Next Article in Journal
Design of a Micro-Plant Factory Using a Validated CFD Model
Previous Article in Journal
Assessment of Fumonisin, Deoxynivalenol, and Zearalenone Levels and the Occurrence of Mycotoxigenic Fusarium Species in Cereal Grains from Muscat, Sultanate of Oman
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases

1
Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
2
College of Biology and Environment, Zhejiang Wanli University, Ningbo 315100, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this study.
Agriculture 2024, 14(12), 2226; https://doi.org/10.3390/agriculture14122226
Submission received: 28 October 2024 / Revised: 25 November 2024 / Accepted: 27 November 2024 / Published: 5 December 2024
(This article belongs to the Section Crop Genetics, Genomics and Breeding)

Abstract

:
The analysis of the developmental stages of Agaricus bisporus, a major edible and medicinal mushroom, has always been an important focus in this research area. The process of the growth and development of edible mushrooms is complex and involves the regulation of multiple genes and metabolic pathways. Less data exist on the mechanism of their growth and development at the overall level. In this study, RNA sequencing analyses (RNA-Seq) and data-independent acquisition (DIA) proteomic analyses were carried out at the button phase (BP), harvesting phase (HP), and opening phase (OP) stages of Agaricus bisporus ‘Shuangbao 106’ to reveal the changes in gene expression during the different growth periods of its substrates. The authors screened and explored 3351 differentially expressed genes (DEGs) with a difference factor of ≥2.0, including 2080 up-regulated and 1271 down-regulated genes. After proteome sequencing, 1156 differentially expressed proteins (DEPs) were screened, including 524 up-regulated and 632 down-regulated genes. The expression in TPM of glycoside hydrolase, catalytic core, and chitinase II decreased during both the HP and OP compared with the BP. This may be because mushrooms require higher levels of glycoside hydrolase, catalytic core, and chitinase II activity during the BP to cope with external threats and the need for cell wall remodeling. Conversely, the growth of mushrooms slowed down and the need for cell wall remodeling decreased during the HP and OP, leading to a decrease in the expression of glycoside hydrolase, catalytic core, and chitinase II. This change is related to the need for environmental adaptation, immune defense, and cell wall remodeling, and may regulate the post-growth process of A. bisporus via the hydrolysis of cell wall chitin and glycoside hydrolase. It may also inhibit the growth of mushroom pilei.

1. Introduction

Agaricus bisporus belongs to Hymenomycetes, Agaricaceae, and Agaricus campestris. It is also known as white mushroom, mushroom, foreign mushroom, etc. Yielding the largest planting output of edible mushrooms in the world, A. bisporus is highly appreciated by consumers for its unique taste and high nutritional value and is extensively planted worldwide for its important economic value [1,2,3]. The A. bisporus “Shuangbao 106” variety is obtained via the monospore breeding of A. bisporus “A20”. It is characterized by early fruiting, a round fruiting body, a solid structure, a high output, and a high commercialization level, and is suitable for cultivation in factory facilities [4]. Early studies have deeply analyzed the different developmental phases (e.g., the primary base phase, harvesting phase, and late opening phase) of A. bisporus using transcriptome sequencing technology and have identified abundant differentially expressed genes (DEGs); the functions of these genes in metabolic pathways and biological processes have also been discussed. Nevertheless, these studies have mainly focused on the transcriptome changes in the commercial varieties “A15” [5] and “As2796” [6]. Cai et al. [7] investigated the genomic changes between anti-browning and easy-browning varieties of A. bisporus. The transcriptomic results showed that the expression of the AbPPO gene played an important role in the browning of A. bisporus. Hao et al. [8] found that antioxidant enzymes and heat shock proteins were important proteins for A. bisporus to resist stress. Under high temperature stress, hyphae reduced damage to themselves through the differential expression of the two genes. Concerning other edible mushrooms, Wu [9] analyzed the molecular characteristics and genetic diversity of Morechella esculenta in Xinjiang using transcriptome technology and obtained three wild Morechella esculenta strains via tissue separation. Studies on the transcriptome of fungi can deepen our understanding of the biological characteristics of edible mushrooms while providing important references for the genetic improvement and high-efficiency planting of edible mushrooms. They can also provide data references to understand the development mechanism of the Flammulina velutipes pileus [10]. Key genes of Schizophyllum commune [11] and Coprinus cinereus [12] have been explored using transcriptome analysis, but a comparative analysis of the transcriptome and proteome of the pileus of “Shuangbao 106” is still lacking. This study adopted a joint analysis of the transcriptome and proteome to reveal the dynamic changes in the expressions of the genes and proteins of “Shuangbao 106” in different growth phases. The gene expressions were measured at the RNA and protein levels based on the joint analysis of the transcriptome and proteome; a panorama view of the gene expressions and regulations at different steps was gained; and new data were mined, enabling the disclosure of the dynamic change laws of the gene and protein expressions of “Shuangbao 106”. Key genes and proteins that control mushroom growth, development, and quality of formation were further explored on this basis. On the one hand, this is conducive to obtaining a deep understanding of the growth regulation mechanism of “Shuangbao 106”; on the other hand, it provides theoretical references and practice guidance to improve mushroom varieties, output, and quality via genetic engineering and molecular biological methods.

2. Materials and Methods

2.1. Experimental Materials

The A. bisporus heterokaryotic strain “Shuangbao 106” was stored and provided by the Edible Mushroom Breeding and Planting Research Institute of the Horticulture Institute, Zhejiang Academy of Agricultural Sciences. “Shuangbao 106” fruiting bodies were sampled using conventional planting and administration. The fruiting body development of A. bisporus was divided into 7 phases: the primary base phase, button phase, harvesting phase, early maturity phase, maturity phase, opening phase, and late opening phase. Three sampling phases of fruiting body development were chosen in this study to increase significant differences: the button phase (BP) (pileus diameter: 10–15 mm), the harvesting phase (HP) (pileus diameter: 30–50 mm; the mushroom membrane is not broken), and the opening phase (OP) (pileus diameter: 50–80 mm; the pileus opens, and the surface bulges). Roots and dirt were removed from the fresh fruiting body samples. The BP, HP, and OP samples were collected with sterile scalpels. All collected samples were sealed and stored with aluminum foils, which were then quickly transferred to liquid nitrogen for freezing. All samples were kept in a refrigerator at −80 °C for later use. The reference gene was A. bisporus var. bisporus H97 (https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=936046, accessed on 25 November 2024). GADPH was used as the internal reference gene [13].

2.2. Transcriptome Sequencing and DEG Analysis

The total RNA was extracted from the fruiting bodies of A. bisporus using a Trizol agent (Invitrogen, Carlsbad, CA, USA), following the instructions. The purity, concentration, and integrity of the total RNA were tested. The qualified total RNA (n = 3) was sent for sequencing to Shanghai Meiji Biomedical Technology Co., Ltd. (Shanghai, China)The expression level of each transcript was calculated according to the transcripts per million reads (TPM) method to identify DEGs between two different samples. Differential expression analysis was performed using DESeq2 [14]. DEGs with |log2FC| ≥ 1 and FDR < 0.05 (DESeq2) or FDR < 0.001 (DEGseq) were considered to be significantly differently expressed genes. In addition, functional enrichment analyses, including Gene Ontology (GO; http://geneontology.org/, accessed on 25 November 2024) [15] and the Kyoto Encyclopedia of Genes and Genomes (KEGG; https://www.genome.jp/kegg/, accessed on 27 October 2024) pathway [16], were performed to identify which DEGs were significantly enriched in GO terms and metabolic pathways at a Bonferroni-corrected p-value of <0.05 compared with the whole-transcriptome background. The GO functional enrichment and KEGG pathway analyses were carried out using Goatools (https://github.com/tanghaibao/GOatools, accessed on 25 November 2024) and the Python scipy software Version 3.8.3 (https://scipy.org/install/, accessed on 25 November 2024), respectively.

