Improving Agar Degradation Activity of Vibrio natriegens WPAGA4 via Atmospheric and Room Temperature Plasma (ARTP)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strain, Medium, and Growth Conditions
2.2. Atmospheric and Room Temperature Plasma (ARTP) Mutagenesis
2.3. Positive Clone Screening
2.4. Measurement of Enzymatic Activity
2.5. Measurement of Optimal Degradation Conditions
2.6. Stability of the Mutant Strains
2.7. Genome Sequencing and Insertion-Deletion (InDel) Analysis
2.8. Neoagarooligosaccharide (NAOS) Consumption in Degrading Strains
2.9. Real-Time Quantitative PCR (RT-qPCR)
2.10. Heterologous Expression and Purification of the Agarase Genes
3. Results
3.1. Lethality Rate of WPAGA4 after ARTP Treatment
3.2. Screening and Verification of the Mutants
3.3. Enzymatic Properties of WPAGA4, T1, T2, and T3
3.4. Genome Sequencing and Comparative Genomic Analysis
3.5. Real-Time qPCR Analysis
3.6. The Degradation Activities of the Agarase Mixtures with Different Mole Ratios
3.7. The Determination of Agar Oligosaccharide Substrate Consumption
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lee, W.-K.; Lim, Y.-Y.; Leow, A.T.-C.; Namasivayam, P.; Abdullah, J.O.; Ho, C.-L. Biosynthesis of agar in red seaweeds: A review. Carbohydr. Polym. 2017, 164, 23–30. [Google Scholar] [CrossRef]
- Mostafavi, F.S.; Zaeim, D. Agar-based edible films for food packaging applications—A review. Int. J. Biol. Macromol. 2020, 159, 1165–1176. [Google Scholar] [CrossRef] [PubMed]
- Xiaodan, C.; Xiaoting, F.; Luqiang, H.; Jiachao, X.; Xin, G. Agar oligosaccharides: A review of preparation, structures, bioactivities and application. Carbohydr. Polym. 2021, 265, 118076. [Google Scholar]
- Wang, W.; Liu, P.; Hao, C.; Wu, L.; Wan, W.; Mao, X. Neoagaro-oligosaccharide monomers inhibit inflammation in LPS-stimulated macrophages through suppression of MAPK and NF-κB pathways. Sci. Rep. 2017, 7, 44252. [Google Scholar] [CrossRef]
- Enoki, T.; Tominaga, T.; Takashima, F.; Ohnogi, H.; Sagawa, H.; Kato, I. Anti-tumor-Promoting Activities of Agaro-Oligosaccharides on Two-Stage Mouse Skin Carcinogenesis. Biol. Pharm. Bull. 2012, 35, 1145–1149. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.G.; Jang, M.K.; Lee, O.H.; Kim, N.Y.; Ju, S.A.; Lee, S.H. Over-production of a glycoside hydrolase family 50 beta-agarase from Agarivorans sp. JA-1 in Bacillus subtilis and the whitening effect of its product. Biotechnol. Lett. 2008, 30, 911–918. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.J.; Lee, J.-H.; Kim, E.J.; Yang, H.J.; Park, J.-S.; Hong, S.-K.; Long, P. Anti-Obesity and Anti-Diabetic Effect of Neoagarooligosaccharides on High-Fat Diet-Induced Obesity in Mice. Mar. Drugs 2017, 15, 90. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Lee, C.R.; Hong, S.K. Implications of agar and agarase in industrial applications of sustainable marine biomass. Appl. Microbiol. Biotechnol. 2020, 104, 2815–2832. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, C.; Zhou, Q.Q.; Zhang, X.F.; Wang, L.Y.; Chang, H.B.; Li, H.P.; Oda, Y.; Xing, X.H. Quantitative evaluation of DNA damage and mutation rate by atmospheric and room-temperature plasma (ARTP) and conventional mutagenesis. Appl. Microbiol. Biotechnol. 2015, 99, 5639–5646. [Google Scholar] [CrossRef]
- Zou, R.-S.; Li, S.; Zhang, L.-L.; Zhang, C.; Han, Y.-J.; Gao, G.; Sun, X.; Gong, X. Mutagenesis of Rhodobacter sphaeroides using atmospheric and room temperature plasma treatment for efficient production of coenzyme Q10. J. Biosci. Bioeng. 2019, 127, 698–702. [Google Scholar] [CrossRef] [PubMed]
- Li, H.-P.; Wang, Z.-B.; Ge, N.; Le, P.-S.; Wu, H.; Lu, Y.; Wang, L.-Y.; Zhang, C.; Bao, C.-Y.; Xing, X.-H. Studies on the Physical Characteristics of the Radio-Frequency Atmospheric-Pressure Glow Discharge Plasmas for the Genome Mutation of Methylosinus trichosporium. IEEE Trans. Plasma Sci. 2012, 40, 2853–2860. [Google Scholar]
- Zhang, X.; Zhang, X.F.; Li, H.P.; Wang, L.Y.; Zhang, C.; Xing, X.H.; Bao, C.Y. Atmospheric and room temperature plasma (ARTP) as a new powerful mutagenesis tool. Appl. Microbiol. Biotechnol. 2014, 98, 5387–5396. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Ma, Y.; Deng, Y.; Zhou, Z.; Cao, Y.; Yang, B.; Bai, J.; Sun, Q. Enhancing Protease and Amylase Activities in Bacillus licheniformis XS-4 for Traditional Soy Sauce Fermentation Using ARTP Mutagenesis. Foods 2023, 12, 2381. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Yang, H.; Chen, X.; Sun, B.; Du, G.; Zhou, Z.; Song, J.; Fan, Y.; Shen, W. Significantly improving the yield of recombinant proteins in Bacillus subtilis by a novel powerful mutagenesis tool (ARTP): Alkaline α-amylase as a case study. Protein Expr. Purif. 2015, 114, 82–88. [Google Scholar] [CrossRef] [PubMed]
- Ning, Z.; Yue, J.; Juan, S.Y.; Chun, J.J.; Juan, T.Y. Breeding of a thermostable xylanase-producing strain of Myceliophthora thermophila by atmospheric room temperature plasma (ARTP) mutagenesis. Front. Bioeng. Biotechnol. 2023, 10, 1095323. [Google Scholar]
- He, R.; Ding, R.; Heyman, J.A.; Zhang, D.; Tu, R. Ultra-high-throughput picoliter-droplet microfluidics screening of the industrial cellulase-producing filamentous fungus Trichoderma reesei. J. Ind. Microbiol. Biotechnol. 2019, 46, 1603–1610. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Xia, Y.; Li, M.; Zhang, T. ARTP mutagenesis of phospholipase D-producing strain Streptomyces hiroshimensis SK43.001, and its enzymatic properties. Heliyon 2022, 8, e12587. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Tong, X.; Wang, W.; Wang, J.; Qu, W. Agarose biodegradation by deep-sea bacterium Vibrio natriegens WPAGA4 with the agarases through horizontal gene transfer. J. Basic Microbiol. 2023, 64, 2300521. [Google Scholar] [CrossRef]
- Tong, X.; Wang, N.; Zhang, M.; Wang, W.; Zhang, M.; Deng, S.; Wang, J.; Zeng, R.; Qu, W. Cloning, expression, and characterization of three agarases in Vibrio natriegens WPAGA4. Acta Microbiol. Sin. 2023, 63, 3667–3678. (In Chinese) [Google Scholar]
- Zhang, M.; Wang, J.; Zeng, R.; Wang, D.; Wang, W.; Tong, X.-C.; Qu, W. Agarose-Degrading Characteristics of a Deep-Sea Bacterium Vibrio Natriegens WPAGA4 and Its Cold-Adapted GH50 Agarase Aga3420. Mar. Drugs 2022, 20, 692. [Google Scholar] [CrossRef]
- Miller, G.L. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 2002, 31, 426–428. [Google Scholar] [CrossRef]
- Cao, S.; Zhou, X.; Jin, W.; Wang, F.; Tu, R.; Han, S.; Chen, H.; Chen, C.; Xie, G.-J.; Ma, F. Improving of lipid productivity of the oleaginous microalgae Chlorella pyrenoidosa via atmospheric and room temperature plasma (ARTP). Bioresour. Technol. 2017, 244, 1400–1406. [Google Scholar] [CrossRef] [PubMed]
- Duleepa, P.; Line, C.; Byeonghyeok, P.; Mikkel, S.; Geul, B.; Peter, S.; InGeol, C. A Novel Auxiliary Agarolytic Pathway Expands Metabolic Versatility in the Agar-Degrading Marine Bacterium Colwellia echini A3T. Appl. Environ. Microbiol. 2021, 87, e0023021. [Google Scholar]
- Gu, L.-S.; Tan, M.-Z.; Li, S.-H.; Zhang, T.; Zhang, Q.-Q.; Li, C.-X.; Luo, X.-M.; Feng, J.-X.; Zhao, S. ARTP/EMS-combined multiple mutagenesis efficiently improved production of raw starch-degrading enzymes in Penicillium oxalicum and characterization of the enzyme-hyperproducing mutant. Biotechnol. Biofuels 2020, 13, 187. [Google Scholar] [CrossRef] [PubMed]
- Colussi, F.; Serpa, V.; da Silva Delabona, P.; Manzine, L.R.; Voltatodio, M.L.; Alves, R.; Mello, B.L.; Pereira, N., Jr.; Farinas, C.S.; Golubev, A.M.; et al. Purification, and biochemical and biophysical characterization of cellobiohydrolase I from Trichoderma harzianum IOC 3844. J. Microbiol. Biotechnol. 2011, 21, 808–817. [Google Scholar] [CrossRef]
Gene | Primer Name | Sequence (5′→3′) |
---|---|---|
agaW3418 | 3418-F | TTCCGGCTCTAATGTTGATATCGTC |
3418-R | GACCGTCTTTTCCAGCCGAG | |
agaW3419 | 3419-F | CCAATACAGAAACGCGCTCTG |
3419-R | CATTTAACTGACCAGAAGTGATTCCG | |
agaW3420 | 3420-F | GTTTCTATCGTGCCAACCTGATG |
3420-R | CCAACGTGGTAAAACCCCAATC | |
agaW3472 | 3472-F | CTGCGTTAATGTCACAGGTAACAC |
3472-R | GGGGAACGAAAACCAGAATAGTG | |
GAPDH | GAPDH-F | CTGTTGACGGTCCTTCTGCTAAAG |
GAPDH-R | AGTTCGCCTTCAGAAGCTTC |
Indels | Insertions | Deletions | SNPs | Intergenic | Upstream | Downstream | Exonic | |
---|---|---|---|---|---|---|---|---|
T1 | 24 | 19 | 5 | 151 | 112 | 15 | 10 | 14 |
T2 | 25 | 19 | 6 | 155 | 109 | 16 | 23 | 7 |
T3 | 24 | 19 | 5 | 180 | 142 | 10 | 11 | 17 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, X.; Fan, S.; Li, X.; Zhang, M.; Wang, J.; Qu, W. Improving Agar Degradation Activity of Vibrio natriegens WPAGA4 via Atmospheric and Room Temperature Plasma (ARTP). J. Mar. Sci. Eng. 2024, 12, 1154. https://doi.org/10.3390/jmse12071154
Tong X, Fan S, Li X, Zhang M, Wang J, Qu W. Improving Agar Degradation Activity of Vibrio natriegens WPAGA4 via Atmospheric and Room Temperature Plasma (ARTP). Journal of Marine Science and Engineering. 2024; 12(7):1154. https://doi.org/10.3390/jmse12071154
Chicago/Turabian StyleTong, Xiufang, Shichang Fan, Xuelian Li, Mengyuan Zhang, Jianxin Wang, and Wu Qu. 2024. "Improving Agar Degradation Activity of Vibrio natriegens WPAGA4 via Atmospheric and Room Temperature Plasma (ARTP)" Journal of Marine Science and Engineering 12, no. 7: 1154. https://doi.org/10.3390/jmse12071154
APA StyleTong, X., Fan, S., Li, X., Zhang, M., Wang, J., & Qu, W. (2024). Improving Agar Degradation Activity of Vibrio natriegens WPAGA4 via Atmospheric and Room Temperature Plasma (ARTP). Journal of Marine Science and Engineering, 12(7), 1154. https://doi.org/10.3390/jmse12071154