Morphological and Molecular Characterization of a New Self-Compatible Almond Variety
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Morphological Characterization
2.3. Statistical Analysis
2.4. Preparation of Genomic DNA and Self-Compatibility Assay
2.5. SSR Analysis
| SSR marker | Ta | Sequence (5′-3′) | Reference |
|---|---|---|---|
| Pchgms1-F | 59 °C | GGGTAAATATGCCCATTGTGCAATC | Sosinski et al., 2000 [43] |
| Pchgms1-R | GGATCATTGAACTACGTCAATCCTC | ||
| Pchgms3-F | 59 °C | ACGGTATGTCCGTACACTCTCCATG | |
| Pchgms3-R | CAACCTGTGATTGCTCCTATTAAAC | ||
| UDP98410-F | 50 °C | AATTTACCTATCAGCCTCAAA | Testolin et al., 2000 [44] |
| UDP98410-R | TTTATGGCAGTTTACAGACCG | ||
| Ps8e8-F | 50 °C | CCCAATGAACAACTGCAT | Joobeur et al., 2000 [45] |
| Ps8e8-R | CATATCAATCACTGGGATG | ||
| Ps9f8-F | 45 °C | GGTTCTTGGTTATTATGA | |
| Ps9f8-R | ACATTTCTATGCAGAGTA | ||
| UDP96008-F | 58 °C | TTGTACACACCCTCAGCCTG | Cipriani et al., 1999 [40] |
| UDP96008-R | TGCTGAGGTTCAGGTGAGTG | ||
| UDP96018-F | 58 °C | TTCTAATCTGGGCTATGGCG | |
| UDP96018-R | GAAGTTCACATTTACGACAGGG | ||
| BPPCT010-F | 55 °C | AAAGCACAGCCCATAATGC | Dirlewanger et al., 2002 [46] |
| BPPCT010-R | GTACTGTTACTGCTGGGAATGC |
3. Results
3.1. Morphological Characterization
3.2. Self-Compatibility Analysis
3.3. SSR Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Statista Nuts: Most Consumed Type Worldwide. Available online: https://www.statista.com/statistics/1030815/tree-nut-global-consumption-by-type/ (accessed on 14 March 2022).
- Martins, M.; Tenreiro, R.; Oliveira, M.M. Genetic Relatedness of Portuguese Almond Cultivars Assessed by RAPD and ISSR Markers. Plant Cell Rep. 2003, 22, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Barreca, D.; Nabavi, S.M.; Sureda, A.; Rasekhian, M.; Raciti, R.; Silva, A.S.; Annunziata, G.; Arnone, A.; Tenore, G.C.; Süntar, İ.; et al. Almonds (Prunus dulcis Mill. D. A. Webb): A Source of Nutrients and Health-Promoting Compounds. Nutrients 2020, 12, 672. [Google Scholar] [CrossRef] [PubMed]
- Bartolozzi, F.; Warburton, M.L.; Arulsekar, S.; Gradziel, T.M. Genetic Characterization and Relatedness among California Almond Cultivars and Breeding Lines Detected by Randomly Amplified Polymorphic DNA (RAPD) Analysis. J. Am. Soc. Hortic. Sci. 1998, 123, 381–387. [Google Scholar] [CrossRef]
- FAOSTAT. Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 2 June 2023).