2.3. Proteome Sequencing and DEG Analysis

The samples in Section 2.1 were used and sent for sequencing to Shanghai Meiji Biomedical Technology Co., Ltd. (Shanghai, China) Each sample was set with three repetitions. The main process consisted of total protein extraction, a sample concentration test, a quality test, trypsin-digested protein, TMT reagent-labeled peptides, chromatographic separation, liquid chromatography–mass spectrometry tandem analysis, and bioinformatics analysis. Based on credible proteins, proteins with a fold factor of expression level variation of ≥2 among samples and a p-value of <0.05 were defined as differentially expressed proteins (DEPs). Functional clustering and KEGG pathway enrichment analyses were carried out on the DEPs. The interaction relations between the DEPs were determined using the STRING database (https://string-db.org, accessed on 25 November 2024), and the first 25 proteins in terms of correlation were chosen for the visual plotting of the interaction network diagram using Cytoscape Version 3.10.3 [17].

2.4. Data Analysis

Three biological replicates were set for each sample. Three data analysis software applications, SPSS26, Graphpad Prism9, and Excel, were used to process and interpret the experimental data. Primers were designed using the software Primer Premier 5.0. The statistical analysis was performed using an Excel 2016 test. The datasets were represented as means ± standard deviation. The expression levels of genes and transcripts were quantified separately using the RSEM software Version 1.3.3 (http://deweylab.github.io/RSEM/, accessed on 25 November 2024) for subsequent analysis of the differential expression of genes/transcripts among different samples. The regulatory mechanisms of genes were revealed by combining the functional information of the sequences. The raw paired end reads were trimmed and quality controlled by fastp [18] using the default parameters. Then, clean reads were separately aligned to the reference genome (https://www.ncbi.nlm.nih.gov/genome/858?genome_assembly_id=31529, accessed on 25 November 2024) with orientation mode set using HISAT2 [19] software. The mapped reads of each sample were assembled by StringTie [20] in a reference-based approach.

2.5. Real-Time Fluorescence Quantitative Polymerase Chain Reaction

Six DEGs were selected from BP vs. HP and BP vs. OP for real-time PCR quantitative analysis (RT-qPCR) to verify the accuracy of the high-throughput transcriptome sequencing. The primers were synthesized by Anhui General Biotechnology Co., Ltd. (Anhui, China) (Table 1). The relative expressions of the target genes were calculated using the 2−ΔΔCt method. The HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech Co., Ltd.(Nanjing, China)) was used for reverse transcription (Vazyme Biotech Co., Ltd. (Nanjing, China)). The real-time fluorescence quantitative PCR reaction system comprised 20.0 μL, including 10 μL of 2× qPCR MIX, 0.4 μL of upstream primers (with a concentration of 10 μM), 0.4 μL of downstream primers (with a concentration of 10 μM), 1.5 μL of the cDNA template, and 7.7 μL of NH2O2. The amplification program included 5 min of pre-degeneration at 95 °C for one cycle; 15 s of degeneration at 95 °C for 40 cycles; and 30 s of annealing/extension at 55 °C for 40 cycles.

3. Results

3.1. Sequencing Data Statistics and Quality Control

The transcriptome data were submitted to NCBI (http://www.ncbi.nlm.nih.gov/, accessed on 25 November 2024), login number PRJNA1185483 (BioProject). The proteomic data were stored in the ProteomeXchange Consortium via iProX (http://proteomecentral.proteomexchange.org, accessed on 25 November 2024), PDX number PXD057879. Three repetitions were set, and a total of nine samples were chosen for transcriptome sequencing (Figure 1). After transcriptome sequencing and data filtering each sample, the reference genomes determined from the high-quality reads were used to compare the sequences, thus obtaining the positional information on the reference genome or genes. The proportions of high-quality reads of each sample in the mapped total reads of the reference genome were all higher than 91.85%, and the proportions of uniquely mapped reads in the positioned total reads of the reference genome were all higher than 83.91%. Principal component analysis (PCA) was performed at the gene level based on the expression values (TPM) of the genes in each sample (Figure 2A) (Supplementary Table S1). The correlation coefficient between the samples was calculated based on the protein expression of each sample. The closer the correlation coefficient (R2) was to 1, the higher the similarity of the gene expression pattern between the samples. The usual biological replication requirement was R2 > 0.8 (Figure 2B) (Supplementary Table S2). Ideally, the same group of samples would gather together. The sequencing results significantly differed between samples, and the sequencing data quality was adequate for the subsequent bioinformatic statistical analysis. The details are listed in Table 2.

3.2. Screening of DEGs and DEPs

After transcriptome sequencing, 3351 DEGs with a difference factor of ≥2.0 were screened. Figure 3A shows that there are a total of 1902 DEGs from BP vs. OP, including 1277 up-regulated DEGs and 625 down-regulated DEGs. Figure 3B shows that there are a total of 1449 DEGs from HP vs. BP, including 803 up-regulated DEGs and 646 down-regulated DEGs. From this, it can be seen that up-regulated gene expression dominates in BP vs. OP and BP vs. HP. Figure 3C that there were a total of 926 DEPs gained from BP vs. OP, including 390 up-regulated DEPs and 536 down-regulated DEPs. Figure 3D shows that there were a total of 230 DEPs gained from BP vs. HP, including 134 up-regulated and 96 down-regulated DEPs. Protein expressions were mainly up-regulated DEPs from the BP vs. OP of A. bisporus, consistent with the transcriptome sequencing results. Figure 4A,B show that 548 DEGs were gained from BP vs. OP in the transcriptome sequencing, and 161 DEGs were gained in the proteome sequencing. Figure 4C,D show that 76 common genes were screened from the DEGs and DEPs in BP vs. HP, and 295 DEGs were screened from BP vs. OP.

3.3. GO Functional Clustering of DEGs and DEPs

The GO enrichment analysis of DEGs was carried out using the topGO software Version 2022.0915. Statistics on the number of genes in each GO term that were significantly enriched were generated, and second-level classification statistical analysis was carried out. The horizontal coordinate expressed the GO term, while the vertical coordinate expressed the enrichment rate (i.e., the ratio of the enriched protein number in the GO term and the background number annotated to the GO term). A higher enrichment rate indicated a higher degree of enrichment. The color gradient of the columns represented the significance of enrichment. The BP was chosen as the control check (CK) to compare with OP vs. HP. A statistical analysis of the GO functional annotation classification results of the DEGs and DEPs was conducted. The results were divided into three classes, namely, biological processes, molecular functions, and cellular components. These three classes were used to describe the biological processes that gene-encoded products participated in, the involved molecular functions, and the involved cell environment. The GO functional clustering analysis of the DEGs in the BP vs. OP of A. bisporus is shown in Figure 5. In the biological process category, the carbohydrate metabolic process and secondary metabolite biosynthetic process were significantly enriched. In the cellular component category, the intrinsic components of the membrane and the integral components of the membrane were significantly enriched. In the molecular function category, oxidoreductase activity and antioxidant activity were significantly enriched. The GO functional clustering analysis of the DEGs in the BP vs. HP of A. bisporus is shown in Figure 6. In the biological process category, the peptide biosynthetic process, cellular macromolecule biosynthetic process, peptide metabolic process, translation, and amide biosynthetic process were significantly enriched. In the cellular component category, the ribosomal subunit, ribonucleoprotein complex, ribosome, and intracellular non-membrane-bound organelle were significantly enriched. In the molecular function category, the structural constituents of the ribosome and structural molecular activity were significantly enriched.
The GO functional directed acyclic graph analysis of the DEPs in the BP vs. OP of A. bisporus is shown in Figure 7 (Supplementary Table S3). In the biological process category, translation was significantly enriched. In the cellular component category, large ribosomal subunits were significantly enriched. In the molecular function category, structural constituents of the ribosome were significantly enriched. The GO functional directed acyclic graph analysis of the DEPs in the BP vs. HP of A. bisporus is shown in Figure 8 (Supplementary Table S4). In the biological process category, peroxidase activity was significantly enriched. In the cellular component category, integral components of the membrane were significantly enriched. In the molecular function category, heme binding was significantly enriched.

3.4. KEGG Pathway Analysis of DEGs and DEPs

The enrichment analysis KEGG is an important information database for the systematic analysis of various metabolic pathways and information transduction pathways of life bodies. Figure 9A shows 96 enriched pathways, mainly in the ribosome, mismatch repair, nucleotide excision repair, the biosynthesis of various plant secondary metabolites, linoleic acid metabolism pathways, etc. Figure 9B displays 107 enriched pathways, mainly in glycolysis/gluconeogenesis, the pentose phosphate pathway, nucleotide metabolism, the biosynthesis of cofactors, tyrosine metabolism pathways, etc. According to the proteome sequencing results, 37 pathways were enriched (Figure 9C), mainly in the peroxisome, tyrosine metabolism, glyoxylate and dicarboxylate metabolism, linoleic acid metabolism, the longevity-regulating pathway in multiple species, and other pathways. Figure 9D shows 90 enriched pathways, mainly enriched in the ribosome, N-glycan biosynthesis, sphingolipid metabolism, cell cycle of yeast, glycosphingolipid biosynthesis (globo), folate biosynthesis, and other pathways.
Combined with transcriptome and proteome analysis, significant enrichment of the ribosome was found in both development stages (Figure 10). The ribosome is composed of ribosomal proteins and ribosomal RNA (rRNA). It is an important place for directing protein synthesis and is related to DNA repair and regulated cell division, proliferation, and differentiation [21]. Intracellular ribosomes adhere to the endoplasmic reticulum under the action of endoplasmic reticulum signal sequences to synthesize soluble proteins [22]. Figure 10 demonstrates that both proteins are up-regulated proteins. As important components in the ribosome synthesis pathway, NOP56 and UTP14 play an important role in maintaining the ribosome’s structure and functions. An enrichment analysis was carried out based on the protein–protein interaction (PPI) network centered at NOP56 [23]. It is usually related to the processing and modification of ribosomal RNA. UTP14 participates in the synthesis of 18S ribosome RNA and is one of 17 UTPs in the small subunit processing group [24]. It might participate in the assembly process of ribosomal subunits in A. bisporus. There are few studies directly focused on NOP56 and UTP14 in A. bisporus. However, based on the importance of ribosomal pathways in protein synthesis and cell development, we can infer that NOP56 and UTP14 play an important role in A. bisporus’s growth, development, and adaptation to environmental pressure.

3.5. Real-Time Fluorescence Quantitative PCR Results and Analysis

Differential expressions of thousands of genes under specific conditions were gained using RNA-Seq technology. Combined with the de-functional clustering and KEGG pathway enrichment analysis results of the DEGs, six DEGs (n = 3) in BP vs. HP (Table 3) and BP vs. OP (Table 4) were chosen, respectively, to verify the accuracy of the transcriptome sequencing data. For example, during the growth of A. bisporus, transcriptome sequencing analyses revealed significant changes in the expression of chitinase II and glycoside hydrolase, the catalytic core between the BP and HP and between the BP and OP. Specifically, in Gene189449, the glycoside hydrolase catalytic core of BP had a seven-fold higher TPM than that of the HP. Gene211936 had a chitinase II TPM value of 383.5 in the BP, whereas it decreased to 71.6 in the HP, a nearly five-fold decrease. Gene208965 had a chitinase II TPM value of 126.8 in the BP, whereas it decreased to 47.6 in the OP, a nearly three-fold decrease. Chitin is an important component of the fungal cell wall. Chitinase can hydrolyze chitin, thereby altering the structure and stability of the cell wall [25]. Mushrooms require higher levels of chitinase activity during the BP to cope with external threats and the need for cell wall remodeling. In contrast, mushroom growth slows down during the HP and OP, and the need for cell wall remodeling decreases, leading to decreased chitinase II expression. This change may be related to the need for environmental adaptation and immune defense of mushrooms at different growth stages. This may indicate that chitinase can hydrolyze the cell wall chitin of A. bisporus and inhibit the elongation of the mushroom stipe, which has an important role in regulating the post-growth process of A. bisporus [26]. The expression changes in these genes in the BP, HP, and OP were further explored using real-time PCR technology. According to the results, the DEGs and their TPM values all showed a consistent expression mode, verifying that the expression trends in these 12 DEGs agreed with the transcriptome sequencing results (Figure 11).

3.6. PPI Analysis of DEPs

The DEPs were annotated via NCBI online BLAST homologous comparison (Table 5). Figure 12A shows that up-regulated genes were dominant. Gene 182780, gene 114179, gene 200291, and gene 179517 had the most interactive relations with other interactive proteins, and they were major nodes of the PPI network. They mainly encoded some enzymatic proteins [27], such as RNA hydrolase and catalase, structural domain-like proteins, and ribosomal biosynthesis-like proteins [28]. Figure 12B shows that down-regulated genes were dominant. Gene 133232 and gene 114401 had the most connections with other interactive proteins, and they were major nodes in the PPI network. They mainly encoded some small ribosomal subunits and large ribosomal subunits. These genes might be significant for the development of high-precision molecular markers for species identification [29]. This provides a new direction to study the DEPs of the A. bisporus pileus in different developmental stages.

