Effects of Metal Oxide Nanoparticles on Nitrous Oxide Emissions in Agriculture Soil

Abstract

Metal oxide nanoparticles (NPs) have been widely used in industrial and agricultural production and introduced into soils. The impact of these nanoparticles on soil nitrous oxide (N₂O) emission is unclear. We conducted a microcosm experiment to investigate the effects of titanium oxide nanoparticles (TiO₂ NPs), copper oxide nanoparticles (CuO NPs), and aluminum oxide nanoparticles (Al₂O₃ NPs) on soil N₂O emissions and the abundance of functional genes related to N₂O production/reduction. Compared to the soil without NPs addition, TiO₂ NPs applied to the soil produced no significant effect on N₂O emissions. The denitrification process in the soil exposed to CuO NPs was inhibited by reducing the functional genes related to nitrite reductase (nirK) and increasing N₂O reductase (nosZ), while CuO NPs added to the soil stimulated the cumulative N₂O emissions by 92.7%. After the application of Al₂O₃ NPs to the soil, the nitrification process was inhibited by inhibiting the functional genes of ammonia-oxidizing bacteria (AOB amoA), and soil N₂O emission was reduced by 48.6%. Large-scale application of CuO NPs in agricultural soils may stimulate the N₂O emissions resulting in potential environmental risks.

1. Introduction

Nanotechnology is a prominent technology in various fields such as electronic, electrical, optical, sensing, food, and biomedical. Engineered nanoparticles (NPs) can be broadly defined as manufactured particles with at least one dimension between 1 and 100 nm. These tiny particles have specific physical, optical, chemical, and mechanical characteristics, which make them useful in comparing their bulk compounds [1,2,3]. Metal oxide NPs are increasingly used in many fields and have a wide range of applications from industries to drug delivery [4]. Titanium oxide nanoparticles (TiO₂ NPs) have the highest output of NPs. Annual production of TiO₂ NPs in 2012 reached 10,000 tons worldwide, and they are widely used in sunscreens, cosmetics, antimicrobial agents, and nano fertilizers [5,6]. Copper oxide nanoparticles (CuO NPs) are widely used in agriculture systems as fungicides, insecticides, herbicides, fertilizers, and plant growth regulators [7]. Aluminum oxide nanoparticles (Al₂O₃ NPs) are widely used in absorbent materials, antibacterial materials, and abrasive materials [8]. Soil is an important sink of nanoparticles as the consumption of nanomaterials increases yearly, and these nanoparticles directly affect the soil microbes and their closely related nutrient cycling [9]. The cobalt oxide nanoparticles applied to the forest soil significantly stimulated the activities of the enzyme involved in nitrogen mineralization [10]. Silver under AgNPs exposure in soil was transferred and accumulated from Folsomia candida to Hypoaspis aculeifer and disturbed the transfer of the major nutrient N [11]. Nanoparticles released into soils not only affect soil nutrient cycling but also affect the emission of greenhouse gases such as nitrous oxide and influence global climate change [12,13].

