression of the TPS and WRKY53 genes in maize. GLP achieves resistance to wheat sharp eyespot and wheat root rot by increasing the relative expression of the broad-spectrum disease resistance-related gene WMS533, the disease-related gene NbPR1a, and the wheat resistance-resistance related gene RS33.

Combined with greenhouse pot and field control experiments, we concluded that the effect of GLP alone on wheat sharp eyespot, wheat root rot, and maize stem rot is approximately 35%. It is lower than the control effect of the chemical fungicides hexaconazole and prochloraz. However, we concluded that GLP seed dressing enhances the control effect of the chemical fungicides. When GLP is combined with low-dose hexaconazole or prochloraz in the treatment of wheat or maize seeds, the effect of prevention and control of soil-borne diseases in the early stage of paper growth is approximately 70%, the same degree of control that results from twice the dose of hexaconazole or prochloraz. Over time, the combination of the GLP and low-dose fungicides effectively controls wheat sharp eyespot and maize stem rot, even more than the control effect of the double dose of hexaconazole and prochloraz.

This has strong implications for reducing the use of pesticides. The increase in the dose of the pesticide and the increasing frequency of the use of pesticides leads to the increasing drug resistance of pathogens, resulting in a vicious cycle of increasing drug consumption and plant diseases [43]. GLP can help to solve this problem. First, GLP combined with chemical seed dressings effectively simultaneously prevented plant diseases and reduced the dose of chemicals. Second, GLP and chemical combined seed dressings prolonged the control period, thus reducing the frequency of the use of chemical pesticides. Biological inducers can induce disease resistance in plants, but the control effect on diseases is between 20% and 80% [39]. In many cases, bioinducing agents are less effective at controlling diseases than chemical fungicides. The combination of fungicides and bioinducing agents can enhance the control effect on diseases. The reasons for this are two-fold. First, it takes a certain time for the bioinducing agent to induce disease resistance in the plants. Conventional fungicides can inhibit the growth of pathogenic fungi before the plants develop disease resistance. Second, chemical fungicides have been found very effective in reducing the pathogenicity of the pathogenic fungi [44]. The ability to induce resistance in plants makes it easier to control pathogens, and therefore, reduces the amount of chemical fungicides used and the number of uses [45].

In addition, we found that GLP combined with fungicide can increase crop yield. Field results in 2017 showed that the yield of the combined application of fungicides and GLP by half was equivalent to that of fungicides and GLP, and both were significantly higher than the control. The 2018 results were basically the same as 2017. Only the combined treatment of Xianyu 336 (maize cultivated variety) was significantly higher than the GLP treatment, and the combined treatment of Jimai 22 (wheat cultivated variety) was higher than the fungicide treatment. These findings are consistent with those of Naz, et al., who reported that botanical-chemical formulations protected against B. sorokiniana and enhanced yield in wheat. We speculate that this is due to the fact that GLP promotes plant health and is combined with fungicides to improve disease prevention effects. In addition, in field trials, we also found that maize rough dwarf virus and maize dwarf mosaic virus were less susceptible to GLP seed dressing plots.

5. Conclusions

In short, we studied the control effects of GLP on three soil-borne diseases in wheat and maize rotation region of North China Plain through the greenhouse and in a field trial, and found that GLP could induce resistance of wheat and maize to soil-borne diseases. GLP seed mixing could reduce pesticide dosage and increase crop yield. Based on previous studies, we hypothesized that GLP improves disease resistance by affecting the expression of related genes in maize and wheat. These results provide a reference for the wide application of GLP in disease prevention and treatment.