4. Discussions

As a key part of the edible mushroom industry, A. bisporus occupies a significant role in output and consumption in China. According to the statistical data of the China Edible Fungi Association, the average annual output of A. bisporus in China stabilized at more than 2 million tons. On the one hand, this demonstrates the extensive demand for A. bisporus in China; on the other hand, China’s output exceeds 50% of the global output, which highlights the important value of A. bisporus in the global edible mushroom industry. Regarding its significant economic value and market demand, it is crucial to further study the biological features of A. bisporus. Combining transcriptome analysis and proteome analysis provides a powerful tool to disclose the molecular mechanisms of the important biological processes of A. bisporus, such as growth and development, quality formation, and stress resistance. Based on transcriptome analysis, the gene expressions of A. bisporus in specific growth phases or under different environmental conditions were found comprehensively, thus identifying key genes closely related to its output, quality, and stress resistance. Proteome analysis can directly test and quantify the types and quantity of these gene expression products. Hence, it can disclose protein functions and their roles in the physiological activities of cells more intuitively. Among previous studies about edible mushrooms, Wang et al. [30] analyzed the expressions of 11 laccase genes of Flammulina velutipes. They found that these genes were related to the lignin degradation process alongside being closely related to the shaping and development of fruiting bodies. The metabolic pathways of Flammulina velutipes that these key genes participated in were further analyzed via RNA-seq technology, and the core genes related to high yield, high quality, and stress resistance were screened [31,32]. In a study on DEGs in the riboflavin synthesis pathways of Floccularia luteovirens, the key genes related to riboflavin metabolism were disclosed via RNA-Seq technology [33]. Some studies have explored genes related to cellulose degradation in shiitake mushrooms [34]. The down-regulated expression of Shiitake LeW1-26ALDH3L1 might lead to a decreased hyphal IAA content under thermal stress, thus influencing the heat resistance of hyphae [35]. Regarding crops, Chen found via ambiomics association analysis that the symbiotic germination and non-symbiotic germination of Dendrobium officinale seeds have similar and even identical metabolic pathways in their early germination phases [36]. The molecular mechanism of anthocyanin synthesis in eggplant was preliminarily disclosed via ambiomics correlation analysis [37]. It provided abundant gene data for the salt-resisting breeding of cotton by studying changes in the expressions of DEGs and DEPs under salt stress and exploring relevant genes and proteins that respond to salt stress based on the transcriptome–proteome combination [38].
In this study, the transcriptome data of the “Shuangbao 106” pileus in the BP, HP, and OP were analyzed. A total of 3351 genes with a difference factor of ≥2.0 were screened, including 2080 up-regulated and 1271 down-regulated ones. Hence, the up-regulated expression of genes was dominant throughout the development of the A. bisporus pileus. Wu et al. [5] screened 6328 DEGs in the primary base phase, harvesting phase, and late opening phase of A. bisporus A15, including 3941 up-regulated and 2387 down-regulated ones. Shi et al. [6] carried out a transcriptome analysis on the primary base phase, immature phase, harvesting phase, and opening phase of A. bisporus “As2796” and found that gene expressions were mainly down-regulated during its development. In this study, a total of 1156 DEGs were screened after proteome sequencing, including 524 up-regulated and 632 down-regulated ones. Chen et al. [39] carried out a proteome analysis on the primary base phase, immature phase, harvesting phase, and opening phase of the fruiting bodies of A. bisporus “As2796”. The samples in the primary base phase were used as the reference group, and differentially expressed proteomes were screened by controlling twice-up-regulated and -down-regulated expressions. A total of 432 differential expressed proteomes were screened, including 170 up-regulated and 262 down-regulated ones.
According to the transcriptome and proteome analyses of A. bisporus in the OP and HP, some commonly enriched metabolic pathways were disclosed which are crucial to the growth and development of mushrooms. The GO functional annotation and enrichment analysis results show that in biological processes, carbohydrate metabolism processes, macromolecular biosynthesis processes, and peptide biosynthesis processes are significantly enriched. For cell components, the overall components of the membrane and intracellular non-membrane-bound organelles are significantly enriched. For molecular functions, the active function of oxidoreductase is significantly enriched. According to the KEGG functional annotation and enrichment analysis results, ribosome metabolism, tyrosine metabolism, linoleic acid metabolism, glyoxylic acid and dicarboxylic acid metabolism, and the longevity regulation pathway are all significantly enriched in the OP and HP. This indicates that these processes are crucial in the life cycle of A. bisporus. These findings disclose the molecular regulation mechanism of A. bisporus in different developmental phases while providing potential targets for biological studies and applications in the future. The PPI network of DEPs is conducive to further understanding their interactive relations. In HP vs. BP, gene 182780, gene 114179, gene 200291, and gene 179517 had the most connections with other interactive proteins. Specifically, gene 200291 annotated catalase, increases in catalase expression, and expression changes in proteins related to nucleic acid metabolism and fatty acid metabolism at the proteome level. In fungi, catalase responds to oxidative stress, protects cells, and participates in riboflavin metabolism [40]. Moreover, catalase can regulate the destination of cells by influencing the intracellular redox state, including cell growth, differentiation, and apoptosis [41]. Nitta et al. [42] demonstrated that activity changes in catalase are closely related to the functions and metabolism of organelles. For example, increased catalase activity in adipocytes is related to the shaping and metabolism of lipid droplets. Gene 189264, gene 198315, gene 133112, gene 189640, etc., are described as ribosomal proteins. As an indispensable key tool in protein synthesis, the ribosome is related to the metabolism and synthesis of proteins, plays an important role in regulating the whole life activities of organisms, and is crucial to the growth and development of living bodies [43]. Metabolic pathways such as oxidoreductase activity, glycolysis/gluconeogenesis, the mitogen-activated protein kinase (MAPK) signaling pathway, and the ribosome are considered important pathways in the formation of the primordium of Pleurotus tuoliensis [44]. In Schizophyllum commune hyphae, pathways such as MAPK, phosphatidylinositol signaling, ubiquitin-mediated protein breakdown, autophagy, and the cell cycle play important roles in the primordium formation period [45]. The biosynthesis of secondary metabolites in the primordium phase of Sarcomyxa edulis is active, including the biosynthesis of the proteasome complex, the assembly of the cellular protein complex, oxidative phosphorylation, and the carbon metabolism pathway [46]. A GO functional analysis of DEPs in the BP and OP of A. bisporus was conducted. In the cellular component category, large ribosomal subunits were significantly enriched. In the molecular function category, structural constituents of the ribosome were significantly enriched. In OP vs. BP, proteins 133232 and 11440 had the closest connections with other interactive proteins, and they were both closely related to ribosome biosynthesis. It can be seen that the ribosomal pathway plays an important role in the growth and development of A. bisporus.
This study aimed to disclose the dynamic changes in the gene and protein expressions of “Shuangbao 106” in the BP, OP, and HP via comprehensive transcriptome analysis and proteome analysis. Moreover, it aimed to explore the key genes that control its growth, development, and quality formation. The results deepen our understanding of the growth regulation mechanisms of “Shuangbao 106”, lay a theoretical foundation, and provide practice guidance to improve the output and quality of mushroom varieties based on genetic engineering and molecular biological technology.

5. Conclusions

According to the GO function annotation and enrichment analysis results of the DEGs and DEPs, concerning biological processes, the carbohydrate metabolism process, macromolecular biosynthesis process, and peptide biosynthesis process were significantly enriched. Concerning cell components, the overall components of the membrane and intracellular non-membrane-bound organelles were significantly enriched. Regarding molecular functions, the active function of oxidoreductase was significantly enriched. In the KEGG enrichment analysis, the DEGs and DEPs were mainly enriched in metabolic pathways, such as ribosome metabolism, tyrosine metabolism, and linoleic acid metabolism. During the growth cycle of A. bisporus, the transcript abundance (TPM value) of glycoside hydrolase, catalytic core, and chitinase II declined after the BP, and then during the HP and OP. This may be because mushrooms require more glycoside hydrolase and chitinase II activities during the BP to cope with external threats and cell wall remodeling. In contrast, the growth rate of mushrooms slowed during the HP and OP, and the need for cell wall remodeling decreased; hence, the expression of these enzymes also declined. This change is associated with the need for environmental adaptation, immune defense, and cell wall remodeling and may regulate the post-growth process of A. bisporus via the hydrolysis of cell wall chitin and glycoside hydrolases, inhibiting the elongation of the mushroom stipe as well as the growth of the mushroom pileus. Gene 211935 and gene 208965 were clearly annotated in chitinase II. To further validate these two candidate genes, the RT-qPCR technique was used, and the results showed that the expression pattern was consistent with the transcriptome sequencing data. Therefore, gene 211935 and gene 208965 were identified as candidate genes related to chitinase in A. bisporus, which provides important clues for the subsequent functional resolution and mechanism of action studies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture14122226/s1; Table S1: PCA analysis table of all DEG; Table S2: Correlation heatmap data sheet for all DEPs.; Table S3: GO enrichment analysis of the top 10 DEPs in OP vs. BP.; Table S4:GO enrichment analysis of the top 10 DEPs in HP vs. BP.

Author Contributions

Conceptualization, W.F. and Z.G.; methodology, W.F., Q.J., Y.S., T.S. and M.W.; software, Z.G., W.F. and J.Z.; validation, Z.G. and W.F.; formal analysis, Z.G.; investigation, W.F., Q.J., Y.S., T.S., M.W., W.C., J.Z. and L.F.; resources, W.F. and W.C.; data curation, W.F., Q.J., W.C. and L.F.; writing—original draft preparation, W.F. and Z.G.; writing—review and editing, W.F., Z.G. and W.C.; visualization, Z.G., Y.S., T.S. and M.W.; supervision, W.F., Q.J., W.C., J.Z. and L.F.; project administration, W.F. and W.C.; funding acquisition, W.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the China Agriculture Research System (grant number: CARS-20) and the Zhejiang Science and Technology Major Program on Agriculture New Variety Breeding (grant number: 2021C02073).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The transcriptome data were submitted to NCBI (http://www.ncbi.nlm.nih.gov/ (accessed on 24 November 2024)), login number PRJNA1185483 (BioProject). The proteomic data were stored in the Pro-teomeXchange Consortium via iProX (http://proteomecentral.proteomexchange.org (accessed on 28 November 2024)), PDX number PXD057879.

Acknowledgments

The data presented in this study are available upon request from the corresponding author.

Conflicts of Interest

The authors declare no competing financial interests.

References

  1. Huang, L.; Wei, X.; Chen, Z.H.; Wen, Z.Q. Detection of early disease of Agaricus bisporus based on optimized SVM and BP neural network. J. Fujian Agric. For. Univ. 2022, 51, 857–864. [Google Scholar] [CrossRef]
  2. Cliffe-Byrnes, V.; O’Beirne, D. Effects of gas atmosphere and temperature on the res-piration rates of whole and sliced mushrooms (Agaricus bisporus)—Implications for film permeability in modified atmosphere packages. J. Food Sci. 2007, 72, E197–E204. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, N.; Zhu, Z.X. Research Summary of Effects of Fresh-keeping Treatments on Quality of Agaricus bisporus. Gansu Agric. Sci. Technol. 2017, 9, 63–66. [Google Scholar] [CrossRef]
  4. Feng, W.L.; Cai, W.M.; Jin, Q.L.; Song, T.T.; Fan, L.J.; Shen, Y.Y. ‘Shuangbao 106’, a new cultivated variety of Agaricus bisporus. Mycosystema 2020, 39, 1199–1201. [Google Scholar] [CrossRef]
  5. Wu, X.M.; Li, X.; Li, N.Y. Transcriptome analysis of Agaricus bisporus fruiting at different stages. Mycosystema 2017, 36, 193–203. [Google Scholar] [CrossRef]
  6. Shi, X.K.; Lu, Y.P.; Cai, Z.X.; Guo, Z.J.; Chen, M.Y.; Liao, J.H. Transcriptome Sequencingon Six Agaricus bisporus Strain sat Four Developmental Stages. Fujian J. Agric. Sci. 2017, 34, 775–781. [Google Scholar] [CrossRef]
  7. Cai, Z.X.; Chen, M.Y.; Lu, Y.P.; Guo, Z.J.; Zeng, Z.H.; Liao, J.H.; Zeng, H. Metabolomics and transcriptomics unravel the mechanism of browning resistance in Agaricus bisporus. PLoS ONE 2022, 17, e0255765. [Google Scholar] [CrossRef]
  8. Hao, H.B.; Huang, J.C.; Wang, Q.; Juan, J.X.; Xiao, T.T.; Song, X.X.; Chen, H.; Zhang, J.J. Effects of heat stress on the differential expression of antioxidant enzymes and heat shock protein genes of Agaricus bisporus. Mycosystema 2021, 40, 616–625. [Google Scholar] [CrossRef]
  9. Wu, D.M. Molecular Phylogeneties and Genetic Diversity of Morchella in Xinjiang. China Agric. Univ. 2015. [Google Scholar]
  10. Plaze, D.F.; Lin, C.W.; Velden, N.S.; Aebi, M.; Künzler, M. Comparative transcriptomics of the model mushroom Coprinopsis cinerea reveals tissue-specific armories and a conserved circuitry for sexual development. BMC Genom. 2014, 15, 492–509. [Google Scholar] [CrossRef]
  11. Muraguchi, H.; Umezawa, K.; Niikura, M.; Yoshida, M.; Kozak, T. Strand-specific RNA-Seq analyses of fruiting body development in Coprinopsis cinerea. PLoS ONE 2015, 10, e0141586. [Google Scholar] [CrossRef] [PubMed]
  12. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Michael Cherry, J.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Geneontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
  13. Liu, A.; Chen, Y.; Qi, C.L.; Lyu, X.M.; Wang, W. Comparison of transcriptomes and proteomes in pileus between maturation and stipe elongation stages of Flammulina filiformis. Mycosystema 2023, 42, 312–329. [Google Scholar] [CrossRef]
  14. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
  15. Koonin, E.V.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Krylov, D.M.; Makarova, K.S.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; Rao, B.S.; et al. A comprehensive evolutionary classification of proteins encoded in complete eu-karyotic genomes. Genome Biol. 2004, 5, R7. [Google Scholar] [CrossRef]
  16. Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein-protein interaction networks, integratedover the tree of life. Nucleic Acids Res. 2015, 43, 447–452. [Google Scholar] [CrossRef]
  17. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2015, 13, 2498–2504. [Google Scholar] [CrossRef]
  18. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, 884–890. [Google Scholar] [CrossRef] [PubMed]
  19. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Method. 2015, 12, 357–360. [Google Scholar] [CrossRef]
  20. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie en+ables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
  21. Wan, R.; Hu, Y.P.; Jing, W.X.; Hu, B.; Guo, Q. Proteomic analysis of haploid Ginkgo biloba. J. Cent. South Univ. For. Technol. 2023, 43, 158–165. [Google Scholar] [CrossRef]
  22. Leng, X.M.; Wang, D.H. Changes of Souble Sugar and Protein Contents in Different Parts of Jinju ju be in North Shananxi. J. Northwest Univ. 2019, 34, 105–108. [Google Scholar] [CrossRef]
  23. Li, Q.; Tang, J.S. Bioinformatics-Based Analysis of the Expression and Significance of NOP56 in Hepatocellular CarcinomaThe. J. Med. Theory Pract. 2023, 36, 2529–2531. [Google Scholar] [CrossRef]
  24. Dragon, F.; Gallagher, J.E.G.; Compagnone-Post, P.A.; Mitchell, B.M.; Porwancher, K.A.; Wehner, K.A.; Wormsley, S.; Settlage, R.E.; Shabanowitz, J.; Osheim, Y.; et al. A large nucleolar U3 ribonucleoprotein required for 18S (rRNA) biogenesis. Nature 2002, 417, 967. [Google Scholar] [CrossRef] [PubMed]
  25. Li, C.S.; Geng, Y.H.; Yao, M.; Zhao, B.S.; Xie, S.P.; Xu, C.; Ma, Q.Z.; Zhang, M. Construction of cDNA library of Bipolaris sorokiniana and screening of BsTup1 interacting proteins. J. Henan Agric. Univ. 2024, 58, 218–227. [Google Scholar] [CrossRef]
  26. Li, S.F.; Li, J.; Wang, A.J.; Tian, G.R.; Zhang, C.F. Appropriate filling nitrogen in vacuum combined with heat treatment to delay cell wall degradation of fresh-cut Agaricus bisporus under cold storage. Food Sci. Technol. 2015, 40, 318–324. [Google Scholar] [CrossRef]
  27. Yang, J.W. Mechanism of the regulatory action of chitinase on the post-growth of Agaricus bisporus. In Proceedings of the China 11th Annual International Conference on Food Science, Nanjing, China, 6–8 August 2023; Available online: https://mp.weixin.qq.com/s?__biz=MzAMzQ4Nzk2Nw==&mid=2653112885&idx=3&sn=72ab1af0f0717e228c3cb901a8739cf7&chksm=80763005b701b91303899d3c55d16394637c96040f3b1f694a73621ff3f78b3e6760ccea4e0b&scene=27 (accessed on 10 November 2024).
  28. Sun, Y.; Liu, A.; Chen, Y.; Wang, Q.J.; Wang, W. Combined analyses of transcriptome and proteome during fruiting body development of Flammulina filiformis. Mycosystema 2024. [Google Scholar] [CrossRef]
  29. Zhou, Q.; Wang, L.Y.; Yuan, Q.; Zheng, X.M.; Liu, H.R. Chloroplast Genomic Characteristics of Hibiscus schizopetalus and Phylogenetic Relationships of Hibiscus. Acta Agrestia Sin. 2024. Available online: https://link.cnki.net/urlid/11.3362.S.20241011.1249.006 (accessed on 16 October 2024).
  30. Wang, W.; Liu, F.; Jiang, Y.; Wu, G.; Guo, L.; Chen, R.; Chen, B.; Lu, Y.; Dai, Y.; Xie, B. The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes. Gene 2015, 563, 142–149. [Google Scholar] [CrossRef]
  31. Liu, F.; Cao, D.; Zong, Y.; Li, Y.; Wei, L.; Liu, B.L. RNA-Seq mining differentially expressed genes of riboflavin synthesis pathway in Armillaria luteovirens. Mol. Plant Breed. 2024, 22, 77–84. [Google Scholar] [CrossRef]
  32. Xu, Z.; Liu, J.Y.; Zhang, D.; Wang, R.J.; Pan, Y.J.; Tan, Q.; Shang, X.D. Transcpriptome Comprison of Differentially Expressed Genes in the Mycelial Stages of Flammulina velutipes Monokaryon 3_M and the Hybrid Dikaryon G1. Acta Edulis Fungi 2016, 23, 1–6. [Google Scholar] [CrossRef]
  33. Zhang, M.F.; Liu, F.; Wang, Q.J.; Yan, J.J.; Wang, W.; Qian, Y.C.; Huang, Q.H. Characterization and expression analysis of small GTPases families in Flammulina velutipes. Genom. Appl. Bio. 2020, 39, 5781–5788. [Google Scholar] [CrossRef]
  34. Liu, H.J.; You, X.X.; Ge, Y.J.; Shang, X.D.; Tan, Q. Transcriptomic Analysis of Genes Related to Lignocellulose Degradation in Lentinula edodes. Acta Edulis Fungi 2024, 31, 33–45. [Google Scholar]
  35. Chen, J.Y.; Duan, Y.M.; Zhou, Y.; Xiao, Y.; Bian, Y.B.; Gong, Y.H. Identification, expression and function analysis of ALDH gene family in Lentinula edodes. Acta Hortic. Sin. 2024, 51, 1033–1046. [Google Scholar] [CrossRef]
  36. Chen, J.; Liu, S.S.; Kohler, A.; Yan, B.; Luo, H.M.; Chen, X.M.; Guo, S.X. iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae). J. Proteome Res. 2017, 16, 2174–2187. [Google Scholar] [CrossRef]
  37. Li, J.; Ren, L.; Gao, Z.; Jiang, M.M.; Liu, Y.; Zhou, L.; He, Y.J.; Chen, H.Y. Combined transcriptomic and proteomic analysis constructs a new model for light-induced anth-ocyanin biosynthesis in egg-plant (Solanum melongena L.). Plant Cell Environ. 2017, 40, 3069–3087. [Google Scholar] [CrossRef]
  38. Peng, Z.; He, S.P.; Gong, W.F.; Xu, F.F.; Pan, Z.E.; Jia, Y.H.; Geng, X.L.; Du, X.M. Integration of proteomic and transcriptomic profiles reveals multiple levels of genetic regulation of salt tolerance in cotton. BMC Plant Biol. 2018, 18, 128. [Google Scholar] [CrossRef]
  39. Chen, M.Y.; Liao, J.H.; Li, H.R.; Cai, Z.X.; Guo, Z.J.; Wang, Z.S. Developmental proteomics analysis of the button mushroom Agaricus bisporus. Mycosystema 2015, 34, 1153–1164. [Google Scholar] [CrossRef]
  40. Gao, Y.N.; Zhu, F.M.; Li, J. Whole-genome sequencing and analysis of a thermotolerant strain Aspergillus niger 3. 316. Mycosystema 2021, 40, 1737–1750. [Google Scholar] [CrossRef]
  41. Yang, J.; Fan, X.M.; Zhang, Q.X.; Feng, K.X.; Yang, Y.Q.; Song, B.; Wu, J.Z. The molecular mechanism of ginkgolide B regulating the expression of long-chain fatty acid metabolism-related proteins and antioxidant therapy for non-alcoholic fatty liver disease. Acta Pharm. Sin. 2021, 56, 1057–1062. [Google Scholar] [CrossRef]
  42. Nitta, Y.; Muraoka-Hirayama, S.; Sakurai, K. Catalase is required for peroxisome maintenance during adipogenesis. Mol. Cell Biol. Lipids 2020, 1865, 158726. [Google Scholar] [CrossRef] [PubMed]
  43. Uechi, T.; Tanaka, T.; Kenmochi, N. A complete map of the human ribosomal protein genes:assignment of 80 genes to the cytogenetic map and implications for human disorders. Genomics 2001, 72, 223–230. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, C.X.; Zhou, J.K.; Cao, Z.J.; Hu, B.; Wang, J.; Guo, J.Y.; Zheng, S.Y. De Novo assembly transcriptome analysis reveals the preliminary molecular mechanism of primordium formation in Pleurotus tuoliensis. Genes 2022, 13, 1747. [Google Scholar] [CrossRef] [PubMed]
  45. Wu, T.H.; Chen, J.; Jiao, C.W.; Hu, H.P.; Wu, Q.P.; Xie, Y.Z. Identification of long non-coding RNAs and their target genes from mycelium and primordium in model mushroom Schizophyllum commune. Mycobiology 2022, 50, 357–365. [Google Scholar] [CrossRef] [PubMed]
  46. Duan, C.; Yao, L.; Lv, J.H.; Jia, X.W.; Tian, F.H.; Li, C.T. Systematic analysis of changes across different developmental stages of the mushroom Sarcomyxa edulis. Gene 2022, 824, 146450. [Google Scholar] [CrossRef]
Figure 1. (A) BP; (B) HP; (C) OP.
Figure 1. (A) BP; (B) HP; (C) OP.
Agriculture 14 02226 g001
Figure 2. (A) PCA charts of all DEGs; (B) correlation heat map analysis of all DEPs.
Figure 2. (A) PCA charts of all DEGs; (B) correlation heat map analysis of all DEPs.
Agriculture 14 02226 g002
Figure 3. Volcano plots: (A) DEGs in OP vs. BP; (B) DEGs in HP vs. BP; (C) DEPs in OP vs. BP; (D) DEPs in HP vs. BP.
Figure 3. Volcano plots: (A) DEGs in OP vs. BP; (B) DEGs in HP vs. BP; (C) DEPs in OP vs. BP; (D) DEPs in HP vs. BP.
Agriculture 14 02226 g003
Figure 4. Venn diagrams: (A) DEGs; (B) DEPs; (C) DEGs and DEPs in HP vs. BP; (D) DEGs and DEPs in OP vs. BP.
Figure 4. Venn diagrams: (A) DEGs; (B) DEPs; (C) DEGs and DEPs in HP vs. BP; (D) DEGs and DEPs in OP vs. BP.
Agriculture 14 02226 g004
Figure 5. GO enrichment analysis of DEGs in OP vs. BP.
Figure 5. GO enrichment analysis of DEGs in OP vs. BP.
Agriculture 14 02226 g005
Figure 6. GO enrichment analysis of DEGs in HP vs. BP.
Figure 6. GO enrichment analysis of DEGs in HP vs. BP.
Agriculture 14 02226 g006
Figure 7. GO enrichment analysis of DEPs in OP vs. BP. (Each box represents a GO term, i.e., a specific concept or classification in GO. The color-coded box indicates a GO term that is significantly enriched in a particular gene set; the closer the color is to red, the higher the enrichment degree of the GO term in the gene set, i.e., the stronger the correlation between the GO term and the gene set. is_a: a containment relationship, indicated by a black arrow; part_of: a part of the whole relationship, indicated by a blue arrow; occurs in: used to describe the occurrence of a gene or protein in a particular biological process, cellular component, or molecular function. Refers to an existential relationship; regulates: the relationship of one process affecting another process, classified as negative or positive regulation).
Figure 7. GO enrichment analysis of DEPs in OP vs. BP. (Each box represents a GO term, i.e., a specific concept or classification in GO. The color-coded box indicates a GO term that is significantly enriched in a particular gene set; the closer the color is to red, the higher the enrichment degree of the GO term in the gene set, i.e., the stronger the correlation between the GO term and the gene set. is_a: a containment relationship, indicated by a black arrow; part_of: a part of the whole relationship, indicated by a blue arrow; occurs in: used to describe the occurrence of a gene or protein in a particular biological process, cellular component, or molecular function. Refers to an existential relationship; regulates: the relationship of one process affecting another process, classified as negative or positive regulation).
Agriculture 14 02226 g007
Figure 8. GO enrichment analysis of DEPs in HP vs. BP. (Each box represents a GO term, i.e., a specific concept or classification in GO. The color-coded box indicates a GO term that is significantly enriched in a particular gene set; the closer the color is to red, the higher the enrichment degree of the GO term in the gene set, i.e., the stronger the correlation between the GO term and the gene set. is_a: a containment relationship, as indicated by a black arrow; part_of: a part of the whole relationship, as indicated by a blue arrow; occurs in: used to describe the occurrence of a gene or protein in a particular biological process, cellular component, or molecular function. Refers to an existential relationship; regulates: the relationship of one process affecting another process, classified as negative or positive regulation).
Figure 8. GO enrichment analysis of DEPs in HP vs. BP. (Each box represents a GO term, i.e., a specific concept or classification in GO. The color-coded box indicates a GO term that is significantly enriched in a particular gene set; the closer the color is to red, the higher the enrichment degree of the GO term in the gene set, i.e., the stronger the correlation between the GO term and the gene set. is_a: a containment relationship, as indicated by a black arrow; part_of: a part of the whole relationship, as indicated by a blue arrow; occurs in: used to describe the occurrence of a gene or protein in a particular biological process, cellular component, or molecular function. Refers to an existential relationship; regulates: the relationship of one process affecting another process, classified as negative or positive regulation).
Agriculture 14 02226 g008
Figure 9. KEGG enrichment analysis: (A) DEGs in HP vs. BP; (B) DEGs in OP vs. BP; (C) DEPs in HP vs. BP; (D) DEPs in OP vs. BP.
Figure 9. KEGG enrichment analysis: (A) DEGs in HP vs. BP; (B) DEGs in OP vs. BP; (C) DEPs in HP vs. BP; (D) DEPs in OP vs. BP.
Agriculture 14 02226 g009
Figure 10. Biosynthetic pathways of eukaryotic ribosomes (Rectangular boxes indicate genes or proteins; green fill refers to the proteins identified in this instance; red markers refer to up-regulation; blue markers refer to down-regulation; circles indicate chemical compound DNA and other molecule; solid arrows indicate molecular interaction or relation; dashed arrows indicate indirect link or unknown reaction. http://www.genome.jp/kegg/, accessed on 25 November 2024).
Figure 10. Biosynthetic pathways of eukaryotic ribosomes (Rectangular boxes indicate genes or proteins; green fill refers to the proteins identified in this instance; red markers refer to up-regulation; blue markers refer to down-regulation; circles indicate chemical compound DNA and other molecule; solid arrows indicate molecular interaction or relation; dashed arrows indicate indirect link or unknown reaction. http://www.genome.jp/kegg/, accessed on 25 November 2024).
Agriculture 14 02226 g010
Figure 11. Real-time fluorescence quantitative PCR: (A) DEGs in HP vs. BP; (B) DEGs in OP vs. BP. The testing method uses two-way ANOVA and Tukey. Different letters in the same group show significant differences (p < 0.05). The lowercase letters show the statistical differences.
Figure 11. Real-time fluorescence quantitative PCR: (A) DEGs in HP vs. BP; (B) DEGs in OP vs. BP. The testing method uses two-way ANOVA and Tukey. Different letters in the same group show significant differences (p < 0.05). The lowercase letters show the statistical differences.
Agriculture 14 02226 g011
Figure 12. PPI network of DEPs: (A) HP vs. BP; (B) OP vs. BP. Up-regulated proteins are expressed in red, and down-regulated proteins are expressed in green. The circle size represents the degree of connectivity, where a larger circle represents a higher degree of connectivity.
Figure 12. PPI network of DEPs: (A) HP vs. BP; (B) OP vs. BP. Up-regulated proteins are expressed in red, and down-regulated proteins are expressed in green. The circle size represents the degree of connectivity, where a larger circle represents a higher degree of connectivity.
Agriculture 14 02226 g012
Table 1. Primer sequences used in fluorescence quantitative PCR.
Table 1. Primer sequences used in fluorescence quantitative PCR.
Reverse Primer GC%Forward Primer GC%Tm °CReverse PrimerForward PrimerGene Name
59.96259.98920GCAGAACCAGCACCCATAATCATAGACCCAGCCAGGTGTTGene62584
59.98959.93120TTTCCGTCAGTGAGCCTCTTGAATTGACGCACAATCATGGGene201037
59.97859.95520CCAGCACGAGAAATAGCCTCCATACTCCTCGGGTTTGCATGene189449
59.96259.95520AAGCTATGCCCAACACCATCTCCGACTCTGCGAATTTCTTGene208965
59.99759.93120ACATCGGTACCAGGCTTGACTTGCCACCCCTCTTATTTTGGene192199
59.93859.95520TAATGGAAACGAACAAGCCCTCCTTACGCCATACTGGACCGene194243
59.93959.92420AGGTCGGCATCATCAAAAACCAATGCACCAATCAATCAGGGene212840
59.95959.99720TGGTAGAAGTGAGGGTTGGGGACTTGTATCACCGTGGCCTGene225220
59.93859.80320TGTTCGAAAACAATAGGGGCTGAAACTGGAGATCCTGCCTGene191563
59.80359.98520GACAGCTCGGATATTGGCTCAATCAGCTTCAAGCGACGATGene144304
59.96059.99320TCAATAACCTAACGTCCGGCATTGTGTTACGCCCTCCTTGGene211936
59.92559.97820AGGGGCGATACCTTGAGAATGATCTGCGAGGCTGTTAAGGGene115052
Table 2. Statistics of comparison rate between reads and reference genome.
Table 2. Statistics of comparison rate between reads and reference genome.
SampleTotal ReadsTotal MappedQ20 (%)Q30 (%)Uniquely Mapped
BP_159,014,42093.10%98.394.8588.40%
BP_252,313,30293.44%98.394.8483.91%
BP_358,005,52292.88%98.2994.8489.00%
HP_161,587,11091.85%98.394.8689.41%
HP_242,241,77892.07%98.3294.9189.20%
HP_354,095,07692.41%98.8896.3390.79%
OP_145,912,31292.95%98.8196.1191.22%
OP_246,479,74292.91%98.7996.0790.85%
OP_351,318,34092.55%98.8696.2890.92%
Note: (1) Total reads: the number of sequences after filtering and sequencing sequences (i.e., clean reads); (2) total mapped: the number of clean reads that can be localized to the genome; (3) uniquely mapped: the number of clean reads that have a unique comparison position on the reference sequence; (4) Q20 (%) and Q30 (%): quality assessment of sequencing data after quality control. Q20 and Q30 refer to the percentage of total bases with a sequencing quality above 99% and 99.9%, respectively. Generally, a Q20 above 85% and a Q30 above 80% indicate a good sequencing quality.
Table 3. TPM values of genes in BP vs. HP.
Table 3. TPM values of genes in BP vs. HP.
BP vs. HP
IDBP_tpmHP_tpmlog2FCRegulationDescription
Gene2128402.4 ± 0.99.2 ± 3.81.9UpAldehyde dehydrogenase
Gene22522017.6 ± 0.797.8 ± 52.42.4UpAcyl-CoA dehydrogenase/oxidase, central region
Gene1915631.4 ± 0.611.7 ± 1.53.2UpAldose 1-epimerase
Gene1443045.9 ± 1.21 ± 0.2−2.5DownGlycoside hydrolase, catalytic core
Gene211936383.5 ± 293.771.6 ± 29.6−2.5DownChitinase II
Gene11505224.3 ± 58.3 ± 1−1.6Down2-isopropylmalate synthase LeuA, allosteric (dimerization) domain
Note: The data are represented as means ± standard deviation. log2FC means log2FoldChange values.
Table 4. TPM values of genes in BP vs. OP.
Table 4. TPM values of genes in BP vs. OP.
BP vs. OP
IDBP_tpmOP_tpmlog2FCRegulationDescription
Gene625846.9 ± 1.2209.8 ± 334.5UpMalic enzyme, conserved site
Gene2010375.1 ± 186.7 ± 10.24.0UpGlyoxalase/bleomycin resistance protein/dioxygenase
Gene1894493185.8 ± 1352.2449.3 ± 23.2−3.2DownGlycoside hydrolase, catalytic core
Gene208965126.8 ± 55.447.6 ± 5.2−1.8DownChitinase II
Gene192199293.7 ± 42.2127 ± 12.3−1.6DownMyo-inositol-1-phosphate synthase
Gene19424328 ± 1213.4 ± 1.6−1.4DownMalic enzyme, conserved site
Note: The data are represented as means ± standard deviation. log2FC means log2FoldChange values.
Table 5. Encoding gene annotations of DEPs.
Table 5. Encoding gene annotations of DEPs.
Gene IDGene NameGene DescriptionKO Name
Gene 200291estExt_Genewise1Plus.
C_21759
CatalasekatE, CAT, catB, srpA
Gene 135027fgenesh2_kg.3_#_572_#_2_1958_
CFAF_CFAG_CFAH_EXTA
Di-copper center-containingTYR
Gene 195196estExt_fgenesh2_kg.C_110188D-arabinono-1,4-lactone oxidaseGULO
Gene 181881estExt_fgenesh2_pm.C_10070Small-subunit processome, Utp14UTP14
Gene 187767estExt_fgenesh2_pm.C_100264Pyruvate carboxyltransferaseHMGCL, hmgL
Gene 188880estExt_fgenesh2_pm.C_160025Malate synthaseaceB, glcB
Gene 77750e_gw1.13.215.1Alkyl hydroperoxide reductase/thiol-specific antioxidant/Mal allergen------
Gene 202648estExt_Genewise1Plus.C_40634Acyl carrier protein-like------
Gene 182780estExt_fgenesh2_pm.C_10980DEAD-like helicase, N-terminalDBP3
Gene 179517estExt_fgenesh2_pg.C_70452NOP5, N-terminalNOP56
Gene 120049Genemark.6517_gDi-copper center-containingTYR
Gene 219773estExt_Genewise1.C_40808Glycoside hydrolase/deacetylase, beta/alpha-barrelE3.5.1.41
Gene 180088estExt_fgenesh2_pg.C_90216Aminotransferase, class V/cysteine desulfuraseAGXT
Gene 74558e_gw1.9.216.1RNA recognition motif, RNP-1------
Gene 114179Genemark.647_g(rRNA) methyltransferase RrmJ/FtsJSPB1, FTSJ3
Gene 194017estExt_fgenesh2_kg.C_70522Acyl carrier protein-like------
Gene 207393estExt_Genewise1Plus.C_70929Superoxide dismutase, copper-/zinc-bindingSOD1
Gene 227531estExt_Genewise1.C_110745Chitinase IIE3.2.1.14
Gene 229666estExt_Genewise1.C_160245Heme peroxidaseE1.11.1.5
Gene 194055estExt_fgenesh2_kg.C_80007Di-copper center-containingTYR
Gene 213339estExt_Genewise1.C_10125Armadillo-type foldPUM
Gene 142473fgenesh2_pg.4_#_299RNA recognition motif, RNP-1NCL, NSR1
Gene 190063estExt_fgenesh2_kg.C_10950ThiolaseSCP2, SCPX
Gene 189264estExt_fgenesh2_kg.C_10133Ribosomal protein S4RP-S9e, RPS9
Gene 198315estExt_Genewise1Plus.C_12086Ribosomal protein S27eRP-S27e, RPS27
Gene 189249estExt_fgenesh2_kg.C_10117-RP-L28e, RPL28
Gene 133112fgenesh2_kg.1_#_574_#_2_2442_
CFAF_CFAG_CFAH_EXTA
Ribosomal protein L13RP-L13Ae, RPL13A
Gene 133452fgenesh2_kg.1_#_914_#_2249_1_C
FAF_CFAG_CFAH_EXTA
Zinc finger, Tim10/DDP-typeTIM10
Gene 147857fgenesh2_pm.1_#_684Zinc finger, Tim10/DDP-typeTIM8
Gene 189640estExt_fgenesh2_kg.C_10515Ribosomal protein L15eRP-L15e, RPL15
Gene 114401Genemark.869_gRibosomal protein S9RP-S16e, RPS16
Gene 133015fgenesh2_kg.1_#_477_#_2_1978_
CFAF_CFAG_CFAH_EXTA
Nucleic acid-binding, OB-fold-likeRP-S11e, RPS11
Gene 133232fgenesh2_kg.1_#_694_#_2_396_
CFAF_CFAG_CFAH_EXTA
Ribosomal protein S14RP-S29e, RPS29
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Feng, W.; Guo, Z.; Jin, Q.; Shen, Y.; Song, T.; Wang, M.; Zhang, J.; Fan, L.; Cai, W. A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases. Agriculture 2024, 14, 2226. https://doi.org/10.3390/agriculture14122226

AMA Style

Feng W, Guo Z, Jin Q, Shen Y, Song T, Wang M, Zhang J, Fan L, Cai W. A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases. Agriculture. 2024; 14(12):2226. https://doi.org/10.3390/agriculture14122226

Chicago/Turabian Style

Feng, Weilin, Zier Guo, Qunli Jin, Yingyue Shen, Tingting Song, Mei Wang, Jun Zhang, Lijun Fan, and Weiming Cai. 2024. "A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases" Agriculture 14, no. 12: 2226. https://doi.org/10.3390/agriculture14122226

APA Style

Feng, W., Guo, Z., Jin, Q., Shen, Y., Song, T., Wang, M., Zhang, J., Fan, L., & Cai, W. (2024). A Comparative Transcriptomic and Proteomic Analysis of the Pileus of Agaricus bisporus During Its Different Developmental Phases. Agriculture, 14(12), 2226. https://doi.org/10.3390/agriculture14122226

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop