Next Article in Journal
Factors Affecting the Ig Content of Sow’s Colostrum: A Systematic Review and Meta-Analysis
Previous Article in Journal
Non-Destructive PTR-ToF-MS Profiling of Red Delicious and Granny Smith Apple Volatilomes During Ripening
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 6
10.3390/agriculture15060639
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mycobiome and Pathogenic Fusarium Fungi in the Rhizosphere of Durum Wheat After Seed Dressing with Debaryomyces hansenii

by
Weronika Giedrojć
and
Urszula Wachowska
*
Department of Entomology, Phytopathology and Molecular Diagnostics, Faculty of Agriculture and Forestry, University of Warmia and Mazury in Olsztyn, Prawocheńskiego 17, 10-720 Olsztyn, Poland
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(6), 639; https://doi.org/10.3390/agriculture15060639
Submission received: 2 February 2025 / Revised: 21 February 2025 / Accepted: 28 February 2025 / Published: 18 March 2025
(This article belongs to the Section Seed Science and Technology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Debaryomyces hansenii naturally colonize wheat grain and can potentially inhibit the pathogens responsible for Fusarium crown rot (FCR). Seed dressing is a recommended method for protecting crops against FCR pathogens. The effectiveness of seed dressing with antagonistic yeasts in reducing the incidence of FCR remains insufficiently investigated. The aim of this study was to evaluate the effect of seed dressing with a triazole fungicide and a suspension of D. hansenii cells on the health status and development of durum wheat cultivars (Durasol and Floradur), and to analyze the structure of the mycobiome in the rhizosphere of seedlings. Under field conditions, the incidence of FCR was reduced by 57.1% by triticonazole and 35.7% by the biocontrol agent relative to the control treatment. Seed dressing with D. hansenii decreased the number of operational taxonomic units (OTUs) of Fusarium pathogens by 47.24% in cv. Durasol and 87.4% in cv. Floradur. The number of OTUs of autochthonous yeast species and Mortierellomycota increased in the rhizosphere of both durum wheat cultivars. The effectiveness of seed dressing with yeasts is determined by the quality and local adaptation of biocontrol agents.

1. Introduction

Durum wheat is a not a traditional crop in countries with a temperate climate, but the growing demand for pasta and groats has increased the interest in this cereal species in the farming sector [1]. Durum wheat is particularly susceptible to pathogens that can be transported with grain and can infect seedlings, stems, leaves, and spikes during plant growth. Fungal pathogens of the genus Fusarium pose the greatest threat to durum wheat [2]. Fusarium head blight (FHB), Fusarium leaf spot (FLS), Fusarium root rot (FRR), and Fusarium crown rot (FCR) decrease grain yields and lead to significant economic losses [3]. Infected grain is discolored and shriveled, and grain proteins are degraded by fungi, which additionally decreases the quality and functionality of cereal products [4]. Pathogens colonize the surface of grain, but they can also penetrate the aleurone layer and the endosperm [5]. Grain can also be contaminated with mycotoxins produced by fungi of the genus Fusarium, including trichothecenes such as deoxynivalenol (DON), zearalenone (ZEA), and nivalenol (NIV), which are harmful for both humans and animals [6]. When contaminated seeds are sown in the field, wheat stands can become infected in the following year because pathogens can spread in the soil in the early stages of seedling development and pose a significant threat [2,3].
Plants are currently considered as holobionts, and microbial communities interact and evolve with the host to stimulate its development [7]. Microorganisms influence plant anatomy and physiology and contribute to inducing plant immunity [8]. Rhizosphere fungi are also a key component of sustainable agriculture. Crops affect the mycobiome, but the underlying mechanism of their action remains largely unknown [9]. Seed-borne microorganisms can also contribute to microbiome development, but their effects vary across wheat species and varieties [10] and soil types [11]. Johnston-Monje et al. [12] found that seed-borne bacteria and fungi play a key role in the microbiome of young plants. Recent research has shown that vertical transmission of seed-borne microorganisms significantly influences the plant microbiome [10]. Johnston-Monje et al. [12] analyzed the microbiome of maize seedlings and found that seed endophytes may colonize other plant tissues and can be transmitted between tissues and secreted by roots to colonize the rhizosphere.
Integrated (chemical and biological) crop protection methods are applied in contemporary agriculture, and varieties that are less susceptible to pathogenic infections are selected to minimize the environmental impact of plant protection products [13]. Seed dressing is one of the simplest and most effective methods of protecting seedlings against pathogens [14,15]. Crop protection chemicals can be harmful for the environment [16], which is why biological disease control methods should be introduced to agricultural practice [17]. This goal can be achieved by manipulating microbial communities in the wheat rhizosphere [15,18,19]. The microbiome, namely the microbial communities colonizing the rhizosphere, can improve the health of host plants by supplying essential nutrients [20] and increasing plants’ resistance to abiotic stresses [20,21] and pathogens [22]. To minimize the use of potentially harmful agricultural chemicals, a set of policy initiatives known as the European Green Deal has been introduced to promote organic farming and biological preparations containing plant-growth-promoting rhizobacteria (PGPR) [9]. The widespread use of PGPR can decrease the global consumption of agrochemicals and pesticides [21]. Moreover, this technology is widely available to farmers in both developed and developing countries. In addition to promoting plant growth, PGPR can also be used in the bioremediation of soils contaminated with heavy metals and pesticides [23,24]. Seed dressing with a suspension of soil yeasts [25] and endophytic yeasts [26] could be one of such methods. Previous research has shown that Debaryomyces hansenii (Zopf) Lodder et Kreger van Rij yeasts exhibit antagonistic activity against Fusarium pathogens in durum wheat [6], Botrytis cinerea and Penicillium expansum pathogens in kiwi fruit [27], and Monilinia fructicola in apples [28]). The yeast D. hansenii has shown significant results as a biocontrol agent by diverse mechanisms of action, such as competition for space (i.e., inhibition of spore germination) and nutrients, secondary metabolite excretion (i.e., volatile organic compounds), or induction of antioxidant enzymes in muskmelons to reduce the rot caused by F. proliferatum. [29,30]. Debaryomyces hansenii is often identified in dairy products, and it has been granted a Qualified Presumption of Safety (QPS) status by the European Food Safety Authority (EFSA) [31,32]. The aim of this study was to: (1) analyze the mycobiome composition rhizosphere of durum wheat seedlings, (2) evaluate changes in the communities of pathogens, yeasts, and fungi of the phyla Mucoromycota and Mortierellomycota, and Trichoderma spp. in the grain of two durum wheat cultivars treated with a triazole fungicide and a suspension of Debaryomyces hansenii cells, (3) assess stem base health in durum wheat, (4) perform a mycological analysis of durum wheat stem bases and grain, and (5) analyze selected yield parameters in durum wheat plants.

2. Materials and Methods

2.1. Site Description, Agricultural Practices, Weather Conditions, and Sampling

Durum wheat was grown between April and August 2020 in a plot experiment established in Tomaszkowo near Olsztyn (53°42′43.794″ N, 20°26′6.371″ E). The analyzed period was generally characterized by a favorable temperature for durum wheat growth. The average temperature was 7.2, 10.2, 18.3, 17.5, and 18.9 °C, and the maximum temperature reached 22.9, 22.5, 28.9, 29.3, and 30.9 °C in successive months of the growing season (Figure S1). Sub-zero temperatures were noted in April and May, but durum wheat plants were not negatively affected by this abiotic factor. April and May were dry months (total monthly precipitation of 5.7 mm each), which inhibited the development of durum wheat seedlings. In turn, abundant precipitation (104.5 mm) was noted in the flowering stage (June). Precipitation reached 79.9 and 58.9 mm in successive months of the growing season.
The experiment had a split-plot design with four replications for each experimental factor, i.e., cultivar and seed treatment. The experimental plots consisted of concrete pots (1.5 × 2 m) buried in the soil. In each plot, seedlings and roots were sampled from an area of approximately 0.5 m2. The experimental factor was the durum wheat cultivar (spring cvs. Floradur—more resistant—and Durasol—less resistant, [33]), and the second factor was the seed treatment method. The chemical treatment involved the Triter 050 FS systemic fungicide (active ingredient: triticonazole, a triazole group fungicide), which was applied at 50 g/L (4.9%; Chemirol Sp. z o.o., Mogilno, Poland) according to the manufacturer’s recommendations. In the biological treatment (Biol), durum wheat seeds were immersed in a suspension of Debaryomyces hansenii 2 cells (GenBank accession number KX444669). The control treatment was plants grown from untreated and uninfected seeds. Wheat was grown according to good agricultural practice, as described by Wachowska et al. [34]. Samples of durum wheat roots and rhizosphere soil were collected in the two leaves unfolded stage (BBCH 12, [35]). The samples for DNA isolation were stored at a temperature of −80 °C.