Nitrous oxide (N₂O), an important greenhouse gas, is a contributor to global warming, with 298 times the global warming potential of carbon dioxide (CO₂) on a 100-year time scale [14]. Ecosystem processes play an important role in N₂O emissions, with the agricultural system estimated to have emitted 2.7 Gt year⁻¹ for N₂O [15]. Nitrifiers and denitrifiers have key roles in N₂O emissions from agricultural soils [16]. Nitrification is the process in which nitrifiers convert ammonia to nitrate nitrogen, and N₂O is generated in the process of hydroxylamine oxidation (NH₂OH→NOH→N₂O) [17]. Denitrification is a process in which denitrifiers convert nitrate to nitrogen, and N₂O is produced during the reduction of nitric oxide to nitrogen (NO₃⁻→NO₂⁻→NO→N₂O→N₂) [18]. Different types of NPs directly affect the nitrification and denitrification processes in soil and affect the emission of N₂O [19]. Silver (Ag) NPs applied to soils can significantly reduce soil microbial metabolic activity and nitrification potential, while iron oxide (FeO) NPs positively affect nitrification potential in agricultural soil [20]. Ag NPs inhibit ammonia monooxygenase (amoA) gene expression of nitrifiers from reducing the nitrification rate in the aquatic environment, but low-dose Ag NPs directly stimulate N₂O emission by increasing hydroxylamine oxidation [21]. Cu NPs increase the N₂O reductase encoding by the nosZ gene of denitrifiers to reduce the release of N₂O in activated sludge [22]. Ag NPs inhibit the denitrification process by decreasing the nosZ and nirS gene abundance of denitrifiers in sediments at Dagu River Estuary and Jiaozhou Bay, China, resulting in the accumulation of inorganic nitrogen and N₂O release [23]. Application of zinc oxide (ZnO) NPs in agriculture soil stimulated N₂O emissions by affecting both soil microbial nitrification and denitrification processes [24]. The different responses of nitrifiers and denitrifiers to nanoparticles vary with nanoparticle type and soils. We do not know the mechanisms of different nanoparticles influencing N₂O emissions in the same soil.

As the human-controlled “processes”, many NPs applied to agricultural ecosystems as nanofertilizers, nanopesticides, and nanobiosensors for sustainable development [25]. Additionally, the agricultural systems often receive large amounts of chemical fertilizers to increase crop yields [26]. Soils enriched with nitrogen substrates such as urea can directly change the behaviors of NPs [27]. Organic fertilizers applied to soils directly enhanced the iron (Fe) bioavailability released by ironic oxide nanoparticles, resulting in a decrease in the number of soil microorganisms [28]. Compared to the soils without ZnO NPs, the total N₂O emissions in the presence of different ZnO NP concentrations increased by 6.28–8.35-fold following both carbon and nitrogen substrate amendments [24]. The large quantities of metal oxide NPs in agricultural soils may increase N₂O emissions, contributing to global climate warming. In this study, we conducted a microcosm experiment in which three NPs (TiO₂, CuO, and Al₂O₃) were applied to the soil without unlimited carbon and nitrogen substrates, and the influence of the different NPs on N₂O emissions was quantified to investigate the potential environmental risks of NPs input to agriculture soil. We hypothesized that in agricultural soil without carbon and nitrogen constraints, NPs mainly affect N₂O emissions by affecting the denitrification process, and the effect varies with NP types.

2. Materials and Methods

2.1. Studied Soil and Nanoparticles

The uncontaminated soil was collected from the surface layer (0–20 cm) of paddy soil in the suburbs of Wuhan (114°26′ N, 30°19′ E), China. The soil was air-dried and then sieved through a 2 mm mesh to remove visible roots and stones for the incubation experiment. According to the standard of the World Reference Base for Soil Resources (WRB), the soil texture was silty clay loam with pH of 6.75, and the total organic carbon and nitrogen were 12.4 and 1.4 g kg⁻¹, respectively. The TiO₂, CuO, and Al₂O₃ NPs were purchased from Aladdin Reagent (Shanghai) Co., LTD (Shanghai, China). According to the vendor, the nanoparticles had a purity >99% and particle size <100 nm.

2.2. Microcosm Setup

We selected three types of nanoparticles, TiO₂ NPs, CuO NPs, and Al₂O₃ NPs. The exposure concentration of each was 500 mg kg⁻¹, representing an accidental spill [29]. A total of 15 g of soil (dry weight) was put into a 120 mL brown serum flask, and the nanoparticles were mixed into the soil evenly. Deionized water was added to keep the soil water content at 60% of the field water holding capacity. Each treatment had three replicates, and the brown serum flasks were cultured at 25 °C for two weeks. We dissolved glucose and (NH₄)₂SO₄ in deionized water and sprinkled the glucose and (NH₄)₂SO₄ solution evenly onto the soil with a 1 mL syringe. The glucose concentration was 600 mg C kg⁻¹, equal to 100% microbial biomass C in the tested soil. The (NH₄)₂SO₄ concentration was 56.4 mg N kg⁻¹, equivalent to 142.2 kg ha⁻¹ field nitrogen application. At the end of the microcosm incubation, all the soil was destructively sampled for further analysis.

2.3. N₂O Measurement

During the incubations, gas samples were collected at 1, 3, 5, and 7 days to measure the N₂O emission rate and cumulative rate. A modified gas chromatograph (Agilent 7890B, Agilent, Palo Alto, CA, USA) equipped with an electron capture detector (ECD) was used to measure the N₂O concentration by injecting 100 μL samples. The temperatures of the oven, injection port, and detector were 60, 340, and 340 °C, respectively.

2.4. Soil NH₄⁺, NO₃⁻, and DOC Measurement

Inorganic nitrogen (NH₄⁺ and NO₃⁻) was extracted by 2 mol L⁻¹ KCl (v/v = 1:5) shaken for 1 h, and then the mixture was filtered with quantitative filter papers. The concentration of ammonia-nitrogen (NH₄⁺) and nitrate-nitrogen (NO₃⁻) were measured using a flow analyzer (Skalar SAN++ System, Skalar Analytical B.V., Breda, The Netherlands). Dissolved organic carbon (DOC) was extracted by 0.5 mol L⁻¹ K₂SO₄ using a solid: water ratio of 1:5 (w/v) on a dry weight basis and shaken at 200 rpm for 1 h at 20 °C on a reciprocal shaker. The suspension was centrifuged at 3500 rpm for 10 min, and the supernatant was filtered through a 0.45 μm membrane filter. The concentration of DOC was measured by a total organic carbon analyzer (Multi-N/C 2100S; Analytik Jena, Jena, Germany).

2.5. DNA Extraction and Real-Time PCR Quantification

Soil microbial DNA was extracted using a FastDNA^® SPIN Kit for Soil (MP Biomedicals, Santa Ana, CA, USA) according to the manufacturer’s directions. The quantity of DNA was determined by a NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA).

The qPCR amplification was performed on a Light-Cycler Roche 480 instrument (Roche Molecular Systems, Switzerland). The reaction system had a total volume of 20 μL, including 10 μL Go Taq qPCR master mix (Promega, Madison, WI, USA), 0.4 μL forward and reverse primers (10 mM), and 1 μL template DNA. Ammonia monooxygenase (amoA) gene abundance of archaea (AOA) and bacteria (AOB) involved in the nitrification process was amplified. The abundance of functional genes encoding nitrite reductase (nirK and nirS) and N₂O reductase (nosZ) was amplified. The qPCR reaction conditions of the different functional genes are seen in

Table 1. Primers of nitrification functional genes (AOA amoA and AOB amoA) and denitrification functional genes (nirK, nirS, and nosZ) and their thermal cycling conditions for qPCR reaction.

Gene	Primers	Pair Primer Sequences	Amplification Condition	Reference
AOA- amoA	CrenamoA23f CrenamoA616r	ATGGTCTGGCTWAGACG GCCATCCATCTGTATGTCCA	95 °C–15 s, 53 °C–45 s, 72 °C–45 s, 83 °C–15 s, 45 cycles	[30]
AOB- amoA	amoA-1F amoA-2R	GGGGTTTCTACTGGTGGT CCCCTCKGSAAAGCCTTCTTC	95 °C–15 s, 54 °C–40 s, 72 °C–45 s, 84 °C–15 s, 45 cycles	[30]
nirK	nirK-F1aCu nirK-R3Cu	ATCATGGTSCTGCCGCG GCCTCGATCAGRTTGTGGTT	95 °C–10 s, 53 °C–45 s, 72 °C–45 s, 86 °C–15 s, 45 cycles	[31]
nirS	nirS-Cd3aF nirS-R3cd	GTSAACGTSAAGGARACSGG GASTTCGGRTGSGTCTTGA	95 °C–15 s, 50 °C–45 s, 72 °C–45 s, 88 °C–15 s, 50 cycles	[32]
nosZ	nosZ-F nosZ-1662R	CGYTGTTCMTCGACAGCCAG CGSACCTTSTTGCCSTYGCG	95 °C–15 s, 50 °C–30 s, 72 °C–30 s, 83 °C–15 s, 55 cycles	[32]

.

2.6. Statistical Analysis

SPSS 20.0 (SPSS LNC., Chicago, IL, USA) was used for one-way ANOVA. Redundancy Analysis (RDA) was performed by CANOCO 4.5 (Ithaca, NY, USA).

3. Results

3.1. N₂O Emissions Affected by Different Nanoparticles

In all the soils, regardless of nanoparticle type, the N₂O emission rate peaked on the first day and then gradually leveled off. Compared with the control treatment (tested soil without nanoparticles addition), TiO₂ NPs slightly promoted the emission rate of N₂O in the soil (Figure 1) on the first day, but the TiO₂ NPs had no significant effect on soil N₂O accumulation after the incubation (p > 0.05, Figure 2). CuO NPs applied to the soil significantly promoted N₂O emission compared to the control treatment (CK) and increased soil N₂O cumulative emissions by 92.7% compared to the control treatment (p < 0.05, Figure 2). Different from the TiO₂ NPs and CuO NPs application, the N₂O emission rate (90.66 μg N kg⁻¹ d⁻¹) in the soil was significantly inhibited by Al₂O₃ NPs application compared to the soil without NPs addition. Al₂O₃ NPs reduced soil N₂O cumulative emissions by 48.6% after 7 days of incubation.

3.2. Effects of Different Nanoparticles on Soil DOC, NH₄⁺, and NO₃⁻ Contents

Compared to the control, the application of TiO₂ NPs and CuO NPs in soils had no significant effect on soil DOC content (p > 0.05,

Table 2. Soil dissolved organic carbon (DOC), ammonium (NH₄⁺), and nitrate (NO₃⁻) contents in different nanoparticles treatments.

Nanoparticles	DOC (mg C kg−1)	NH4+ (mg N kg−1)	NO3− (mg N kg−1)
CK	47.70 ± 7.47 a	22.93 ± 0.38 b	0.43 ± 0.06 a
TiO2 NPs	52.10 ± 1.56 a	23.90 ± 0.47 ab	0.45 ± 0.07 a
CuO NPs	47.30 ± 2.05 a	21.03 ± 0.46 c	0.45 ± 0.04 a
Al2O3 NPs	30.40 ± 3.34 b	23.25 ± 0.39 b	0.25 ± 0.04 b

Note: different letters indicate statistically significant differences (p < 0.05).

), but the input of Al₂O₃ NPs significantly reduced soil DOC content (p < 0.05). Compared to the control, the application of TiO₂ NPs and Al₂O₃ NPs in soils had no significant effect on the soil NH₄⁺ content (p > 0.05, Table 2), but the input of CuO NPs significantly reduced soil NH₄⁺ content (p < 0.05). Compared to the control, the application of TiO₂ NPs and CuO NPs in soils had no significant effect on the soil NO₃⁻ content (p > 0.05, Table 2), but the input of Al₂O₃ NPs significantly reduced soil NO₃⁻ content (p < 0.05).

3.3. Effects of Nanoparticles on Soil Microbial Functional Gene Abundance

Different nanoparticle types added to soil showed different effects on the abundance of nitrification genes (Figure 3a,b). The copies of AOA amoA and AOB amoA in the soil without addition were 5.49 × 10⁴ and 3.59 × 10³, respectively. TiO₂ NPs and CuO NPs in the soils did not affect the abundance of AOA amoA genes (p > 0.05), while Al₂O₃ NPs in the soil significantly inhibited AOA amoA gene abundance (Figure 3a, p < 0.05). After TiO₂ NPs and Al₂O₃ NPs were applied to soil, the abundance of the AOB amoA gene was significantly reduced to 2.24 × 10³ and 2.46 × 10³ copies g⁻¹ soil (p < 0.05), respectively. However, CuO NPs applied to soil had no significant effect on the abundance of the AOB amoA gene.

Different types of nanoparticles resulted in different abundances of functional genes related to denitrification (Figure 3c–e). The copies of nirK, nirS, and nosZ genes in soil without nanoparticle addition were 3.73 × 10⁴, 2.16 × 10⁵, and 1.76 × 10⁵, respectively. TiO₂ NPs applied to the soil significantly increased the abundance of the nirK gene (p < 0.05), while there was no effect on the abundance of the nirS and nosZ gene. CuO NPs applied to the soil significantly decreased the abundance of the nirK gene (p < 0.05), while the trend for the nosZ gene was the opposite, and there was no effect on the abundance of the nirS gene. Al₂O₃ NPs applied to the soil significantly promoted the abundance of the nirK, nirS, and nosZ genes (p < 0.05).

3.4. Correlation Analysis of Environmental Factors

Regression analysis showed that soil N₂O cumulative emissions were positively correlated with NO₃⁻ content while they were negatively correlated with NH₄⁺ content (p < 0.05, Figure 4).

4. Discussion

The effect of nanoparticles on N₂O emissions in the soil was mainly related to the nitrification and denitrification processes of soil microorganisms [12,33]. Compared to the soils with CuO NPs and Al₂O₃ NPs application, the soils with TiO₂ NPs addition showed an insignificant effect on N₂O emissions, while the functional gene abundance of nitrifiers and denitrifiers were both affected. Similarly, TiO₂ NPs reduced the abundance of ammonia-oxidizing microorganisms in the soil, while the denitrifying community was not suppressed by TiO₂ NPs exposure [34]. After the TiO₂ NPs were added to the clay-silty soil, the high concentration of TiO₂ NPs (500 mg kg⁻¹) reduced its toxicity to soil microorganisms [29]. N₂O emissions increased when CuO NPs were added to the soil, and CuO NPs inhibited the N₂O emissions by the denitrification process with the decreased gene abundance related to N₂O production (nirK) and the increased gene abundance related to N₂O reduction (nosZ). A previous study has shown that a high dose (500 mg kg⁻¹) of CuO NPs in the soil inhibited the denitrification process by reducing the activities of nitrate reductase and nitrous oxide reductase [35]. Guo et al. found that CuO NPs application inhibited the denitrification process of Pseudomonas aeruginosa, but it increased nitrite accumulation and N₂O emissions [36]. The application of Al₂O₃ NPs in wastewater inhibited the denitrification process and reduced the removal efficiency of total nitrogen [37]. Conversely, we found that the application of Al₂O₃ NPs in soil promoted the denitrification process by increasing the abundance of functional genes related to nitrite reductase (nirS) and N₂O reductase (nosZ). In addition, the decreased abundance of amoA gene in AOB indicated that the nitrification process was inhibited by Al₂O₃ NPs in the soil. Contrary to the original hypothesis, Al₂O₃ NPs might inhibit N₂O emissions by inhibiting the nitrification process [38]. The relationship between N₂O emissions and NO₃⁻ and NH₄⁺ also indicated that the N₂O emissions were positively related to the nitrification process.

The types and doses of nanoparticles applicated to soils also significantly affected the emissions of N₂O. The application of TiO₂ NPs increased the emission rates of N₂O in the soils, but the cumulative emissions were not significantly affected. Fan et al. found that there were no significant differences in N₂O emission fluxes 14 d after the application of TiO₂ NPs with different concentrations (10–1000 mg kg⁻¹) [39]. This may have been due to the formation of larger aggregates after the application of TiO₂ NPs in soil, especially at high concentrations, which reduced the number of nanoparticles entering microbial cells [40]. The application concentration of CuO NPs in the range of 10–500 mg kg⁻¹ significantly reduced the N₂O emission rates in the soil [35]. Conversely, we found that the CuO NPs significantly increased the soil N₂O emission when the concentration of CuO NPs reached 500 mg kg⁻¹. CuO NPs applied to soils increased the abundance of microorganisms involved in the nitrogen cycle, such as Nitrosomonas and Nitrospira, which are involved in the nitrification process, and Thermomonas and Flavobacterium that are involved in the denitrification process [41]. CuO NPs are toxic to soil microorganisms due to the release of Cu ions after soil application [42]. Increased activity of soil microorganisms in response to metal stress may be responsible for the increase in N₂O emissions in soils [43]. When the application content of Al₂O₃ NPs was 500 mg kg⁻¹, the cumulative emission of N₂O was significantly inhibited. Previous studies found that high concentration application of some metal-oxide nanoparticles such as ZnO NPs (50 mg kg⁻¹) and LiO₂ NPs (474 mg kg⁻¹) to soils reduced the emissions of N₂O [43,44]. The responses of nitrifiers and denitrifiers related to N₂O emitting varied with NPs’ type. In the agricultural system, subdividing the NPs’ type and subsequently balancing stability and toxicity should be taken into consideration to reduce nitrogen loss due to N₂O emissions.

The effect of nanoparticles on N₂O emissions in agricultural soils was influenced by agricultural management such as fertilization. To eliminate the limitation of carbon and nitrogen on soil N₂O emissions, glucose as the carbon substrate and ammonia sulfate as the nitrogen substrate were added after the end of pre-culture. This greatly stimulated the activities of soil microorganisms. N₂O emissions in sugar cane soil increased significantly in the first 20 d after the application of ammonia sulfate (100 kg N ha⁻¹) [45]. The application of ammonia sulfate fertilizer to vegetable soils promoted the denitrification process of nitrifying microorganisms [46]. In addition, the addition of glucose also increased soil respiration and then promoted the denitrification process [47]. These may be the main factors behind the significant increase in the rate of N₂O emissions from the soils during the first day. In addition, the particle sizes of nanoparticles also directly affected the toxicity of nanoparticles to soil microorganisms. As the particle size of nanoparticles increases, its toxic effect on microorganisms may weaken [48]. With the increase in particle size, the availability of metal ions released by nanoparticles in soils decreased because they were adsorbed by silicates or complexation by soil organic matter [49]. The particle sizes of metal oxide nanoparticles that we applied to soils at a relatively high concentration (500 mg kg⁻¹) were below 100 nm. This was done to explore their impacts on N₂O emissions, which were not subdivided into the nanoscales. Excessive metal oxide nanoparticles in soils led to the formation of large aggregates in the soil or complexation with soil organic matter, which can significantly reduce the toxicity to microorganisms but increase the persistence and risks of soil pollution [50]. In agricultural production, CuO NPs have been used as fertilizers and fungicides with large doses applied to soils [51,52], which directly pose environmental risks by increasing N₂O emissions.

In this study, we investigated the effects of three NPs applied to the soil on N₂O emissions and functional gene abundance related to N₂O production/reduction. However, the abundance of functional genes does not accurately measure microorganisms participating in nitrification and denitrification due to the greater significance of multiple environmental factors [53]. It is necessary to determine the activities of enzymes during the nitrogen cycle to clearly understand the impact of nanoparticles on the specific process of the nitrogen cycle. Additionally, it would be better to subdivide the application levels of nanoparticles in soils to explore the dose–effect relationships of nanoparticles on soil nitrogen cycling. These improvements may lead to a better understanding of the environmental behaviors of different NP in soils and their impacts on N₂O emissions.

5. Conclusions

In conclusion, we reported the effects of different metal-oxide nanoparticles applied to soils on N₂O emissions and functional gene abundances of nitrifiers and denitrifiers. The responses of nitrifiers and denitrifiers varied with NPs’ type resulting in different N₂O emissions. TiO₂ NPs in soils both affected the nitrification and denitrification processes but had no significant effect on N₂O emission. CuO NPs applied to the soil inhibited microbial denitrification but promoted N₂O emissions, and Al₂O₃ NPs applied to the soil reduced N₂O emissions by inhibiting the nitrification process. The application of different kinds of NPs in agriculture may increase the emission of agricultural soil N₂O, resulting in potential environmental risks. This study provides relevant data for greenhouse gas emissions from soil contaminated by nanoparticles. The internal mechanisms related to soil N₂O emissions could be further explored by combing microbial communities and enzyme activities related to nitrogen cycling.