- Nanos, G.D.; Kazantzis, I.; Kefalas, P.; Petrakis, C.; Stavroulakis, G.G. Irrigation and Harvest Time Affect Almond Kernel Quality and Composition. Sci. Hortic. 2002, 96, 249–256. [Google Scholar] [CrossRef]
- Jackson, C.L.; Hu, F.B. Long-Term Associations of Nut Consumption with Body Weight and Obesity. Am. J. Clin. Nutr. 2014, 100, 408S–411S. [Google Scholar] [CrossRef]
- Mohammadifard, N.; Salehi-Abargouei, A.; Salas-Salvadó, J.; Guasch-Ferré, M.; Humphries, K.; Sarrafzadegan, N. The Effect of Tree Nut, Peanut, and Soy Nut Consumption on Blood Pressure: A Systematic Review and Meta-Analysis of Randomized Controlled Clinical Trials. Am. J. Clin. Nutr. 2015, 101, 966–982. [Google Scholar] [CrossRef]
- Li, S.C.; Liu, Y.H.; Liu, J.F.; Chang, W.H.; Chen, C.M.; Chen, C.Y.O. Almond Consumption Improved Glycemic Control and Lipid Profiles in Patients with Type 2 Diabetes Mellitus. Metabolism 2011, 60, 474–479. [Google Scholar] [CrossRef]
- Souza, R.G.M.; Gomes, A.C.; Naves, M.M.V.; Mota, J.F. Nuts and Legume Seeds for Cardiovascular Risk Reduction: Scientific Evidence and Mechanisms of Action. Nutr. Rev. 2015, 73, 335–347. [Google Scholar] [CrossRef]
- Drogoudi, P.D.; Pantelidis, G.; Bacchetta, L.; De Giorgio, D.; Duval, H.; Metzidakis, I.; Spera, D. Protein and Mineral Nutrient Contents in Kernels from 72 Sweet Almond Cultivars and Accessions Grown in France, Greece and Italy. Int. J. Food Sci. Nutr. 2013, 64, 202–209. [Google Scholar] [CrossRef]
- Zeinalabedini, M.; Sohrabi, S.; Nikoumanesh, K.; Imani, A.; Mardi, M. Phenotypic and Molecular Variability and Genetic Structure of Iranian Almond Cultivars. Plant Syst. Evol. 2012, 298, 1917–1929. [Google Scholar] [CrossRef]
- Khadivi-Khub, A.; Etemadi-Khah, A. Phenotypic Diversity and Relationships between Morphological Traits in Selected Almond (Prunus amygdalus) Germplasm. Agrofor. Syst. 2015, 89, 205–216. [Google Scholar] [CrossRef]
- Sorkheh, K.; Shiran, B.; Kiani, S.; Amirbakhtiar, N.; Mousavi, S.; Rouhi, V.; Mohammady-D, S.; Gradziel, T.M.; Malysheva-Otto, L.V.; Martínez-Gómez, P. Discriminating Ability of Molecular Markers and Morphological Characterization in the Establishment of Genetic Relationships in Cultivated Genotypes of Almond and Related Wild Species. J. For. Res. 2009, 20, 183–194. [Google Scholar] [CrossRef]
- Xu, Y.; Ma, R.C.; Xie, H.; Liu, J.T.; Cao, M.Q. Development of SSR Markers for the Phylogenetic Analysis of Almond Trees from China and the Mediterranean Region. Genome 2004, 47, 1091–1104. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.; Sui, Y.; Chang, F.Q.; Xu, Y.; Ma, R.C. SSR Allelic Variation in Almond (Prunus dulcis Mill.). Theor. Appl. Genet. 2006, 112, 366–372. [Google Scholar] [CrossRef]
- Martínez-Gómez, P.; Arulsekar, S.; Potter, D.; Gradziel, T.M. An Extended Interspecific Gene Pool Available to Peach and Almond Breeding as Characterized Using Simple Sequence Repeat (SSR) Markers. Euphytica 2003, 131, 313–322. [Google Scholar] [CrossRef]
- Marchese, A.; Bošković, R.I.; Martínez-García, P.J.; Tobutt, K.R. The Origin of the Self-Compatible Almond ‘Supernova’. Plant Breed. 2008, 127, 105–107. [Google Scholar] [CrossRef]