2.2. Preparation of the Debaryomyces hansenii Suspension for the Biological Treatment

The Biol treatment was a suspension of Debaryomyces hansenii 2 cells (GenBank accession number KX444669) isolated from apples cv. Antonówka. Yeast cells were grown on potato dextrose agar (PDA, A&A Biotechnology, Gdańsk, Poland) with 150 μg/cm3 of streptomycin (Serva, Heidelberg, Germany) and 75 μg/cm3 of kanamycin (A&A Biotechnology, Gdańsk, Poland). Petri plates (FLMedical, Torreglia, Italy) were incubated at a temperature of 27 °C in the dark for 7 days in an incubator (Pol-Eko, Wodzisław Śląski, Poland). The suspension was prepared according to the procedure described by Wachowska et al. [6]. Suspension density was estimated at 106 cells in 1 cm3 of sterile water by counting yeast cells in the Thoma chamber (Marienfeld, Lauda-Königshofen, Germany). Seeds were soaked in the suspension of D. hansenii cells for three hours directly before sowing.

2.3. Soil Characteristics

The soil in the experimental plots was characterized by a low content of organic carbon, average content of humus (Table 1), slightly acidic pH (6.2), very high content of K2O (41 mg/100 g of soil) and P2O5 (36 mg), and low content of iron (Fe). The content of the remaining micronutrients was average (Mg, Mn, Cu) or high (Zn).

2.4. DNA Isolation from Soil

Seedling roots and rhizosphere soil covering the roots (10 g) were ground in liquid nitrogen. Fungal DNA was isolated with the Soil DNA Purification Kit (EURx Ltd., Gdańsk, Poland) according to the manufacturer’s instructions [9]. The samples were homogenized mechanically in bead tubes with the use of the Star Beater for Molecular Biology (Bio-Strategy Ltd., Part of DKSH Group, Hobsonville, Auckland, New Zealand). The quantity and quality of the isolated DNA were checked by measuring absorption at a wavelength of 260 nm and 280 nm (NanoDrop 2000, Thermo Scientific, Warsaw, Poland). DNA was stored at a temperature of −20 °C.

2.5. Amplification of DNA Fragments by PCR

The metagenomic sequencing analysis of the hypervariable ITS2 region in fungi was conducted according to a previously described method [9]. The selected region was amplified, and the library was prepared with the use of fungi-specific primers fITS7 (GTGARTCATCGAATCTTTG) and ITS4 (TCCTCCGCTTATTGATATGC), supplemented with an overhang adapter sequence at the 5′ end of each primer. PCR was conducted with the use of the Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Warsaw, Poland). Dual-indexed libraries were prepared with the Nextera XT Index Kit (Illumina, Warsaw, Poland).

2.6. Illumina MiSeq Sequencing

Paired-end (PE) DNA sequencing was performed in the MiSeq sequencer (Illumina, Poland) (2 × 250 bp) with the Illumina Kit v2 (Genomed, Warsaw, Poland). The sequencing procedure was described previously by Wachowska and Rychcik [9]. Fungal DNA was sequenced by Genomed, a biotechnology company (www.genomed.pl, accessed on 14 June 2020).

2.7. Analysis of Selected Biometric Parameters and the Yield Potential of Durum Wheat

The number of emerged seedlings was counted in the two leaves unfolded stage (BBCH 120) [38], and the yield potential of durum wheat was estimated by calculating the Normalized Difference Vegetation Index (NDVI) [39]. The NDVI was calculated with the use of the formula proposed by Sultana et al. [40], and it ranged from −1 (water) to +1 (strongest vegetative growth). The measurements were conducted with a portable spectrometer (Photo Systems Instruments, PolyPen RP, Poznań, Poland). A total of 72 measurements were performed (12 in each plot).
In the fully ripe stage (BBCH 89), plants for the biometric analysis and the assessment of stem base health were sampled from 30 cm-long sections in three rows. The collected plants were counted to estimate the number of spikes per m2. Plant height was measured, and spike density was calculated based on the number of spikelets per 10 cm of spike length.

2.8. Analysis of Stem Base and Grain Health

Stem base health was analyzed two weeks before durum wheat harvest. Leaf sheaths were removed from the base of the stem, and a phytopathological analysis was conducted on a four-point scale proposed by the European and Mediterranean Plant Protection Organization (1/28(3), EPPO), where 0 points—no symptoms of infection on the stem surface, 1 point—single lesions covering up to 25% of stem surface, 2—several lesions covering around 26–50% of stem surface, 3—strongly infected, rotting stems [41]. Grain health was evaluated macroscopically, and kernels with dark discoloration, damaged kernels, weakly filled kernels, and shriveled kernels with pink discoloration were regarded as infected. Grain health was assessed by estimating the percentage of infected kernels.

2.9. Mycological Analysis of the Stem Base and Grain

The mycological analysis was conducted by the culture method. Infected segments with a length of 5–7 mm were cut out from stems with a scalpel. Infected stem segments and infected kernels were surface disinfected in 75% ethanol (Stanlab, Lublin, Poland) for 1 minute and 2% sodium hypochlorite (Chempur, Piekary Śląskie, Poland) for 2 min. Disinfected kernels and stem sections were rinsed with sterile water three times, dried on blotting paper (Eurochem BGD, Tarnów, Poland), placed on PDA, and incubated at a temperature of 24 °C for 7 days. The analysis was conducted in four replicates. Pathogens were identified under the Nikon Eclipse E200 light microscope based on sporulation characteristics. Pathogens were classified with the use of dichotomous keys and literature data [42,43].

2.10. Statistical Analysis

Data were processed by analysis of variance (ANOVA) and principal component analysis (PCA) in the Statistica 13 program. The significance of differences between means was evaluated by Tukey’s test (p < 0.001) for stem base health, grain health, and the percentage of kernels colonized by fungi, and by Duncan’s test (p < 0.01) for agronomic traits (number of seedlings, NDVI, plant density, plant height, yield). The Shannon–Wiener diversity index (Hw) was calculated from the equation Hw = −∑pi(ln pi), where pi is the proportion of individuals found in the ith OUT [9]. The similarities between fungal communities in the analyzed samples were determined based on normalized Euclidean distances. The relationships between fungal taxonomic and functional groups vs. the agronomic traits of durum wheat, stem base health, and grain health were determined by calculating Spearman’s correlation coefficients.

3. Results

3.1. Fungal Community Profiles

The profiles of all fungal communities isolated from the rhizosphere soil of durum wheat cvs. Durasol and Floradur grown from fungicide-treated (Fung) and biologically treated (Biol) seeds were compared. The comparison revealed that the majority of operational taxonomic units (OTUs) belonged to the phyla Ascomycota (47.12% of total OTUs), Mortierellomycota (25.95%%), and Basidiomycota (15.73%) (Table 2). Mucoromycota reads accounted for 10.44% of all OTUs. The remaining reads were classified to the phyla Aphelidiomycota (0.0008%), Chytridiomycota (0.098%), Olpidiomycota (0.002%), and Zoopagomycota (0.003%), and they accounted for less than 0.11% of the total number of reads. In total, 718,310 high-quality ITS2 sequences were obtained from all rhizosphere samples. The fungal communities isolated from the rhizosphere soil of both durum wheat cultivars grown from biologically treated (Biol) seeds were more diverse than the fungal communities isolated from the control treatment and the fungicide (Fung) treatment. In the Biol treatment, the Shannon–Wiener diversity index was determined at 1.309 for cv. Floradur and 1.670 for cv. Durasol (Table 2). The Fung treatment decreased the Shannon–Wiener diversity index to 1.218 in cv. Floradur and 1.204 in cv. Durasol, relative to the Biol treatment.
The fungal community colonizing the rhizosphere of durum wheat seedlings was composed of 270 identified fungal species of the phyla Ascomycota (160 species), Basidiomycota (88), Chytridiomycota (4), Mortierellomycota (8), Mucoromycota (9), and Olpidiomycota (1) (Table 1 and Table S1). The number of fungal species was higher in the rhizosphere of durum wheat cv. Floradur than cv. Durasol (Table 2). The following percentage of reads was assigned at the taxonomic level of kingdom, phylum, class, order, family, genus, and species: 100%, 99.11–99.66%, 97.08–99.12%, 96.92–99.07%, 94.49–98.28%, 79.40–91.73%, and 64.76–81.56%, respectively (Table S2).

3.2. Differences in Fungal Communities Between Durum Wheat Cultivars and Seed Treatments

Ascomycota were the dominant fungal phylum in all soil samples. The relative abundance of Ascomycota OTUs was determined at 47.12%, and in the rhizosphere of cv. Floradur in the control treatment at 11.54% (Table 2). Mortierellomycota was the dominant phylum in the Biol treatment in both durum wheat cultivars (5.17% and 5.51%, respectively). Fungi of the phylum Basidiomycota were identified mainly in the Durasol/Fung treatment (4.22%), and fungi of the phylum Mucoromycota in the Durasol/control treatment (4.99%) (Table 2).
Species belonging to the phylum Ascomycota were classified into 28 orders, 58 families, and 112 genera. Only 13 genera contained three or more species, and eight genera were composed of two species (Table S1). Species of the phylum Basidiomycota were classified into 25 orders, 41 families, and 76 genera. Five genera contained three or more species, and 11 genera were composed of two species (Table S1).
Fifteen dominant taxa were identified in the total number of 270 fungal species, and they accounted for 75.69% of total OTUs (Figure 1). The abundance of the dominant species was determined based on the analyzed variables, and the communities of dominant fungal taxa were similar in the control treatments of both durum wheat cultivars (Figure S2). Two clades with Biol and Fung treatments differed between cvs. Floradur and Durasol. The clade grouping the control treatments of both cultivars differed mainly in the high number of OTUs of Gibberella avenacea and Colletotrichum gloeosporioides pathogens, as well as Mortierella alpina and Mucor hiemalis (Figure 1 and Figure S1).

3.3. The Influence of Seed Treatment on the Number of Fungal Taxonomic and Functional Groups

The identified fungal species were divided into six taxonomic or functional groups: (1) pathogens of the genus Fusarium, (2) other pathogens, (3) yeasts, (4) Mortierellomycota (5) Mucoromycota, and (6) Trichoderma spp. (Figure 2 and Figure 3). Seed dressing decreased the average number of Fusarium OTUs, in particular in cv. Floradur. The Biol treatment induced a 4.44-fold decrease and the Fung treatment induced a 3.98-fold decrease in the above parameter relative to the control treatment (Figure 2). The Biol treatment was more effective in reducing the abundance of the remaining pathogens than the Fung treatment. The Biol treatment decreased average pathogen counts 2.11-fold in the rhizosphere of cv. Floradur and 2.62-fold in the rhizosphere of cv. Durasol. In most cases, seed dressing increased the average abundance of yeasts and fungi of the phylum Mucoromycota (Figure 2). The direction of changes induced by seed dressing in the average number of Mucoromycota and Trichoderma spp. OTUs was determined by the durum wheat cultivar: an increase was observed in cv. Floradur, whereas a decrease was noted in cv. Durasol (Figure 2).
In the dendrograms generated for Fusarium spp., pathogens, yeasts, and Trichoderma spp. in different treatments, the control treatment (F) was completely different from the remaining clades (Figure 3). Yeasts were grouped mainly based on durum wheat cultivars. In turn, Mortierellomycota were grouped in clades based mainly on seed treatments.
Fusarium species accounted for 9.9% of total OTUs. Six Fusarium species were identified, and Gibberella avenacea (anamorph: Fusarium avenaceum) was the dominant species (Figure 4). Seed dressing decreased the number of G. avenacea OTUs in the rhizosphere of both durum wheat cultivars. The abundance of Fusarium pathogens was reduced by 47.24% (cv. Durasol) to 87.4% (cv. Floradur) by the Biol treatment, and by 21.82% (cv. Durasol) to 74.85% (cv. Floradur) by the Fung treatment, relative to the control treatment.
Other potentially pathogenic species accounted for 8.6% of total OTUs. This group consisted of 16 species, including Monographella nivalis, Urocystis tritici, Ustilago maydis, and Bipolaris sorokiniana, which often colonize cereals (Figure 5). Seed dressing, in particular the suspension of D. hansenii cells (Biol treatment), decreased the number of OTUs of most fungal species in both durum wheat cultivars.
Yeasts accounted for 13.46% of total OTUs, and 27 yeast species were identified (Figure 6). Four yeast species were particularly abundant (more than 10,000 OTUs): Debaryomyces hansenii, Naganishia vaughanmartiniae, Rhodotorula glutinis, and Solicoccozyma fuscescens. In cv. Floradur, the Biol treatment increased the number of D. hansenii OTUs in the rhizosphere 4.8 times. In addition, the number of OTUs of autochthonous N. vaughanmartiniae and S. fuscescens increased in the rhizosphere of both durum wheat cultivars in response to both Biol and Fung treatments. In the rhizosphere of cv. Durasol, the Biol treatment induced a 5.3-fold increase in the number of S. fuscescens OTUs and a 2.5-fold increase in the number of N. vaughanmartiniae OTUs.
Eight identified species of the genus Mortierella accounted for 25.4% of total OTUs (Table 3). The number of OTUs of most identified species (seven in cv. Floradur and six in cv. Durasol) increased in the rhizosphere of seedlings grown from dressed seeds. In comparison with the rhizosphere of seedlings grown from non-dressed seeds, the Biol and Fung treatments increased the total number of Mortierella OTUs 2.8- and 2.5-fold, respectively, in cv. Floradur, and by 29.3% and 22.3%, respectively, in cv. Durasol.
Fungi belonging to the phylum Mucoromycota accounted for 10.3% of total OTUs, and Mucor hiemalis predominated in the group of six identified species of the genus Mucor (Table 3). The direction of changes induced by seed dressing in the abundance of Mucoromycota was determined by the durum wheat cultivar: an increase was observed in cv. Floradur, whereas a decrease was noted in cv. Durasol.
Fungi of the genus Trichoderma accounted for 10.3% of total OTUs. Five Trichoderma species were identified, and T. hamatum was the dominant species (Table 3). After seed dressing, the abundance of T. hamatum increased in the rhizosphere of cv. Floradur (up to 2.2-fold in the Fung treatment) and decreased in the rhizosphere of cv. Durasol.

3.4. The Effect of Seed Dressing on Plant Health, Biometric Parameters, and Yield-Related Traits

Seed dressing was the only protective treatment in the presented experiment. In cv. Durasol, the severity of FCR symptoms was significantly reduced by the Fung treatment (by 30.86%) and the Biol treatment (by 29.14%) (Table 4). In cv. Floradur, the Fung and Biol treatments decreased the incidence of FCR by 57.1% and 35.7%, respectively, relative to the control treatment (Table 4). Eight species of the genus Fusarium were isolated from the stem bases of durum wheat plants with symptoms of FCR (F. avenaceum, F. culmorum, F. graminearum, F. solani, F. sporotrichioides, F. tricinctum, F. oxysporum, and F. poae). Durum wheat cv. Durasol was characterized by significantly taller plants than cv. Floradur (Table 4). The average number of emerged seedlings was significantly higher after the Fung treatment. Seed dressing also increased NDVI values and the number of spikes per m2, in particular after the application of triticonazole. However, seed dressing had no significant influence on other biometric parameters, including yield, measured in different stages of plant growth (Table 5).