- Sonneveld, T.; Tobutt, K.R.; Robbins, T.P. Allele-Specific PCR Detection of Sweet Cherry Self-Incompatibility (S) Alleles S1 to S16 Using Consensus and Allele-Specific Primers. Theor. Appl. Genet. 2003, 107, 1059–1070. [Google Scholar] [CrossRef]
- Boškovic, R.; Tobutt, K.R.; Batlle, I.; Duval, H. Correlation of Ribonuclease Zymograms and Incompatibility Genotypes in Almond. Euphytica 1997, 97, 167–176. [Google Scholar] [CrossRef]
- Ushijima, K.; Sassa, H.; Dandekar, A.M.; Gradziel, T.M.; Tao, R.; Hirano, H. Structural and Transcriptional Analysis of the Self-Incompatibility Locus of Almond: Identification of a Pollen-Expressed F-Box Gene with Haplotype-Specific Polymorphism. Plant Cell 2003, 15, 771–781. [Google Scholar] [CrossRef]
- Hua, Z.H.; Fields, A.; Kao, T.H. Biochemical Models for S-RNase-Based Self-Incompatibility. Mol. Plant 2008, 1, 575–585. [Google Scholar] [CrossRef]
- Fernández i Martí, A.; Gradziel, T.M.; Socias i Company, R. Methylation of the Sf Locus in Almond Is Associated with S-RNase Loss of Function. Plant Mol. Biol. 2014, 86, 681–689. [Google Scholar] [CrossRef] [PubMed]
- Bošković, R.; Tobutt, K.R.; Duval, H.; Batlle, I.; Dicenta, F.; Vargas, F.J. A Stylar Ribonuclease Assay to Detect Self-Compatible Seedlings in Almond Progenies. Theor. Appl. Genet. 1999, 99, 800–810. [Google Scholar] [CrossRef]
- Dicenta, F.; García, J.E. Inheritance of Self-Compatibility in Almond. Heredity 1993, 70, 313–317. [Google Scholar] [CrossRef]
- Pérez de los Cobos, F.; Martínez-García, P.J.; Romero, A.; Miarnau, X.; Eduardo, I.; Howad, W.; Mnejja, M.; Dicenta, F.; Socias i Company, R.; Rubio-Cabetas, M.J.; et al. Pedigree Analysis of 220 Almond Genotypes Reveals Two World Mainstream Breeding Lines Based on Only Three Different Cultivars. Hortic. Res. 2021, 8, 11. [Google Scholar] [CrossRef] [PubMed]
- Miarnau, X.; Alegre, S.; Vargas, F. Productive potential of six almond cultivars under regulated deficit irrigation. In Proceedings of the XIV GREMPA Meeting on Pistachios and Almonds, Athens, Greece, 30 March–4 April 2008; Zakynthinos, G., Ed.; Série A: Séminaires Méditerranéens; n. 94. Options Méditerranéennes: Zaragoza, Spain, 2010; pp. 267–271. [Google Scholar]
- Socias i Company, R.; Alonso, J.M.; Kodad, O.; Gradziel, T.M. Almond. In Fruit Breeding; Badenes, M., Byrne, D., Eds.; Springer: Boston, MA, USA, 2012; pp. 697–728. ISBN 9781441907639. [Google Scholar]
- Dicenta, F.; Ortega, E.; Cánovas, J.A.; Egea, J. Self-Pollination vs. Cross-Pollination in Almond: Pollen Tube Growth, Fruit Set and Fruit Characteristics. Plant Breed. 2002, 121, 163–167. [Google Scholar] [CrossRef]
- Ledbetter, C.A. Shell Cracking Strength in Almond (Prunus dulcis [Mill.] D.A. Webb.) and Its Implication in Uses as a Value-Added Product. Bioresour. Technol. 2008, 99, 5567–5573. [Google Scholar] [CrossRef]
- Shiran, B.; Amirbakhtiar, N.; Kiani, S.; Mohammadi, S.; Sayed-Tabatabaei, B.E.; Moradi, H. Molecular Characterization and Genetic Relationship among Almond Cultivars Assessed by RAPD and SSR Markers. Sci. Hortic. 2007, 111, 280–292. [Google Scholar] [CrossRef]
- Alonso, J.M.; Socias i Company, R. Physiological and Genetic determination of self-compatibility in an almond breeding progeny. In Proceedings of the XIII GREMPA Meeting on Almonds and Pistachios, Mirandela, Portugal, 1–5 June 2003; Oliveira, M.M., Cordeiro, V., Eds.; CIHEAM: Zaragoza, Spain, 2005; Volume 105, pp. 101–105. [Google Scholar]
- Kodad, O.; Socias i Company, R. Variability of Oil Content and of Major Fatty Acid Composition in Almond (Prunus amygdalus Batsch) and Its Relationship with Kernel Quality. J. Agric. Food Chem. 2008, 56, 4096–4101. [Google Scholar] [CrossRef]
- Ma, R.C.; Oliveira, M.M. Molecular Cloning of the Self-Incompatibility Genes S1 and S3 from Almond (Prunus dulcis Cv. Ferragnès). Sex Plant Reprod. 2001, 14, 163–167. [Google Scholar] [CrossRef]
- Tao, R.; Yamane, H.; Sugiura, A.; Murayama, H.; Sassa, H.; Mori, H. Molecular Typing of S-Alleles through Identification, Characterization and CDNA Cloning for S-RNases in Sweet Cherry. J. Am. Soc. Hortic. Sci. 1999, 124, 224–233. [Google Scholar] [CrossRef]
- Channuntapipat, C.; Sedgley, M.; Batlle, I.; Arús, P.; Collins, G. Sequences of the Genomic DNAs Encoding the S2, S9, S10, and S23 Alleles from Almond, Prunus dulcis. J. Hortic. Sci. Biotechnol. 2002, 77, 387–392. [Google Scholar] [CrossRef]
- Hanada, T.; Fukuta, K.; Yamane, H.; Esumi, T.; Gradziel, T.; Dandekar, A.; Fernández i Martí, Á.; Alonso, J.; Socias i Company, R. Cloning and Characterization of a Self-Compatible Sf Haplotype in Almond [Prunus dulcis (Mill.) D.A. Webb. Syn. P. Amygdalus Batsch] to Resolve Previous Confusion in Its Sf-RNase Sequence. HortScience 2009, 44, 609–613. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
- Cipriani, G.; Lot, G.; Huang, W.G.; Marazzo, M.T.; Peterlunger, E.; Testolin, R. AC/GT and AG/CT Microsatellite Repeats in Peach [Prunus persica (L.) Batsch]: Isolation, Characterisation and Cross-Species Amplification in Prunus. Theor. Appl. Genet. 1999, 99, 65–72. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research-an Update. Bioinforma. Appl. 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Roldán-Ruiz, I.; Dendauw, J.; Van Bockstaele, E.; Depicker, A.; De Loose, M. AFLP Markers Reveal High Polymorphic Rates in Ryegrasses (Lolium spp.). Mol. Breed. 2000, 6, 125–134. [Google Scholar] [CrossRef]
- Sosinski, B.; Gannavarapu, M.; Hager, L.D.; Beck, L.E.; KIng, J.J.; Ryder, C.D.; Rajapakse, S.; Baird, W.V.; Ballard, R.E.; Abbot, A.G. Characterization of Microsatellite Markers in Peach [Prunus persica (L.) Batsch]. Theor. Appl. Genet. 2000, 101, 421–428. [Google Scholar] [CrossRef]
- Testolin, R.; Marrazzo, T.; Cipriani, G.; Quarta, R.; Verde, I.; Dettori, M.; Pancaldi, M.; Sansavini, S. Microsatellite DNA in Peach (Prunus persica L. Batsch) and Its Use in Fingerprinting and Testing the Genetic Origin of Cultivars. Genome 2000, 43, 512–520. [Google Scholar] [CrossRef]
- Joobeur, T.; Periam, N.; De Vicente, M.C.; King, G.J.; Arus, P. Development of a Second Generation Linkage Map for Almond Using RAPD and SSR Markers. Genome 2000, 43, 649–655. [Google Scholar] [CrossRef]
- Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, M.J.; Poizat, C.; Zanetto, A.; Arús, P.; Laigret, F. Development of Microsatellite Markers in Peach [Prunus persica (L.) Batsch] and Their Use in Genetic Diversity Analysis in Peach and Sweet Cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef]
- Avise, J. Molecular Markers, Natural History and Evolution; Springer Science and Business Media, LLC: New York, NY, USA, 1994; ISBN 0412037718. [Google Scholar]
- Perez-Sanchez, R.; Morales-Corts, M.R. Agromorphological Characterization and Nutritional Value of Traditional Almond Cultivars Grown in the Central-Western Iberian Peninsula. Agronomy 2021, 11, 1238. [Google Scholar] [CrossRef]
- Gradziel, T.M. Almond (Prunus dulcis) breeding. In Breeding Plantation Tree Crops: Temperate Species; Jain, S.M., Priyadarshan, P., Eds.; Springer: New York, NY, USA, 2009; pp. 1–31. ISBN 9780387712031. [Google Scholar]
- Bernad, D.; Socias i Company, R. Characterization of Some Self-Compatible Almonds. II. Flower Phenology and Morphology. HortScience 1995, 30, 321–324. [Google Scholar] [CrossRef]
- Socias i Company, R.; Felipe, A.J. ‘Belona’ and ‘Soleta’ Almonds. HortScience 2007, 42, 704–706. [Google Scholar] [CrossRef]
- Ledbetter, C.A.; Sisterson, M.S. Carpological Variability of Almond [Prunus dulcis (Mill.) D.A. Webb Cv. Nonpareil] in a Single Orchard during Seven Consecutive Harvests. HortScience 2010, 45, 1788–1792. [Google Scholar] [CrossRef]
- Arslan, S.; Vursavus, K.K. Physico-Mechanical Properties of Almond Nut and Its Kernel as a Function of Variety and Moisture Content. Philipp. Agric. Sci. 2008, 91, 171–179. [Google Scholar]
- Lovicu, G.; Pala, M.; De Pau, L.; Satta, D.; Farci, M. Bioagronomical Behaviour of Some Almond Cultivars in Sardinia. Acta Hortic. 2002, 591, 487–491. [Google Scholar] [CrossRef]
- Socias i Company, R.; Ansón, J.M.; Espiau, M. Taxonomy, botany and physiology. In Almonds: Botany, Production and Uses; Socias i Company, R., Gradziel, T.M., Eds.; CABI: Wallingford, UK, 2017; pp. 1–42. ISBN 1780643543. [Google Scholar]
- Socias i Company, R.; Kodad, O.; Alonso, J.M.; Gradziel, T.M. Almond Quality: A Breeding Perspective. In Horticultural Reviews; Janick, J., Ed.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2008; Volume 34, pp. 197–238. ISBN 9780470380147. [Google Scholar]
- Maldera, F.; Vivaldi, G.A.; Iglesias-Castellarnau, I.; Camposeo, S. Two Almond Cultivars Trained in a Super-High Density Orchard Show Different Growth, Yield Efficiencies and Damages by Mechanical Harvesting. Agronomy 2021, 11, 1406. [Google Scholar] [CrossRef]
- Egea, J.; Burgos, L. Detecting Cross-Incompatibility of Three North American Apricot Cultivars and Establishing the First Incompatibility Group in Apricot. J. Am. Soc. Hortic. Sci. 1996, 121, 1002–1005. [Google Scholar] [CrossRef]
- Ortega, E.; Sutherland, B.G.; Dicenta, F.; Bošković, R.; Tobutt, K.R. Determination of Incompatibility Genotypes in Almond Using First and Second Intron Consensus Primers: Detection of New S Alleles and Correction of Reported S Genotypes. Plant Breed. 2005, 124, 188–196. [Google Scholar] [CrossRef]
- Tamura, M.; Ushijima, K.; Sassa, H.; Hirano, H.; Tao, R.; Gradziel, T.M.; Dandekar, A.M. Identification of Self-Incompatibility Genotypes of Almond by Allele-Specific PCR Analysis. Theor. Appl. Genet. 2000, 101, 344–349. [Google Scholar] [CrossRef]
- Hasanbegovic, J.; Hadziabulic, S.; Kurtovic, M.; Gasi, F.; Lazovic, B.; Dorbic, B.; Skender, A. Genetic Characterization of Almond (Prunus Amygdalus L) Using Microsatellite Markers in the Area of Adriatic Sea. Turk. J. Agric. For. 2021, 45, 797–806. [Google Scholar] [CrossRef]
- Esgandaripirmorad, F.; Karcı, H.; Paizila, A.; Topçu, H.; Kafkas, S. Molecular Characterization of Almond Cultivars Using Simple Sequence Repeat Markers. Erwerbs-Obstbau 2022, 64, 463–474. [Google Scholar] [CrossRef]
- Kadkhodaei, S.; Nekouei, M.K.; Shahnazari, M.; Etminani, H.; Imani, A.; Ghaderi-Zefrehei, M.; Elahy, M.; Ariff, A.B. Molecular Tagging of Agronomic Traits Using Simple Sequence Repeats: Informative Markers for Almond (Prunus dulcis) Molecular Breeding. Aust. J. Crop Sci. 2011, 5, 1199–1209. [Google Scholar]
- Elhamzaoui, A.; Oukabli, A.; Charafi, J.; Moumni, M. Assessment of Genetic Diversity of Moroccan Cultivated Almond (Prunus dulcis Mill. DA Webb) in Its Area of Extreme Diffusion, Using Nuclear Microsatellites. Am. J. Plant Sci. 2012, 03, 1294–1303. [Google Scholar] [CrossRef]
- Zeinalabedini, M.; Grigorian, V.; Torchi, M.; Khayam-Nekoui, M.; Majourhat, K.; Dicenta, F.; Martínez-Gómez, P. Study of the Origin of the Cultivated Almond Using Nuclear and Chloroplast DNA Markers. Acta Hortic. 2009, 814, 695–700. [Google Scholar] [CrossRef]
- Zeinalabedini, M.; Majourhat, K.; Khayam-Nekoui, M.; Grigorian, V.; Toorchi, M.; Dicenta, F.; Martínez-Gomez, P. Molecular Characterization of Almond Cultivars and Related Wild Species Using Nuclear and Chloroplast DNA Markers. J. Food Agric. Environ. 2007, 5, 242–247. [Google Scholar]
- Gouta, H.; Ksia, E.; Buhner-Zaharieva, T.; Mliki, A.; Gogorcena, Y. Molecular Characterization of Local Almonds Development of an SSR-Based Identification Key for Tunisian Local Almonds. Sci. Agric. 2012, 69, 108–113. [Google Scholar] [CrossRef]
- Padilla, G.; Socias i Company, R.; Ordás, A. Molecular Characterization of Almond Accessions from the Island of La Palma (Canary Islands, Spain) Using SSR Markers. Plant Genet. Resour. 2014, 12, 323–329. [Google Scholar] [CrossRef]
- Bentley, L.; Barker, N.P.; Dold, A.P. Genetic Diversity of the Endangered Faucaria tigrina (Aizoaceae) through ISSR “Fingerprinting” Using Automated Fragment Detection. Biochem. Syst. Ecol. 2015, 58, 156–161. [Google Scholar] [CrossRef]







| Trait | ‘Mars’ | ‘Ferragnes’ |
|---|---|---|
| One-year-old shoot anthocyanin coloration | Weak | Strong |
| Leaf blade width (mm) | 26.2 a | 26.6 a |
| Leaf ratio length/width | 3.18 a | 3.20 a |
| Leaf blade intensity of green color | Medium | Medium |
| Leaf blade incisions of margin | Crenate | Crenate |
| Petiole length (mm) | 28.0 a | 28.3 a |
| Flower bud shape | Triangular | Triangular |
| Flower bud color of tip of petals | Pink | Pink |
| Flower bud color of sepals | Red | Red |
| Flower bud pubescence of sepals | Medium | Medium |
| Petal shape | Medium elliptic | Circular |
| Petal color of inner side | Light pink | Light pink |
| Petal undulation of margin | Weak | Weak |
| Flower number of stamens | 42 a | 32 b |
| Stamen anthocyanin coloration of filament | Moderate | Absent |
| Stigma position in relation to anthers | Above | Above |
| Stigma size | Small | Small |
| Fruit size | Large | Large |
| Fruit shape (in lateral view) | Elliptic | Ovate |
| Fruit shape of apex | Obtuse | Obtuse |
| Fruit pubescence | Dense | Dense |
| Nut shape (in lateral view) | Ovate | Ovate |
| Nut shape of apex | Acute | Acute |
| Nut thickness of endocarp | Medium | Medium |
| Nut resistance to cracking | Strong | Strong |
| Nut keel development | Medium | Weak |
| Kernel size | Large | Large |
| Kernel intensity of brown color | Light | Light |
| Kernel rugosity of surface | Weak | Weak |
| Time of harvest | Early | Medium |
| Trait | ‘Mars’ | ‘Ferragnes’ | ‘Lauranne’ | ‘Tuono’ |
|---|---|---|---|---|
| Nut weight (g) | 5.15 a | 5.58 a | 3.86 b | 2.97 c |
| Nut length (mm) | 37.9 a | 37.6 a | 36.6 a | 34.3 a |
| Nut width (mm) | 24.1 ab | 25.0 a | 22.3 b | 23.3 ab |
| Nut thickness (mm) | 17.6 a | 17.1 a | 14.4 b | 15.5 b |
| Nut ratio length/width | 1.57 ab | 1.51 b | 1.64 a | 1.47 b |
| Kernel weight (g) | 1.57 ab | 1.83 a | 1.3 bc | 1.25 c |
| Kernel length (mm) | 27.2 b | 29.4 a | 26.3 b | 23.9 c |
| Kernel width (mm) | 15.2 a | 15.3 a | 13.7 a | 14.0 a |
| Kernel thickness (mm) | 8.33 a | 8.85 a | 7.20 b | 7.21 b |
| Kernel ratio length/width | 1.80 ab | 1.93 a | 1.92 a | 1.71 b |
| Kernel (%) | 30.6 b | 32.9 b | 33.5 b | 42.0 a |
| Double kernels (%) | 9.2 b | 0 c | 0 c | 20 a |
| SSR Marker | Allele Size Range | No of Bands | Ne | I | Ho | He | PIC | |
|---|---|---|---|---|---|---|---|---|
| Total | Polymorphic | |||||||
| Pchgms1 | 179–212 bp | 6 | 6 | 4.000 | 1.583 | 1.000 | 0.750 | 0.365 |
| Pchgms3 | 166–186 bp | 5 | 5 | 3.789 | 1.445 | 1.000 | 0.736 | 0.320 |
| UDP98410 | 131–143 bp | 3 | 3 | 1.946 | 0.824 | 0.333 | 0.486 | 0.211 |
| Ps8e8 | 170–174 bp | 2 | 1 | 1.600 | 0.562 | 0.500 | 0.375 | 0.147 |
| Ps9f8 | 133–165 bp | 4 | 4 | 3.429 | 1.309 | 0.667 | 0.708 | 0.269 |
| UDP96008 | 130–134 bp | 2 | 1 | 1.385 | 0.451 | 0.333 | 0.278 | 0.147 |
| UDP96018 | 226–232 bp | 4 | 4 | 3.789 | 1.358 | 0.667 | 0.736 | 0.269 |
| BPPCT010 | 131–141 bp | 4 | 4 | 3.789 | 1.358 | 0.500 | 0.736 | 0.269 |
| Mean | 3.75 | 3.5 | 2.966 | 1.111 | 0.625 | 0.601 | 0.250 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mougiou, N.; Maletsika, P.; Konstantinidis, A.; Grigoriadou, K.; Nanos, G.; Argiriou, A. Morphological and Molecular Characterization of a New Self-Compatible Almond Variety. Agriculture 2023, 13, 1362. https://doi.org/10.3390/agriculture13071362
Mougiou N, Maletsika P, Konstantinidis A, Grigoriadou K, Nanos G, Argiriou A. Morphological and Molecular Characterization of a New Self-Compatible Almond Variety. Agriculture. 2023; 13(7):1362. https://doi.org/10.3390/agriculture13071362
Chicago/Turabian StyleMougiou, Niki, Persefoni Maletsika, Aristarhos Konstantinidis, Katerina Grigoriadou, George Nanos, and Anagnostis Argiriou. 2023. "Morphological and Molecular Characterization of a New Self-Compatible Almond Variety" Agriculture 13, no. 7: 1362. https://doi.org/10.3390/agriculture13071362
APA StyleMougiou, N., Maletsika, P., Konstantinidis, A., Grigoriadou, K., Nanos, G., & Argiriou, A. (2023). Morphological and Molecular Characterization of a New Self-Compatible Almond Variety. Agriculture, 13(7), 1362. https://doi.org/10.3390/agriculture13071362