3.5. Principal Component Analysis

The principal component analysis was based on 18 parameters (plant health, grain yield, soil properties) of durum wheat plants grown from seeds dressed with a fungicide (Fung), D. hansenii suspension (Biol), and non-dressed seeds (Control), as well as rhizosphere soil (Figure 7). The first principal component (PC1) explained 34.17% of total variance, and it was dominated by yield, yield-reducing factors (severity of FCR, grain infection), and yield-promoting factors (seedling emergence). The second principal component (PC2) explained 29.44% of total variance, and it was composed mainly of the number of OTUs of beneficial fungi (yeasts, Mortierellomycota) and harmful fungi (soil pathogens, including Fusarium spp.). Interestingly, fungal biodiversity and Mortierellomycota counts were grouped around NDVI, whereas the severity of FCR and Basidiomycota counts were grouped around yields, but these relationships were statistically insignificant.
Several significant negative correlations were observed between fungal counts and yield-related traits (Table S3, Figure 8). The abundance of Ascomycota was bound by a significant negative correlation with the number of seedlings per m2 (r = −0.844) and NDVI values (r = −0.934). The number of plants with FCR symptoms was significantly negatively correlated with the number of seedlings (r = −0.829). The number of Mortierellomycota OTUs was positively correlated with NDVI values (r = 0.943). In turn, spike density was significantly correlated with the number of kernels colonized by Fusarium fungi (r = 0.829). The number of yeast OTUs was bound by a significant positive correlation with the number of Mortierellomycota OTUs (r = 0.829) and a significant negative correlation with pathogen counts (r = −0.839). The number of Ascomycota OTUs was significantly negatively correlated with the number of Mortierellomycota OTUs (r = −0.838).

4. Discussion

Biological seed treatment is one of the most effective methods of reducing pesticide use and promoting sustainable agricultural practices. In the present experiment, durum wheat seeds were dressed with a suspension of Debaryomyces hansenii cells [6], and non-dressed seeds and seeds treated with a triazole fungicide were used as a reference material. The experimental plots were abundant in rhizosphere fungi, and taxa of the phyla Ascomycota and Mortierellomycota were predominant. These fungal phyla appear to be dominant in the rhizosphere soil of wheat, and they have been identified by other researchers [44,45]. Levi et al. [45] analyzed the composition and role of fungal communities colonizing the rhizosphere of winter wheat Triticum aestivum in different phenological stages and found that species of the phylum Ascomycota and genus Mortierella were predominant.
In the present study, seed dressing with the suspension of D. hansenii cells inhibited the growth of Fusarium pathogens in the rhizosphere of durum wheat, and decreased the incidence and severity of FCR caused by Fusarium spp. The Biol treatment decreased the abundance of Fusarium pathogens in the rhizosphere of durum wheat by 47.24% to 87.4%, and it was more effective than the Fung treatment. In turn, the Fung treatment was more effective in reducing the incidence of FCR than the Biol treatment. However, the fungicide could exert its antagonistic effects for a longer period of time than yeast cells because stem base health was evaluated two weeks before harvest. In the work of Sui et al. [46], seed dressing with a T. harzianum strain was more effective in reducing FCR than a fungicide. According to the cited authors [46], biological seed treatment could deliver additional benefits by promoting plant growth and resistance against pathogens. Seed dressing with yeast suspensions or extracts is a relatively new agricultural treatment that has been rarely examined in the literature [18,47,48]. Seed dressing with a yeast extract improved the vigor of wheat seedlings and decreased the abundance of Fusarium pathogens colonizing wheat grain [18]. In a pot experiment conducted under controlled conditions, seed dressing with Meyerozyma guilliermondii strain MT731365 clearly stimulated the germination and growth of durum wheat seedlings cv. Karima [48]. The above strain also induced the production of indole-3-acetic acid (IAA), which promoted root development. According to Fedotov et al. [25], seed soaking in yeast solutions contributed to the development of epiphytic, rather than endophytic microorganisms. Seed dressing is widely applied in agriculture to reduce pesticide use and introduce new active ingredients that offer prolonged, broad-spectrum protection [49,50]. Biological seed treatment not only improves plant health by reducing pressure from soil pathogens, but it can also induce defense responses [46,48,51,52].
The present study analyzed also the effect of seed dressing with D. hansenii yeasts on fungal communities colonizing the rhizosphere of durum wheat. An analysis of the composition of OTUs revealed that seed dressing, in particular the Biol treatment, modified the biodiversity of fungal communities. Seed dressing also induced changes in the structure of fungal taxonomic and functional groups. Yeasts and Mortiellela spp. were highly abundant, and their counts increased significantly in the rhizosphere of seedlings grown from seeds treated with D. hansenii. Yeasts are widely used in biotechnological processes [53], biological plant protection [6,54], and food production [55]. In the current experiment, these fungi were most abundant in the rhizosphere of seedlings grown from biologically treated seeds. A total of 27 species were identified, and some of them had been previously classified as biological control agents (BCAs), including Candida sake, Rhodotorula glutinis, and Sporobolomyces roseus [35,56,57]. However, these species were not highly abundant, and they did not affect the development of durum wheat seedlings. Interestingly, seed dressing, in particular the Biol treatment, increased the abundance of Naganishia vaughanmartiniae and Solicoccozyma fuscescens. The role of S. fuscescens has not been fully elucidated, but this species was previously identified in agricultural soil [58]. The genus Naganishia was resurrected from Cryptococcus and amended to accommodate the albidus clade of Filobasidiales, Tremellomycetes, and Basidiomycota [34,59]. Cryptococcus vaughanmartiniae was first isolated from cold environments worldwide [60].
In the present study, seed dressing with D. hansenii increased the abundance of this yeast species only in durum wheat cv. Floradur. This observation could be attributed to (1) differences in the grain mycobiome and (2) differences in the physiology of root development and root secretions that select soil-dwelling microorganisms. Özkurt et al. [44] demonstrated that fungi colonizing the grain of wild and domesticated wheat species are transmitted vertically to the roots or leaves of seedlings. However, this transfer mechanism varies depending on plant genotypes and microbial taxa. When seedling roots are colonized by pathogens, plants activate a defense mechanism known as the “call for help” strategy that indirectly increases the abundance and diversity of beneficial microorganisms [61]. Lebeis et al. [62] provided ample evidence to demonstrate that salicylic acid modulates the colonization of Arabidopsis thaliana roots by specific bacterial families. In a study by Yuan et al. [63], the root exudates of infected tomato plants were significantly more abundant in amino acids, nucleotides, and long-chain organic acids (LCOAs) (C > 6), and less abundant in sugars, alcohols, and short-chain organic acids (SCOAs) (C ≤ 6). Modified root exudates induced changes in the structure of microbial communities to prevent the spread of soil-borne infections. Earlier Sevillano-Caño et al. [64] showed that D. hansenii induced the expression of several genes related to ET biosynthesis (ACO1), ET signaling (EIN2 and EIN3), and SA biosynthesis (PAL) in cucumber leaves from plants grown in soil inoculated with D. hansenii. Sevillano-Caño et al. [64] suggest that D. hansenii can induce both induced systemic resistance (ISR) and systemic acquired resistance (SAR). In this way D. hansenii can increase plant resistance to the pathogen infections, initiating in the plants a state known as priming. This phenomenon was described by Pieterse et al. [65] as a plant’s response to rhizosphere microorganisms.
In this study, five Trichoderma species were identified in the rhizosphere of durum wheat. The predominant species, T. hamatum, was detected mainly in the rhizosphere of the control seedlings of cv. Durasol. Trichoderma species are well known for their ability to suppress cereal pathogens. For example, the inoculation of wheat grain with T. atroviride strain HB20111 stimulated soil-dwelling microorganisms, increased their diversity, and reduced the abundance of pathogenic F. pseudograminearum [46]. However, in the current study, Trichoderma spp. had no influence on plant health.
Nine species of the genus Mortierella were identified in this experiment. The abundance of Mortierella spp. increased considerably after both Fung and Biol treatments, which had positive implications for plant development. In the work of Ozimek and Hanaka [66], Mortierella spp. were classified as plant-growth-promoting fungi (PGPF), which improve the availability of P and Fe in soil. In addition, these species are well adapted to highly unsupportive environments, and they utilize carbon from polymers such as cellulose, hemicellulose, and chitin [66].

5. Conclusions

Seed dressing with microbial suspensions is a highly promising biotechnological treatment that improves crop yields. The Debaryomyces hansenii strain used for dressing durum wheat seeds before sowing reduced the incidence and severity of Fusarium crown rot, reduced the counts of Fusarium pathogens in the rhizosphere, and increased the abundance of other yeast species and fungi of the phylum Mortierellomycota. The results of this study indicate that biological seed treatment with yeasts may be a potential alternative to pesticides, without adverse effects on humans, animals, or the natural environment. The future of seed dressing depends on the quality of biological preparations, which should be adapted to the crop species and local environmental conditions.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agriculture15060639/s1, Table S1. Systematic of kingdom Fungi; Table S2. Percentage of the dataset reads assigned to different taxonomic levels; Table S3. Correlations between the yield and health of durum wheat and the number of fungi inhabiting the rhizosphere of seedlings; Figure S1. Weather conditions during the experiment in Tomaszkowo in 2020: temperature (top) and precipitation (bottom). Figure S2. Cluster analysis performed using Euclidean distance measure and Ward’s group linkage method for hyperdominant fungal species for normalized data.

Author Contributions

Conceptualization, U.W. and W.G.; methodology, U.W.; software, U.W.; validation, W.G. and U.W.; formal analysis, U.W.; investigation, W.G.; resources, W.G.; data curation, U.W.; writing—original draft preparation, W.G.; writing—review and editing, U.W.; visualization, U.W.; supervision, U.W.; project administration, U.W.; funding acquisition, U.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Minister of Science under “The Regional Initiative of Excellence Program”.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The research data of this research are all listed in the Supplementary Materials.

Acknowledgments

The authors express their gratitude to A. Poprawska for language editing.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bobryk-Mamczarz, A.; Kiełtyka-Dadasiewicz, A.; Rachoń, L. Usefulness of hulled wheats grown in polish environment for wholegrain pasta-making. Foods 2021, 10, 458. [Google Scholar] [CrossRef] [PubMed]
  2. Spychaj, R.; Gil, Z.; Chrzanowska-Drożdż, B. Technological value of winter durum wheat cv. Komnata as dependent on chemical plant protection. Biul. Inst. Hod. Aklim. Rośl. 2011, 262, 25–38. [Google Scholar]
  3. Kuzdraliński, A.; Szczerba, H.; Tofil, K.; Filipiak, A.; Garbarczyk, E.; Dziadko, P.; Solarska, E. Early PCR-based detection of Fusarium culmorum, F. graminearum, F. sporotrichioides and F. poae on stem bases of winter wheat throughout Poland. Eur. J. Plant Pathol. 2014, 140, 491–502. [Google Scholar] [CrossRef]
  4. Lenc, L.; Czecholiński, G.; Wyczling, D.; Turów, T.; Kaźmierczak, A. Fusarium head blight (FHB) and Fusarium spp. on grain of spring wheat cultivars grown in Poland. J. Plant Prot. Res. 2015, 55, 266–275. [Google Scholar] [CrossRef]
  5. Błaszczyk, L.; Salamon, S.; Mikołajczak, K. Fungi inhabiting the wheat endosphere. Pathogens 2021, 10, 1288. [Google Scholar] [CrossRef]
  6. Wachowska, U.; Sulyok, M.; Wiwart, M.; Suchowilska, E.; Kandler, W.; Krska, R. The application of antagonistic yeasts and bacteria: An assessment of in vivo and under field conditions pattern of Fusarium mycotoxins in winter wheat grain. Food Control 2022, 138, 109039. [Google Scholar] [CrossRef]
  7. Lyu, D.; Zajonc, J.; Pagé, A.; Tanney, C.A.S.; Shah, A.; Monjezi, N.; Msimbira, L.A.; Antar, M.; Nazari, M.; Backer, R.; et al. Plant holobiont theory: The phytomicrobiome plays a central role in evolution and success. Microorganisms 2021, 24, 675. [Google Scholar] [CrossRef]
  8. Rosenberg, E.; Zilber-Rosenberg, I. Microbes drive evolution of animals and plants: The hologenome concept. MBio 2016, 7, 11101128. [Google Scholar] [CrossRef]
  9. Wachowska, U.; Rychcik, B. Plants control the structure of mycorrhizal and pathogenic fungal communities in soil in a 50-year maize monoculture experiment. Plant Soil 2023, 484, 133–153. [Google Scholar] [CrossRef]
  10. Salamon, S.; Mikołajczak, K.; Błaszczyk, L. Constellation of the endophytic mycobiome in spring and winter wheat cultivars grown under various conditions. Sci. Rep. 2023, 13, 6089. [Google Scholar] [CrossRef]
  11. Walsh, C.M.; Becker-Uncapher, I.; Carlson, M.; Fierer, N. Variable influences of soil and seed-associated bacterial communities on the assembly of seedling microbiomes. ISME J. 2021, 15, 2748–2762. [Google Scholar] [CrossRef] [PubMed]
  12. Johnston-Monje, D.; Gutiérrez, J.P.; Lopez-Lavalle, L.A.B. Seed-transmitted bacteria and fungi dominate juvenile plant microbiomes. Front. Microbiol. 2021, 12, 737616. [Google Scholar] [CrossRef] [PubMed]
  13. Danielewicz, J.; Korbas, M.; Horoszkiewicz-Janka, J.; Jajor, E.; Krzymińska, J. The use of reduced doses of fungicides in integrated plant protection. Zagadnienia Doradz. Rol. 2015, 80, 97–106. [Google Scholar]
  14. Ayesha, M.S.; Suryanarayanan, T.S.; Nataraja, K.N.; Prasad, S.R.; Shaanker, R.U. Seed treatment with systemic fungicides: Time for review. Front. Plant Sci. 2021, 12, 654512. [Google Scholar] [CrossRef] [PubMed]
  15. Keyser, C.A.; Jensen, B.; Meyling, N.V. Dual effects of Metarhizium spp. and Clonostachys rosea against an insect and a seed-borne pathogen in wheat. Pest Manag. Sci. 2016, 72, 517–526. [Google Scholar] [CrossRef]
  16. Del Puerto, O.; Gonçalves, N.P.F.; Medana, C.; Prevot, A.B.; Roslev, P. Attenuation of toxicity and occurrence of degradation products of the fungicide tebuconazole after combined vacuum UV and UVC treatment of drinking water. Environ. Sci. Pollut. Res. 2022, 29, 58312–58325. [Google Scholar] [CrossRef]
  17. Collinge, D.B.; Jensen, D.F.; Rabiey, M.; Sarrocco, S.; Shaw, M.W.; Shaw, R.H. Biological control of plant diseases—What has been achieved and what is the direction? Plant Pathol. 2022, 71, 1024–1047. [Google Scholar] [CrossRef]
  18. Ibrahim, E.A.M.; Abo El-Dahab, M.S. Influence of seed dressing by yeast extract and fungicides on seed quality of wheat during storage. J. Plant Prod. Mansoura Univ. 2017, 8, 187–193. [Google Scholar] [CrossRef]
  19. Paravar, A.; Piri, R.; Balouchi, H.; Ma, Y. Microbial seed coating: An attractive tool for sustainable agriculture. Biot. Rep. 2023, 37, e00781. [Google Scholar] [CrossRef]
  20. Wallace, M.E. Root-Inhabiting and Rhizosphere Mycobiomes and Crop Yield of Corn and Wheat. Master’s Thesis, The University of Western Ontario, London, ON, Canada, 2022; p. 9028. Available online: https://ir.lib.uwo.ca/etd/9028 (accessed on 14 May 2021).
  21. Chen, J.; Sharifi, R.; Khan, M.S.S.; Islam, F.; Bhat, J.A.; Kui, L.; Majeed, A. Wheat microbiome: Structure, dynamics, and role in improving performance under stress environments. Front. Microbiol. 2022, 12, 821546. [Google Scholar] [CrossRef]
  22. Trivedi, P.; Leach, J.E.; Tringe, S.G.; Sa, T.; Singh, B.K. Plant-microbiome interactions: From community assembly to plant health. Nat. Rev. Microbiol. 2020, 18, 607–621. [Google Scholar] [CrossRef] [PubMed]
  23. Wachowska, U.; Kucharska, K.; Pluskota, W.; Czaplicki, S.; Stuper-Szablewska, K. Bacteria associated with winter wheat degrade Fusarium mycotoxins and triazole fungicide residues. Agronomy 2020, 10, 1673. [Google Scholar] [CrossRef]
  24. Rai, A.; Belkacem, M.; Assadi, I.; Bollinger, J.C.; Elfalleh, W.; Assadi, A.A.; Amrane, A.; Mouni, L. Bacteria in soil: Promising bioremediation agents in arid and semi-arid environments for cereal growth enhancement. Appl. Sci. 2022, 12, 11567. [Google Scholar] [CrossRef]
  25. Fedotov, G.N.; Shoba, S.A.; Fedotova, M.F.; Stepanov, A.L.; Streletsky, R.A. Soil yeasts and their role in seed germination. Eurasian Soil Sci. 2017, 50, 573–579. [Google Scholar] [CrossRef]
  26. Alfonzo, A.; Sicard, D.; Di Miceli, G.; Guezenec, S.; Settanni, L. Ecology of yeasts associated with kernels of several durum wheat genotypes and their role in co-culture with Saccharomyces cerevisiae during dough leavening. Food Microbiol. 2021, 94, 103666. [Google Scholar] [CrossRef] [PubMed]
  27. Ming, X.; Wang, Y.; Sui, Y. Pretreatment of the antagonistic yeast, Debaryomyces hansenii, with mannitol and sorbitol improves stress tolerance and biocontrol efficacy. Front. Microbiol. 2020, 11, 601. [Google Scholar] [CrossRef]
  28. Czarnecka, M.; Żarowska, B.; Połomska, X.; Restuccia, C.; Cirvilleri, G. Role of biocontrol yeasts Debaryomyces hansenii and Wickerhamomyces anomalus in plants’ defence mechanisms against Monilinia fructicola in apple fruits. Food Microbiol. 2019, 83, 1–8. [Google Scholar] [CrossRef]
  29. Huang, C.; Zhang, L.; Johansen, P.G.; Petersen, M.A.; Arneborg, N.; Jespersen, L. Debaryomyces hansenii strains isolated from danish cheese brines act as biocontrol agents to inhibit germination and growth of contaminating molds. Front. Microbiol. 2021, 12, 662785. [Google Scholar] [CrossRef]
  30. Rivas-Garcia, T.; Murillo-Amador, B.; Reyes-Pérez, J.J.; Chiquito-Contreras, R.G.; Preciado-Rangel, P.; Ávila-Quezada, G.D.; Lara-Capistran, L.; Hernandez-Montiel, L.G. Debaryomyces hansenii, Stenotrophomonas rhizophila, and ulvan as biocontrol agents of fruit rot disease in muskmelon (Cucumis melo L.). Plants 2022, 11, 184. [Google Scholar] [CrossRef]
  31. Fröhlich-Wyder, M.T.; Arias-Roth, E.; Jakob, E. Cheese yeasts. Yeast 2019, 36, 129–141. [Google Scholar] [CrossRef]
  32. Koutsoumanis, K.; Allende, A.; Alvarez-Ordóñez, A.; Bolton, D.; Bover-Cid, S.; Chemaly, M.; Davies, R.; De Cesare, A.; Hilbert, F.; Lindqvist, R.; et al. Update of the list of QPS-recommended biological agents intentionally added to food or feed as notified to EFSA 12: Suitability of taxonomic units notified to EFSA until March 2020. EFSA J. 2020, 18, 6174. [Google Scholar] [CrossRef]
  33. Wachowska, U.; Sulyok, M.; Wiwart, M.; Suchowilska, E.; Giedrojć, W.; Gontarz, D.; Kandler, W.; Krska, R. Secondary metabolites of pathogenic fungi in Triticum durum grain protected with Debaryomyces hansenii in two different locations in Poland. Agronomy 2023, 13, 721. [Google Scholar] [CrossRef]
  34. Bijlani, S.; Parker, C.; Singh, N.K.; Sierra, M.A.; Foox, J.; Wang, C.C.C.; Mason, C.E.; Venkateswaran, K. Genomic characterization of the titan-like cell producing Naganishia tulchinskyi, the first novel eukaryote isolated from the international space station. J. Fungi 2022, 8, 165. [Google Scholar] [CrossRef]
  35. Calvo-Garrido, C.; Viñas, I.; Usall, J.; Rodríguez-Romera, M.; Ramos, M.C.; Teixidó, N. Survival of the biological control agent Candida sake CPA-1 on grapes under the influence of abiotic factors. J. Appl. Microbiol. 2014, 117, 800–811. [Google Scholar] [CrossRef]
  36. IUNG. 2023. Available online: https://iung.pl (accessed on 29 May 2023).
  37. Kuś, J.; Kopiński, J. The management of soil organic matter in contemporary agriculture. Zagadnienia Doradz. Rol. 2012, 2, 5–27. [Google Scholar]
  38. Meier, U. Phenological Growth Stages. In Phenology: An Integrative Environmental Science; Schwartz, M.D., Ed.; Tasks for Vegetation Science; Springer: Dordrecht, The Netherlands, 2003; p. 39. [Google Scholar] [CrossRef]
  39. Pettorelli, N. The Normalized Difference Vegetation Index; Oxford University Press: New York, NY, USA, 2013. [Google Scholar]
  40. Sultana, S.R.; Ali, A.; Ahmad, A.; Mubeen, M.; Zia-Ul-Haq, M.; Ahmad, S.; Ercisli, S.; Jaafar, H.Z.E. Normalized Difference Vegetation Index as a tool for wheat yield estimation: A case study from Faisalabad, Pakistan. Sci. World J. 2014, 2014, 725326. [Google Scholar] [CrossRef]
  41. EPPO. European and Mediterranean Plant Protection Organization 1/28 (3). 2019. Available online: https://www.eppo.int/RESOURCES/eppo_standards/pp1_list (accessed on 2 July 2019).
  42. Gams, W. Cephalosporium-Artige Schimmelpilze (Hyphomycetes); Fischer, G., Ed.; Taylor & Francis, Ltd.: Stuttgart, Germay, 1971. [Google Scholar]
  43. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing Professional: Oxford, UK, 2006; ISBN 9780813819198. [Google Scholar] [CrossRef]
  44. Özkurt, E.; Hassani, M.A.; Sesiz, U.; Künzel, S.; Dagan, T.; Özkan, H.; Stukenbrock, E.H. Seed-derived microbial colonization of wild emmer and domesticated bread wheat (Triticum dicoccoides and T. aestivum) seedlings shows pronounced differences in overall diversity and composition. mBio 2020, 11, e02637-20. [Google Scholar] [CrossRef]
  45. Levi, M.; Applebaum, I.; Sherman, C.; Doniger, T.; Steinberger, Y. Soil fungal community of wheat Triticum aestivum rhizosphere at different phenological stages under a rain-fed management. Rhizosphere 2022, 24, 100605. [Google Scholar] [CrossRef]
  46. Sui, L.; Li, J.; Philp, J.; Yang, K.; Wei, Y.; Li, H.; Li, J.; Li, L.; Ryder, M.; Toh, R.; et al. Trichoderma atroviride seed dressing influenced the fungal community and pathogenic fungi in the wheat rhizosphere. Sci. Rep. 2022, 12, 9677. [Google Scholar] [CrossRef]
  47. Cardarelli, M.; Woo, S.L.; Rouphael, Y.; Colla, G. Seed treatments with microorganisms can have a biostimulant effect by influencing germination and seedling growth of crops. Plants 2022, 11, 259. [Google Scholar] [CrossRef]
  48. Kthiri, Z.; Jabeur, M.B.; Chairi, F.; López-Cristoffanini, C.; López-Carbonell, M.; Serret, M.D.; Araus, J.L.; Karmous, C.; Hamada, W. Exploring the potential of Meyerozyma guilliermondii on physiological performances and defense response against Fusarium crown rot on durum wheat. Pathogens 2021, 10, 52. [Google Scholar] [CrossRef] [PubMed]
  49. Australian Pesticides and Veterinary Medicines Authority. Fluxapyroxad in the Product Systiva Seed Treatment Fungicide. 2015. Available online: https://apvma.gov.au (accessed on 30 July 2021).
  50. Sawinska, Z.; Krzyzińska, B.; Kazikowski, P.; Głazek, M. Fluxapyroxad-new strategy in reducing leaf disease of spring barley. Fragm. Agron. 2014, 31, 85–91. [Google Scholar]
  51. Powell, W.A.; Klingeman, W.E.; Ownley, B.H.; Gwinn, K.D. Evidence of endophytic Beauveria bassiana in seed-treated tomato plants acting as a systemic entomopathogen to larval Helicoverpa zea (Lepidoptera: Noctuidae). J. Entomol. Sci. 2009, 44, 391–396. [Google Scholar] [CrossRef]
  52. Perello, A.E.; Dal Bello, G.M. Suppression of tan spot and plant growth promotion of wheat by synthetic and biological inducersunder field conditions. Ann. Appl. Biol. 2011, 158, 267–274. [Google Scholar] [CrossRef]
  53. Nandya, S.K.; Srivastavab, R.K. A review on sustainable yeast biotechnological processes and applications. Microbiol. Res. 2018, 20, 83–90. [Google Scholar] [CrossRef]
  54. Shude, S.P.N.; Mbili, N.C.; Yobo, K.S. Epiphytic yeasts as potential antagonists against Fusarium head blight of wheat (Triticum aestivum L.) caused by Fusarium graminearum sensu strict. J. Saudi Soc. Agric. Sci. 2022, 21, 404–411. [Google Scholar] [CrossRef]
  55. El-Ghwas, D.E.; Elkhateeb, W.A.; Akram, M.; Daba, G.M. Yeast as biotechnological tool in food industry. J. Pharm. Sci. 2014, 5, 1–6. [Google Scholar] [CrossRef]
  56. Li, B.; Peng, H.; Tian, S. Attachment capability of antagonistic yeast Rhodotorula glutinis to Botrytis cinerea contributes to biocontrol efficacy. Front. Microbiol. 2016, 7, 601. [Google Scholar] [CrossRef]
  57. Janisiewicz, W.J.; Petersen, D.L.; Bors, S. Control of storage decay of apples with Sporobolomyces roseus. Plant Dis. 1994, 78, 466. [Google Scholar] [CrossRef]
  58. Mašínová, T.; Bahnmann, B.D.; Větrovský, T.; Tomšovský, M.; Merunková, K.; Baldrian, P. Drivers of yeast community composition in the litter and soil of a temperate forest. FEMS Microbiol. Ecol. 2017, 93, fiw223. [Google Scholar] [CrossRef]
  59. Fotedar, R.; Kolecka, A.; Boekhout, T.; Fell, J.W.; Anand, A.; Al Malaki, A.; Zeyara, A.; Al Marri, M. Naganishia qatarensis sp. nov., a novel basidiomycetous yeast species from a hypersaline marine environment in Qatar. Int. J. Syst. Evol. Microbiol. 2018, 68, 2924–2929. [Google Scholar] [CrossRef] [PubMed]
  60. Turchetti, B.; Selbmann, L.; Blanchette, R.A.; Di Mauro, S.; Marchegiani, E.; Zucconi, L.; Arenz, B.E.; Buzzini, P. Cryptococcus vaughanmartiniae sp. nov. and Cryptococcus onofrii sp. nov.: Two new species isolated from worldwide cold environments. Extremophiles 2015, 19, 149. [Google Scholar] [CrossRef] [PubMed]
  61. Yuan, X.; Chen, Y.; Qin, W.; Xu, T.; Mao, Y.; Wang, Q.; Chen, K.; Zhu, B. Plant and microbial regulations of soil carbon dynamics under warming in two alpine swamp meadow ecosystems on the Tibetan Plateau. Sci. Total Environ. 2021, 790, 148072. [Google Scholar] [CrossRef]
  62. Lebeis, S.L.; Paredes, S.H.; Lundberg, D.S.; Breakfield, N.; Gehring, J.; McDonald, M.; Malfatti, S.; Del Rio, G.T.; Jones, C.D.; Tringe, S.G.; et al. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science 2015, 349, 860–864. [Google Scholar] [CrossRef] [PubMed]
  63. Yuan, J.; Zhao, J.; Wen, T.; Zhao, M.; Li, R.; Goossens, P.; Huang, Q.; Bai, Y.; Vivanco, J.M.; Kowalchuk, G.A.; et al. Root exudates drive the soil-borne legacy of aboveground pathogen infection. Microbiome 2018, 6, 156. [Google Scholar] [CrossRef]
  64. Sevillano-Caño, J.; García, M.J.; Córdoba-Galván, C.; Luque-Cruz, C.; Agustí-Brisach, C.; Lucena, C.; Ramos, J.; Pérez-Vicente, R.; Romera, F.J. Exploring the role of Debaryomyces hansenii as biofertilizer in iron-deficient environments to enhance plant nutrition and crop production sustainability. Int. J. Mol. Sci. 2024, 25, 5729. [Google Scholar] [CrossRef]
  65. Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.M.; Bakker, P.A.H.M. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef]
  66. Ozimek, E.; Hanaka, A. Mortierella Species as the plant growth-promoting fungi present in the agricultural soils. Agriculture 2021, 11, 7. [Google Scholar] [CrossRef]
Agriculture 15 00639 g001
Figure 1. Number of OTUs of hyperdominant species (more than 10,000 OTUs). D—cv. Durasol, F—cv. Floradur, Biol—biological control, Fung—fungicide control.
Figure 1. Number of OTUs of hyperdominant species (more than 10,000 OTUs). D—cv. Durasol, F—cv. Floradur, Biol—biological control, Fung—fungicide control.
Agriculture 15 00639 g001
Agriculture 15 00639 g002
Figure 2. Average abundance of dominant fungal species and functional groups in the rhizosphere of durum wheat seedlings in different seed treatment groups. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control. “*”—multiplication.
Figure 2. Average abundance of dominant fungal species and functional groups in the rhizosphere of durum wheat seedlings in different seed treatment groups. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control. “*”—multiplication.
Agriculture 15 00639 g002
Agriculture 15 00639 g003
Figure 3. Cluster analysis of fungal taxonomic and functional groups based on the Euclidean distance and Ward’s linkages for normalized data. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Figure 3. Cluster analysis of fungal taxonomic and functional groups based on the Euclidean distance and Ward’s linkages for normalized data. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Agriculture 15 00639 g003
Agriculture 15 00639 g004
Figure 4. Number of OTUs of pathogenic Fusarium spp. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Figure 4. Number of OTUs of pathogenic Fusarium spp. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Agriculture 15 00639 g004
Agriculture 15 00639 g005
Figure 5. Number of OTUs of other potentially pathogenic fungal species. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Figure 5. Number of OTUs of other potentially pathogenic fungal species. D—cv. Durasol, F—cv. Floradur. Biol—biological control, Fung—fungicide control.
Agriculture 15 00639 g005
Agriculture 15 00639 g006
Figure 6. Number of yeast OTUs. D—cv. Durasol, F—cv. Floradur, Biol—biological control, Fung—fungicide control.
Figure 6. Number of yeast OTUs. D—cv. Durasol, F—cv. Floradur, Biol—biological control, Fung—fungicide control.
Agriculture 15 00639 g006
Agriculture 15 00639 g007
Figure 7. Principal component analysis of soil fungi (phylum or functional group), yields, and plant health. Bas—number of Basidiomycota OTUs in rhizosphere soil; FCR—severity of Fusarium crown root, Trich—number of Trichoderma OTUs in rhizosphere soil; Path—number of pathogenic OTUs in rhizosphere soil; Asc—number of Ascomycota OTUs in rhizosphere soil; Fus—number of Fusarium OTUs in rhizosphere soil; FCR fr.—incidence of Fusarium crown rot; Muc—number of Mucoromycota OTUs in rhizosphere soil; Head—spike density; FDK—Fusarium-damaged kernel; Fus grain—percentage of kernels colonized by Fusarium fungi; Yeast—number of yeast OTUs in rhizosphere soil; Mort—number of Mortierellomycota OTUs in rhizosphere soil; S-W index—Shannon–Wiener diversity index; Seed—number of seedlings in the two leaves unfolded stage; Plant—plant height. “x”—A multiplication sign.
Figure 7. Principal component analysis of soil fungi (phylum or functional group), yields, and plant health. Bas—number of Basidiomycota OTUs in rhizosphere soil; FCR—severity of Fusarium crown root, Trich—number of Trichoderma OTUs in rhizosphere soil; Path—number of pathogenic OTUs in rhizosphere soil; Asc—number of Ascomycota OTUs in rhizosphere soil; Fus—number of Fusarium OTUs in rhizosphere soil; FCR fr.—incidence of Fusarium crown rot; Muc—number of Mucoromycota OTUs in rhizosphere soil; Head—spike density; FDK—Fusarium-damaged kernel; Fus grain—percentage of kernels colonized by Fusarium fungi; Yeast—number of yeast OTUs in rhizosphere soil; Mort—number of Mortierellomycota OTUs in rhizosphere soil; S-W index—Shannon–Wiener diversity index; Seed—number of seedlings in the two leaves unfolded stage; Plant—plant height. “x”—A multiplication sign.
Agriculture 15 00639 g007
Agriculture 15 00639 g008
Figure 8. Heat map of the correlations between selected fungal species, yield, and the health status of durum wheat (refer to the key under Figure 7).
Figure 8. Heat map of the correlations between selected fungal species, yield, and the health status of durum wheat (refer to the key under Figure 7).
Agriculture 15 00639 g008
Table 1. Selected soil properties.
Table 1. Selected soil properties.
Compound/ElementContent (mg/100 g of Soil)Classification Based on Standard
Values for Light Soils *
P2O536Very high
K2O41Very high
Mg3.9Moderate
Mn257.2Moderate
Cu2.3Moderate
Zn10.7High
Fe1332Low
pH in KCl6.2Slightly acidic
Corg (%) **1.26Low
Humus (%) **2.18Moderate
* According to the Institute of Soil Science and Plant Cultivation (IUNG) [36]. ** [37] Corg—organic carbon.
Table 2. Illumina MiSeq sequenced fungal data and fungal community based on the ITS2 gene at the species level in rhizosphere of Triticum durum.
Table 2. Illumina MiSeq sequenced fungal data and fungal community based on the ITS2 gene at the species level in rhizosphere of Triticum durum.
CultivarTreatmentNumber of OTUsShannon–Wiener IndexTotal Number of SpeciesAscomycotaMortierellomycotaBasidiomycotaMucoromycotaChytridiomycotaOlpidiomycotaZoopagomycotaAphelidiomycota
Percentage Total OTUs
FloradurControl121,9731.18717211.541.933.40.030.0120.000700
Biol116,4221.3091607.715.511.920.940.01300.0030.0003
Fung128,5201.2181818.314.770.893.800.0270.000600.0001
DurasolControl135,6631.1121538.033.811.914.990.006000
Biol103,2161.6701595.255.173.390.390.0320.000300
Fung112,5161.2041686.264.754.220.280.008000.0004
Total718,310 27047.1225.9415.7310.440.0980.0020.0030.0008
Biol—biological control, Fung—fungicide control.
Table 3. Number of Mortierellomycota, Mucoromycota, and Trichoderma spp. OTUs.
Table 3. Number of Mortierellomycota, Mucoromycota, and Trichoderma spp. OTUs.
Speciescv. Floradurcv. Durasol
ControlBiolFungControlBiolFung
Mortierellomycota
Mortierella alpina10,6525415800212,41119,08712,607
Mortierella elongata45611,73063012804905511,172
Mortierella exigua6387135904836
Mortierella fatshederae005054
Mortierella hyalina8367441291933261528
Mortierella sarnyensis240948294047729016462067
Mortierella sclerotiella115590120
Mortierella zonata02071420
Mortierella spp. 23910,23213,030352447456549
Mucoromycota
Mucor circinelloides1548228157475122
Mucor fragilis001117046
Mucor hiemalis183577126,74435,22221821773
Mucor moelleri07016363515
Mucor mucedo001000
Mucor racemosus0211100
Rhizopus arrhizus05811000
Trichoderma spp.
Trichoderma hamatum172259383618233125
Trichoderma harzianum200001
Trichoderma lanuginosum004000
Trichoderma spirale1412182132
Trichoderma virens002011
Biol—biological control, Fung—fungicide control.
Table 4. Health status of durum wheat.
Table 4. Health status of durum wheat.
CultivarSeed TreatmentFusarium Crown Rot (FCR)Fusarium Species Isolated from Stems with Symptoms of FCR (%)Grain Health
SeverityPrevalenceFpFgFspoFaFsFtFcFoFDKFusarium spp. (%)
DurasolControl1.75 a80 a37.500000004.1730.007.00
Fung1.21 b70 ab37.5004.1704.17004.1722.509.00
Biol 1.24 b85 a33.3312.500004.170047.5019.00
FloradurControl1.29 ab70 ab25.0008.334.174.1700017.5016.00
Fung1.71 ab30 c5.5633.3300000027.5016.54
Biol 1.25 b45 bc4.174.1708.338.3304.17037.5012.8
Mean for cultivarDurasol1.4078.33 A36.11 A4.171.3901.391.3902.7833.3311.67
Floradur1.3848.33 B12.12 B10.613.034.554.5501.52027.5015.11
Mean for seed treatmentControl1.5375 X31.2504.172.082.082.0802.0823.7511.50
Fung1.3850 Y23.8114.292.3802.382.3802.3825.0012.77
Biol 1.2465 XY18.758.3304.174.174.172.08042.5015.90
Identical letters in columns denote values that do not differ significantly in Tukey’s test (p < 0.001). FDK—Fusarium-damaged kernel. Fp—Fusarium poae, Fg—F. graminearum, Fspo—F. sporotrichioides, Fa—F. avenaceum, Fs—F. solani, Ft—F. tricinctum, Fc—F. culmorum, Fo—F. oxysporum.
Table 5. Selected biometric parameters and yield-related traits in durum wheat plants.
Table 5. Selected biometric parameters and yield-related traits in durum wheat plants.
CultivarSeed TreatmentNumber of Seedlings per m2NDVI of LeavesNumber of Spikes per m²Plant Height [cm]Spike DensityYield Per m2 [g]
DurasolControl43.21 b0.4895178.2 bc57.57 ab2.38 b242.15
Fung50.93 ab0.5523273.9 a62.31 a2.32 c232.32
Biol45.37 ab0.5433108.9 d48.87 b2.56 a191.75
FloradurControl49.69 ab0.5197138.6 cd58.53 ab2.52 ab229.99
Fung54.01 ab0.5698148.5 cd64.69 a2.44 ab242.26
Biol58.95 a0.5565214.5 b61.91 a2.50 ab201.85
Mean for cultivarDurasol46.50 B0.5319187.056.25 B2.42222.07
Floradur54.22 A0.5487167.261.71 A2.48224.70
Mean for seed treatment Control46.450.5068158.4 Y58.05 XY2.45 XY236.07
Fung52.470.5610211.2 X63.51 X2.38 Y237.29
Biol52.160.5499161.7 Y55.39 Y2.53 X196.80
Identical letters in columns denote values that do not differ significantly in Duncan’s test (p < 0.001). NDVI—chlorophyll content.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Giedrojć, W.; Wachowska, U. Mycobiome and Pathogenic Fusarium Fungi in the Rhizosphere of Durum Wheat After Seed Dressing with Debaryomyces hansenii. Agriculture 2025, 15, 639. https://doi.org/10.3390/agriculture15060639

AMA Style

Giedrojć W, Wachowska U. Mycobiome and Pathogenic Fusarium Fungi in the Rhizosphere of Durum Wheat After Seed Dressing with Debaryomyces hansenii. Agriculture. 2025; 15(6):639. https://doi.org/10.3390/agriculture15060639

Chicago/Turabian Style

Giedrojć, Weronika, and Urszula Wachowska. 2025. "Mycobiome and Pathogenic Fusarium Fungi in the Rhizosphere of Durum Wheat After Seed Dressing with Debaryomyces hansenii" Agriculture 15, no. 6: 639. https://doi.org/10.3390/agriculture15060639

APA Style

Giedrojć, W., & Wachowska, U. (2025). Mycobiome and Pathogenic Fusarium Fungi in the Rhizosphere of Durum Wheat After Seed Dressing with Debaryomyces hansenii. Agriculture, 15(6), 639. https://doi.org/10.3390/agriculture15060639

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop