Next Article in Journal
Synergistic Effect of Combination Interventions for Methicillin-Resistant Staphylococcus aureus Transmission Control in Nursing Homes: A Computation Modelling Evaluation with Heterogeneous Contact Mixing
Previous Article in Journal
Insufficient Stability of Clavulanic Acid in Widely Used Child-Appropriate Formulations
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 3
10.3390/antibiotics10030226
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Emergence of Nosocomial Pneumonia Caused by Colistin-Resistant Escherichia coli in Patients Admitted to Chest Intensive Care Unit

by
Mohamed A. El-Mokhtar
1,2,
Enas Daef
1,
Aliae A. R. Mohamed Hussein
3,
Maiada K. Hashem
3 and
Hebatallah M. Hassan
1,*
1
Department of Medical Microbiology and Immunology, Faculty of Medicine, Assiut University, Assiut 71515, Egypt
2
Microbiology and Immunology Department, Faculty of Pharmacy, Sphinx University, Assiut 71515, Egypt
3
Chest Department, Faculty of Medicine, Assiut University, Assiut 71515, Egypt
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(3), 226; https://doi.org/10.3390/antibiotics10030226
Submission received: 30 December 2020 / Revised: 13 February 2021 / Accepted: 15 February 2021 / Published: 24 February 2021
Versions Notes

Abstract

:
(1) Background: Colistin is a last-resort antibiotic used in treating multidrug-resistant Gram-negative infections. The growing emergence of colistin resistance in Escherichia coli (E. coli) represents a serious health threat, particularly to intensive care unit (ICU) patients. (2) Methods: In this work, we investigated the emergence of colistin resistance in 140 nosocomial E. coli isolated from patients with pneumonia and admitted to the chest ICU over 36 months. Virulence and resistance-related genes and E. coli pathotypes in colistin-resistant and colistin-sensitive isolates were determined. (3) Results: Colistin resistance was observed in 21/140 (15%) of the nosocomial E. coli isolates. The MIC50 of the resistant strains was 4 mg/L, while MIC90 was 16 mg/L. Colistin-resistant isolates were also co-resistant to amoxicillin, amoxicillin/clavulanic, aztreonam, ciprofloxacin, and chloramphenicol. The mechanism of colistin resistance was represented by the presence of mcr-1 in all resistant strains. Respectively, 42.9% and 36.1% of colistin-resistant and colistin-sensitive groups were extended-spectrum β-lactamase (ESBL) producers, while 23.8% and 21% were metallo β-lactamase (MBL) producers. blaTEM-type was the most frequently detected ESBL gene, while blaIMP-type was the most common MBL in both groups. Importantly, most resistant strains showed a significantly high prevalence of astA (76.2%), aggR (76.2%), and pic (52.4%) virulence-related genes. Enteroaggregative E. coli (76%) was the most frequently detected genotype among the colistin-resistant strains. (4) Conclusion: The high colistin resistance rate observed in E. coli strains isolated from patients with nosocomial pneumonia in our university hospital is worrisome. These isolates carry different drug resistance and virulence-related genes. Our results indicate the need for careful monitoring of colistin resistance in our university hospital. Furthermore, infection control policies restricting the unnecessary use of extended-spectrum cephalosporins and carbapenems are necessary.

1. Introduction

Multidrug-resistant (MDR) Gram-negative bacteria are among the most serious public health problems worldwide and are particularly important in developing countries where the misuse of antibiotics is highest [1]. The Center for Disease Control and Prevention (CDC) reported that about two million patients are infected with MDR microorganisms in the United States, and about 32,000 Americans die annually [2]. Colistin, also known as polymyxin E, is a positively charged polypeptide antibiotic that was discovered in 1949 and was effective in the treatment of Gram-negative bacterial infections. However, colistin use was clinically limited because of the reported side effects, such as the high incidence of nephro- and neurotoxicity [3]. The development of MDR bacteria and the attractive activity of colistin against these agents have necessitated the reintroduction of this old antibiotic to clinical practice [4]. Nowadays, colistin is one of the last resorts in treating serious, difficult to treat infections caused by the MDR Gram-negative bacteria, including carbapenem-resistant agents [5].
Unfortunately, increasing resistance rates to colistin have been reported worldwide, which is attributed, at least to a great extent, to the clinical misuse of colistin and/or the use of colistin in veterinary medicine. Therefore, active surveillance and monitoring of colistin resistance and the underlying resistance mechanisms are of paramount importance, particularly in patients with critical conditions such as those admitted to intensive care units (ICUs) [6].
Plasmid-mediated colistin-resistance was first described in China and was attributed to the presence of the mcr-1 gene, which encodes a transferase enzyme that inactivates colistin [7]. The mcr-1 gene was not only confined to the plasmid but was also reported to be located on the bacterial chromosome [8]. Later on, additional mcr genes (mcr-2 to mcr-10) were also described globally [9,10,11,12,13]. Several mcr-1-positive Escherichia coli (E. coli) have been isolated from both humans and animals in many different countries, which greatly impacted colistin clinical treatment strategies [14,15].
Healthcare-associated infections (nosocomial infections) are known to increase patients’ morbidity and mortality. In ICUs, the rate of nosocomial pneumonia exceeds that in general wards by 5–10 times. Moreover, the incidence of pneumonia among these critically ill patients ranges from 7% to more than 40% [16]. Nosocomial pneumonia in Europe increased the mortality rate by 6%, and duration of stay in the ICU and mechanical ventilation (10–12 days) [17]. The objective of this study was to evaluate colistin resistance in E. coli isolated from patients with nosocomial pneumonia, describe the resistance mechanism, and evaluate the associated resistance and virulence-related genes in the isolated colistin-resistant E. coli strains.

2. Material and Methods

2.1. Bacterial Strains

E. coli isolates were recovered from respiratory samples that were collected over a period of 36 months (from January 2017 to December 2019) from patients admitted to the chest ICU, Assiut University Hospital, which is one of the main tertiary hospitals in Upper Egypt. E. coli isolates were recovered from sputum, bronchial, and tracheal aspirate (in mechanically ventilated) samples of patients suffering from hospital-acquired pneumonia and were phenotypically identified using the API 20E system (Biomérieux, Marcy l’Etoile, France). Hospital-acquired pneumonia was defined as pneumonia that developed 48 h after admission, excluding infections that were incubating upon admission [18].

2.2. Sampling Process

Sputum and aspirate samples were collected for the microbiology assessment before starting the empirical antibiotic therapy. For patients who received inadequate empirical antibiotic treatment and still suffered from signs and symptoms of infection, the antibiotic therapy was continued based on the antibiogram results of the isolated pathogen. Inadequate treatment was considered if the initial empirical antibiotic therapy did not contain an effective drug against the isolated microorganism.
Samples were incubated aerobically at 37 °C for 24 h on suitable culture media: blood agar and MacConkey agar. E. coli was preliminarily identified by its characteristic growth on the differential media and was further confirmed using the API system (API 20E, BioMérieux, Marcy l’Etoile, France).

2.3. Antibiotic Susceptibility Testing

The antibiotic susceptibility profile of the E. coli isolates was determined using the Kirby–Bauer disc diffusion technique [19]. The following commonly used antibiotics were tested: amikacin, amoxicillin, amoxicillin/clavulanic acid, aztreonam, cefaclor, ceftriaxone, cephazolin, chloramphenicol, ciprofloxacin, levofloxacin, imipenem, and meropenem. Susceptibility testing was performed by inoculating Mueller–Hinton agar plates (Thermo Fisher Scientific, Waltham, MA, USA) with a bacterial suspension equivalent in turbidity to 0.5 McFarland. Plates were then incubated overnight at 37 °C before recording the results according to the Clinical and Laboratory Standard Institute guidelines [20].

2.4. Colistin Susceptibility Test

The use of the disc diffusion method for determination of colistin susceptibility is unreliable, which is attributed to the poor and unpredictable diffusion of colistin in the agar [21,22]. Therefore, in our study, we used the broth microdilution method for the determination of the minimal inhibitory concentration (MIC) to test for the colistin susceptibility. Broth microdilution is recommended by both EUCAST as well as CLSI for testing colistin susceptibility. Strains that show colistin minimal inhibitory concentrations (MICs) > 2 mg/L were interpreted as resistant according to the EUCAST breakpoints [23].

2.5. Detection of mcr Genes by Multiplex PCR

E. coli isolates that showed phenotypic resistance to colistin by the broth microdilution method were screened to detect mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5 genes by multiplex PCR (mPCR) according to the method described by Rebelo et al. [10]. Bacterial DNA was isolated from overnight cultures in Luria–Bertani medium using the Qiagen DNeasy DNA Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The PCR reaction consisted of 12.5 μL 2 × MyTaq Red Mix (Bioline, London, UK), 0.2 μM of each primer, and 2 μL bacterial DNA. The sequences of the primers and the size of the amplified target products are listed in Table 1. The PCR conditions were: 1 cycle of initial denaturation at 95 °C for 10 min, followed by 30 cycles of initial denaturation at 94 °C for 30 s, an annealing step at 58 °C for 90 s, and an elongation step at 72 °C for 90 s, then a final elongation step at 72 °C for 10 min. Synthetic DNA fragments were used as controls. The identity of the amplified amplicons was confirmed by sequencing.

2.6. Detection of Extended-Spectrum β-Lactamase and Metallo β-Lactamase Production

E. coli isolates were screened for production of extended-spectrum β-lactamase (ESBL) by testing for reduced sensitivity to one or more of ceftriaxone, cefotaxime, and ceftazidime. These potential ESBL producers were confirmed by the modified double-disc synergy test as previously described [24]. The organism was considered an ESBL producer when an increase in the zone of inhibition of cefotaxime, ceftriaxone, and cefepime towards a disc containing amoxicillin clavulanate was observed. In addition, in the presence of clavulanic acid, the MIC values for ceftazidime and cefotaxime were lowered by ≥3 twofold dilutions as tested by the E-test [24]. Moreover, E. coli isolates were screened for metallo β-lactamase (MBL) production by testing for reduced susceptibility to imipenem or meropenem. Suspected strains were considered MBL producers when the inhibition zone diameters were enhanced in the presence of EDTA as tested by the combined disc assay using imipenem and imipenem/EDTA discs [25]. To evaluate the molecular basis of the resistance phenotypes, we assayed for the common ESBL (blaTEM-type, blaCTX-M-type, and blaSHV-type) or common MBL (blaIMP-type, and blaNDM-1) genes by PCR with specific primers (Table 1).

2.7. Identification of Different E. coli Pathotypes by mPCR

The isolates were screened for the presence of different virulence genes (uidA, escV, bfpB, stx1, stx2, elt, estIa, estIb, invE, astA, aggR, and pic) by the mPCR method using the same technique described by Muller et al. [26]. Reactions were performed in a total volume of 25 μL, containing 0.25 μL of Platinum Taq DNA polymerase (5 U/μL; Thermo Scientific, Waltham, MA, USA), 84 mM Tris HCl, 50 mM KCl, 2.1 mM MgCl2, 14 mM 2-mercaptoethanol, and 0.3 mM of each dNTP. Reaction conditions included an initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s (denaturation), 63 °C for 30 s (annealing), and 72 °C for 1.5 min (extension), then a final extension for 5 min at 72 °C. Amplified products were visualized using 1.5% agarose gel electrophoresis. Primers used in the multiplex reactions are shown in Table 1. E. coli isolates were differentially classified into different pathotypes according to the profile of the tested virulence genes as described previously [26]. Enteropathogenic E. coli (EPEC) were identified as escV+ bfp+ stx−, Shiga toxin-producing E. coli (STEC) as escV+/− bfp- stx+, enterotoxigenic E. coli (ETEC) as elt+ and/or estIa+ estIb+, enteroinvasive E. coli (EIEC) as invE+, enteroaggregative E. coli (EAEC) as astA+ and/or aggR+ and/or pic+, and atypical E. coli (ATEC) as escV+ bfp− stx−.
Table
Table 1. Primers used for the multiplex PCR detection of mcr1 to mcr5, E. coli virulence-related genes, and β-lactamase enzymes.
Table 1. Primers used for the multiplex PCR detection of mcr1 to mcr5, E. coli virulence-related genes, and β-lactamase enzymes.
Target GeneSequence (5′–3′)Amplified Product (bp)Reference
mcr-1AGTCCGTTTGTTCTTGTGGC
AGATCCTTGGTCTCGGCTTG		320[10]
mcr-2CAAGTGTGTTGGTCGCAGTT
TCTAGCCCGACAAGCATACC		715
mcr-3AAATAAAAATTGTTCCGCTTATG
AATGGAGATCCCCGTTTTT		929
mcr-4TCACTTTCATCACTGCGTTG
TTGGTCCATGACTACCAATG		1116
mcr-5ATGCGGTTGTCTGCATTTATC
TCATTGTGGTTGTCCTTTTCTG		1644[27]
EPEC, ATEC, STEC
escV		ATTCTGGCTCTCTTCTTCTTTATGGCTG
CGTCCCCTTTTACAAACTTCATCGC		544[26]
EPEC
bfpB		GACACCTCATTGCTGAAGTCG
CCAGAACACCTCCGTTATGC		910
STEC
stx1		CGATGTTACGGTTTGTTACTGTGACAGC
AATGCCACGCTTCCCAGAATTG		244
STEC
stx2		GTTTTGACCATCTTCGTCTGATTATTGAG
AGCGTAAGGCTTCTGCTGTGAC		324
ETEC
elt		GAACAGGAGGTTTCTGCGTTAGGTG
CTTTCAATGGCTTTTTTTTGGGAGTC		655
ETEC
estIa		CCTCTTTTAGYCAGACARCTGAATCASTG
CAGGCAGGATTACAACAAAGTTCACAG		157
ETEC
estIb		TGTCTTTTTCACCTTTCGCTC
CGGTACAAGCAGGATTACAACAC		171
EIEC
invE		CGATAGATGGCGAGAAATTATATCCCG
CGATCAAGAATCCCTAACAGAAGAATCAC		766
EAEC
astA		TGCCATCAACACAGTATATCCG
ACGGCTTTGTAGTCCTTCCAT		102
EAEC
aggR		ACGCAGAGTTGCCTGATAAAC
AATACAGAATCGTCAGCATCAGC		400
EAEC
pic		AGCCGTTTCCGCAGAAGCC
AAATGTCAGTGAACCGACGATTGG		1111
uidAATGCCAGTCCAGCGTTTTTGC
AAAGTGTGGGTCAATAATCAGGAAGTG		1487
blaIMPGGAATAGAGTGGCTTAAYTCTC
GGTTTAAYAAAACAACCACC		232[28]
blaNDM-1CAGCGCAGCTTGTCG
TCGCGAAGCTGAGCA		784[29]
blaTEMATGAGTATTCAACATTTCCGTG
TTACCAATGCTTAATCAGTGA		861[30]
blaSHVTTATCTCCCTGTTAGCCACC
GATTTGCTGATTTCGCTCGG		795[31]
blaCTX-MSCSATGTGCAGYACCAGTAA
CCGCRATATGRTTGGTGGTG		544[32]

2.8. Statistical Analysis

The results are shown as frequencies (%) for qualitative variables. The normality of the data distribution was assessed by the Kolmogorov–Smirnov test. Comparisons between proportions were carried out using the chi-square test or Fisher’s exact test using Pearson’s probability value (p-value) where appropriate. Comparisons between quantitative variables were carried out by the Mann–Whitney test. SPSS software (SPSS 17.0, Chicago, IL, USA) was used for data analysis. A p-value less than 0.05 was considered statistically significant.

3. Results

A total of 2340 patients were admitted to chest ICU over the 36-month duration of the study, of whom 702 developed nosocomial infections (30.1%). There were 140/702 (19.9%) cases of nosocomial pneumonia infected with E. coli, of whom 76/140 (45.2%) were males and 64/140 (45.8%) were females.
Patients had a mean age of 54.5 ± 10.3 years and all of them had received empirical antibiotics, but none of them had been given colistin. Most of the patients (72.9%) required urinary catheters. Baseline characteristics of the enrolled patients are shown in Table 2.
As tested by broth microdilution, 21/140 (15%) isolates were resistant to colistin. Of note, the prevalence of colistin resistance increased over the study duration (3 years). Colistin resistance was observed in 5/55 (9.1%) patients during the first year of the study, and the rate of resistance increased to 8/49 (16.3%) patients in the next year and reached 8/36 (22.2%) patients in the third year of the study duration.
The MIC of the resistant isolates ranged from 4–16 mg/L: MIC50 was 4 mg/L, while MIC90 was 16 mg/L. Multiplex PCR screening for mcr genes (mcr-1 to mcr-5) showed that all colistin-resistant isolates harbored mcr-1, and no other mobile colistin resistance gene was detected. There were no differences between the colistin-resistant and colistin-sensitive groups regarding sex, age, diabetes mellitus, obesity, malnutrition, urinary tract catheterization, central venous catheterization, artificial feeding, or the need for mechanical ventilation (Table 2), indicating that the presence of these risk factors was not associated with resistance to colistin.
All colistin-resistant E. coli isolates also showed co-resistance to amoxicillin and amoxicillin/clavulanic acid (21/21; 100%). Moreover, a high proportion of the isolates showed co-resistance to aztreonam (10/21; 47.6%), ceftriaxone (9/21; 42.9%), chloramphenicol (9/21; 42.9%), and ciprofloxacin (9/21; 42.9%) (Table 3). However, a similar trend was also observed among the colistin-sensitive isolates (p > 0.05), indicating that co-resistance to other antibiotics was not characteristic of the colistin-resistant strains.
Resistance to third-generation cephalosporins correlated with the rate of ESBL production, while resistance to carbapenems correlated with MBL production. Regarding ESBL production, 9 (42.9%) and 43 (36.1%) of colistin-resistant and colistin-sensitive groups were ESBL producers, while 5 (23.8%) and 25 (21%) were MBL producers, respectively. blaTEM-type was the most frequently detected ESBL gene, while blaIMP-type was the most common MBL in both groups (Table 3). In the colistin-resistant isolates, two strains carried blaNDM+ blaTEM-type, and one strain carried blaIMP-type + blaCTX-M-type. However, in the colistin-sensitive group, six isolates had blaNDM + blaTEM-type, two isolates had blaIMP-type + blaCTX-M-type, and two isolates had blaIMP-type + blaNDM + blaTEM-type.
Overall, the isolated E. coli strains showed a high frequency of virulence genes. The genes aggR, escV, and astA showed the highest frequencies of 25.7%, 25%, and 21.4%, respectively. Other genes were also observed but at a lower rate (Table 4). Interestingly, colistin resistance was statistically correlated with astA, aggR, and pic genes (p = 0.001, 0.002, 0.001, respectively).
Moreover, we classified the clinical E. coli isolates according to their pathotypes (Table 5), and the most common detected E. coli strains were enteroaggregative E. coli (EAEC), followed by enterotoxigenic E. coli (ETEC) and atypical E. coli (ATEC) (rates of detection = 25.7%, 23.6%, and 20.7%, respectively). Importantly, colistin resistance was statistically associated with the enteroaggregative E. coli (EAEC) samples (76.2%; p = 0.0001). Lower levels of colistin resistance were observed among enteropathogenic E. coli (EPEC) (9.5%; p = 0.059) and Shiga toxin-producing E. coli (STEC) (9.5%; p = 0.059).

4. Discussion

Despite the improvements in therapeutic agents and infection control practice, hospital-acquired pneumonia is still a major health problem. Nosocomial pneumonia is a leading cause of morbidity and mortality and is associated with longer hospital stays (7–9 days), particularly when coupled with antibiotic-resistant organisms [33]. The Center for Disease Control and Prevention (CDC) and the Nosocomial Infection Surveillance System (NISS) have reported that the most important causative agents for nosocomial pneumonia are the Gram-negative bacilli [34,35].
Patients admitted to chest intensive care units are frequently subjected to prolonged antibiotic therapy, which increases the risk of the development of antibiotic resistance, which explains the high rates of antimicrobial resistance observed in our samples [36,37,38,39,40,41]. The increased resistance to multiple antibiotics in Gram-negative bacteria presents significant global health-care problems because these MDR Gram-negative pathogens are often not controlled by the available and effective antibiotics [42,43,44]. The advent of MDR Gram-negative bacteria in recent years has made colistin an effective therapeutic alternative for various infections [45]. Two types of risk factor have been described for nosocomial pneumonia: the patient and factors related to infection prevention. Patient-related factors include prolonged hospitalization, malnutrition, acidosis, smoking, and the presence of comorbidities (CNS disease, chronic obstructive pulmonary disease, respiratory insufficiency, and diabetes mellitus) [18,46,47]. However, risk factors related to infection prevention include bad hygiene, failure of sterilization techniques, or inappropriate prolonged antibiotic treatment [48,49]. In our study, colistin resistance was not associated with age, sex, urinary tract catheters, diabetes mellitus, obesity, malnutrition, central venous catheters, artificial feeding, or laboratory parameters. However, the risk factors differed according to the geographical area and the analyzed population.
The present study described the prevalence of colistin resistance in clinical isolates of E. coli isolated from cases of nosocomial pneumonia. Colistin resistance was observed in 15% of the isolates, although none of the patients had received colistin. A similar high level of colistin resistance (23.1%) was observed in the same hospital among E. coli isolated from urine samples [50]. Overall, the rate of colistin resistance was higher when compared with other reported cases in other countries [51,52,53]. A study from the worldwide SENTRY antimicrobial surveillance program reported that resistance to polymyxins is stable for most Gram-negative pathogens except for Klebsiella species. Pseudomonas aeruginosa (P. aeruginosa), Acinetobacter spp., and Klebsiella spp. showed resistance rates of 0.4%, 0.9%, and 1.5%, respectively [54]. In Nigeria and South Africa, colistin resistance rates were less than 10% [55]. Studies from Tunisia showed that 0.09% of E. coli and 1.2% of Klebsiella pneumoniae strains were resistant to colistin [56]. In the United Kingdom, a low percentage of P. aeruginosa strains were colistin-resistant (3.1%) [57]. A study from Spain showed that 19.1% of Acinetobacter baumannii (A. baumannii) strains were resistant to colistin [58]. Miftode et al. [59] analyzed the colistin resistance of E. coli and Klebsiella in Romania and reported 11% and 17% of them to be colistin-resistant, respectively. The use of empirical antibiotic therapy may lead to an increase in the detection of the resistant isolates because susceptible isolates may not be detected. However, adequate empirical antibiotics are essential to decrease the length of hospitalization and achieve better clinical resolution in both hospital and ventilator-associated cases of pneumonia [60].
Alarmingly, when we analyzed the prevalence of the colistin resistance over the 3 years (36 months), we noticed a steady increase in the resistance rates to colistin from 9.1% in the first year to 16.3% in the second year and 22.2% in the third year. Therefore, active surveillance of colistin resistance is very important in our university hospital to monitor and prevent the further spread of the nosocomial colistin-resistant strains. Colistin resistance was first identified in Egypt in E. coli isolated from a sputum sample from a patient admitted to ICU of Cairo City Hospital [61]. Interestingly, this isolate belonged to sequence type ST1011, which was described in Egypt as an avian fecal strain [62]. Another alarming rate for colistin resistance in Egypt was reported among cancer patients, where 8.8% of Klebsiella pneumoniae (K. pneumoniae) and E. coli strains were colistin-resistant [63]. In agreement with different reports, in our study, resistance to colistin was mediated by the presence of the mcr-1 gene, which is responsible for the addition of phosphoethanolamine to the lipid A fraction of the cell wall [64,65,66]. However, we did not test the presence of the recently reported types of mcr such as mcr 6–10 or the pmrA/B and phoP/Q genes. Importantly, Snesrud et al. [67] showed that mcr-1 could be mobilized as a transposon which may reflect the wide spread of colistin resistance in the Gram-negative bacilli.
Of note, our isolates showed a high colistin resistance rate, although none of the patients had received colistin. This could be explained, in general, by the increased exposure and use of antimicrobials, leading to the selection of multidrug-resistant microorganisms and horizontal pathogen transmissions [68]. It is also possible that resistant strains have become more prevalent and widespread in the hospital environment, regardless of the particular risk factors of the group of patients involved, and are circulating in the hospital environment [69]. Importantly, a similar rate of colistin resistance was observed in the same hospital in E. coli strains isolated from the urine samples of patients suffering from urinary tract infections [50].
At the community level, colistin use in animal production was proposed as the most likely factor leading to the development of mcr-1. Liu et al. [7] showed that colistin usage in chicken farms was associated with increased colonization of chickens with mcr-1 carrying bacteria. Furthermore, human exposure to mcr-1+ chickens was associated with increased colonization with colistin-resistant bacteria, pointing to the need to restrict the use of colistin as an antimicrobial drug in animals used for food production [70]. In Portugal, screening of 100 rectal swabs from pigs revealed 98 mcr-1-positive isolates [71]. It is possible that persistent exposure to low levels of colistin, such as those originating from the use of colistin-containing poultry food, led to the development of colistin resistance [64].
In fact, the actual regular rate of resistance to colistin is not known, as it is not tested on a routine in our microbiology laboratories. Colistin resistance is typically tested in MDR isolates when it is considered for treatment [66]. Generally, the tested E. coli strains showed an MDR phenotype regardless of colistin resistance.
Of the 140 E. coli isolates, 52/140 (37.1%) were ESBL producers and 30/140 (21.4%) were MBL producers, with the predominance of blaTEM-type and blaIMP-type resistance-associated genes, regardless of colistin resistance status, which is in line with previous studies from the university hospital [36,72]. Many isolates carried more than one resistance-associated gene. This high level of resistance is consistent with the fact that these isolates were nosocomial in origin, which are well-known for their resistance to multiple antibiotics. Bradford et al. [73] showed that colistin-resistant Enterobacteriaceae isolates showed a strong association with carrying ESBL enzymes such as blaCTX-M-type, blaSHV-type, and blaVEB variants, and/or a high level of KPC type carbapenemase (65.5%). Kontopoulou et al. [74] described a clonal spread of a colistin-resistant K. pneumoniae that produced a carbapenemase-type of β-lactamase in hospitals in Greece. In Tunisia, 7/29 carbapeneme-resistant K. pneumoniae were also resistant to colistin and were responsible for an outbreak in a university hospital [75].
Importantly, most of the colistin-resistant E. coli identified in this study also exhibited a high carriage rate of virulence genes: astA (76.2%), aggR (76.2%), and pic (52.4%). These genes are responsible for the production of enteroaggregative E. coli heat-stable toxin-1, a regulator for a number of virulence-associated genes, and a serine protease precursor, respectively [76]. These genes are characteristic of the enteroaggregative type of E. coli. Although EAEC in this study were isolated from pneumonia patients, these strains, in fact, commonly cause persistent diarrhea in children [77]. Extraintestinal E. coli infections emerged during the 2000s and are characterized by a high level of antibiotic resistance, especially to B-lactams and fluoroquinolones. The extraintestinal infections of E. coli included nosocomial pneumonia, bacteremia, and neonatal meningitis [78]. These isolates often exhibit a broad range of virulence-related genes, including toxins, adhesion, and invasion factors, which increase the ability to colonize the lungs and other body tissues [3,79].
astA is similar to the heat-stable enterotoxin ETEC and it functions by interfering with cGMP signaling, leading to secretion of anions and impaired fluid balance across the epithelium [80]. AggR is a transcriptional activator that stimulates the production of many plasmid- and chromosomal-mediated virulence genes [81]. Pic has diverse biological functions; it has a mucinolytic activity, which might enhance the ability of E. coli to penetrate the mucus layer and promote bacterial colonization [82]. It plays a potential role in complement resistance through protease activity [83]. Pic may also contribute to the production of biofilms [84].
Despite a huge amount of research accumulated on the mechanism of E. coli’s damage in gastro-intestinal tract, urinary tract, bloodstream, and CNS infections, there is, surprisingly, little data on pulmonary infections, although E. coli causes infections in ICUs as frequently as Pseudomonas [85]. The main E coli pathotypes detected in our cases were the enteroaggregative E. coli, which carry the AggR gene responsible for aggregative adherence to tissue. This type of E. coli is known to cause infection in elderly or immunocompromised patients, which is consistent with the fact that our patients are in the ICU. The role of the different E. coli virulence factors, including Shiga toxin, in pneumonia pathogenesis has not been clearly investigated, and we did not carry out experimental analysis on the role of the toxins in pulmonary cells. Increased awareness of the geno- and phenotypic characters of E. coli causing pneumonia in ICUs is a crucial first step in identifying preventive strategies. To the best of our knowledge, this is the first study of the correlation between colistin resistance in E. coli and the distribution of the virulence-related genes and E. coli pathotypes.

5. Conclusions

In conclusion, the high colistin resistance rate observed among E. coli strains isolated from patients with nosocomial pneumonia in our university hospital is worrisome. These isolates carry different drug resistance and virulence-related genes. Our results indicate that strict monitoring of colistin-resistant E. coli in our university hospital is necessary. Furthermore, infection control policies restricting the unnecessary use of extended-spectrum cephalosporins and carbapenems are needed.

Author Contributions

Conceptualization: M.A.E.-M., E.D. and H.M.H.; methodology: M.A.E.-M., E.D., A.A.R.M.H., M.K.H. and H.M.H.; formal analysis: M.A.E.-M., E.D., A.A.R.M.H., M.K.H. and H.M.H.; clinical investigations: A.A.R.M.H. and M.K.H.; data curation: M.A.E.-M. and H.M.H.; writing—original draft preparation: M.A.E.-M. and H.M.H.; project administration: M.A.E.-M., E.D., A.A.R.M.H., M.K.H. and H.M.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Assiut University, Faculty of Medicine (IRB no: 17300410).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data generated in this study are available from the corresponding author on reasonable request.

Acknowledgments

We acknowledge the Medical Research Center, Faculty of Medicine and the Infection Control Research Laboratory for providing the necessary laboratory equipment for carrying out the experiments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, X.; Zhao, X.; Che, J.; Xiong, Y.; Xu, Y.; Zhang, L.; Lan, R.; Xia, L.; Walsh, T.R.; Xu, J.; et al. Detection and dissemination of the colistin resistance gene, mcr-1, from isolates and faecal samples in China. J. Med. Microbiol. 2017, 66, 119–125. [Google Scholar] [CrossRef] [PubMed]
  2. Weinstein, R.A.; Gaynes, R.; Edwards, J.R.; System, N.N.I.S. Overview of nosocomial infections caused by gram-negative bacilli. Clin. Infect. Dis. 2005, 41, 848–854. [Google Scholar] [CrossRef]
  3. Li, J.; Nation, R.L.; Turnidge, J.D.; Milne, R.W.; Coulthard, K.; Rayner, C.R.; Paterson, D.L. Colistin: The re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. Lancet Infect. Dis. 2006, 6, 589–601. [Google Scholar] [CrossRef]
  4. Ahmed, M.A.E.-G.E.-S.; Zhong, L.-L.; Shen, C.; Yang, Y.; Doi, Y.; Tian, G.-B. Colistin and its role in the Era of antibiotic resistance: An extended review (2000–2019). Emerg. Microbes Infect. 2020, 9, 868–885. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Giacobbe, D.R.; Saffioti, C.; Losito, A.R.; Rinaldi, M.; Aurilio, C.; Bolla, C.; Boni, S.; Borgia, G.; Carannante, N.; Cassola, G.; et al. Use of colistin in adult patients: A cross-sectional study. J. Glob. Antimicrob. Resist. 2020, 20, 43–49. [Google Scholar] [CrossRef] [PubMed]
  6. Kijima-Tanaka, M.; Ishihara, K.; Morioka, A.; Kojima, A.; Ohzono, T.; Ogikubo, K.; Takahashi, T.; Tamura, Y. A national surveillance of antimicrobial resistance in Escherichia coli isolated from food-producing animals in Japan. J. Antimicrob. Chemother. 2003, 51, 447–451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.D.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  8. Veldman, K.; van Essen-Zandbergen, A.; Rapallini, M.; Wit, B.; Heymans, R.; van Pelt, W.; Mevius, D. Location of colistin resistance gene mcr-1 in Enterobacteriaceae from livestock and meat. J. Antimicrob. Chemother. 2016, 71, 2340–2342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible salmonella enterica serotype typhimurium isolate. mBio 2019, 10, e00853-19. [Google Scholar] [CrossRef] [Green Version]
  10. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 17–00672. [Google Scholar] [CrossRef] [PubMed]
  11. Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg. Microbes Infect. 2020, 9, 508–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Eurosurveillance 2016, 21, 30280. [Google Scholar] [CrossRef]
  13. Yin, W.; Shaolin, W.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhangqi, S.; Walsh, T.R.; Shen, J.; Wang, Y. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. MBio 2017, 8, e00543-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Hadjadj, L.; Riziki, T.; Zhu, Y.; Linda, H.; Diene, S.M.; Rolain, J.-M. Study of mcr-1 gene-mediated colistin resistance in enterobacteriaceae isolated from humans and animals in different countries. Genes 2017, 8, 394. [Google Scholar] [CrossRef] [Green Version]
  15. Luo, Q.; Wang, Y.; Xiao, Y. Prevalence and transmission of mobilized colistin resistance (mcr) gene in bacteria common to animals and humans. Biosaf. Health 2020, 2, 71–78. [Google Scholar] [CrossRef]
  16. Torres, A.; Aznar, R.; Gatell, J.M.; Jiménez, P.; González, J.; Ferrer, A.; Celis, R.; Rodriguez-Roisin, R. Incidence, risk, and prognosis factors of nosocomial pneumonia in mechanically ventilated patients. Am. Rev. Respir. Dis. 1990, 142, 523–528. [Google Scholar] [CrossRef]
  17. Koulenti, D.; Tsigou, E.; Rello, J. Nosocomial pneumonia in 27 ICUs in Europe: Perspectives from the EU-VAP/CAP study. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 1999–2006. [Google Scholar] [CrossRef] [PubMed]
  18. American Thoracic Society; Infectious Diseases Society of America. Guidelines for the management of adults with hospital-acquired, ventilator-associated, and healthcare-associated pneumonia. Am. J. Respir. Crit. Care Med. 2005, 171, 388–416. [Google Scholar] [CrossRef]
  19. Boyle, V.J.; Fancher, M.E.; Ross, R.W. Rapid, modified Kirby-Bauer susceptibility test with single, high-concentration antimicrobial disks. Antimicrob. Agents Chemother. 1973, 3, 418–424. [Google Scholar] [CrossRef] [Green Version]
  20. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Suppl. M100; CLSI: Pittsburgh, PA, USA, 2020; Volume 40, pp. 1–332. [Google Scholar]
  21. Prim, N.; Rivera, A.; Coll, P.; Mirelis, B. Is colistin susceptibility testing finally on the right track? Antimicrob. Agents Chemother. 2018, 62, e02067-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Singhal, L.; Sharma, M.; Verma, S.; Kaur, R.; Britto, X.B.; Kumar, S.M.; Ray, P.; Gautam, V. Comparative evaluation of broth microdilution with polystyrene and glass-coated plates, agar dilution, E-test, vitek, and disk diffusion for susceptibility testing of colistin and polymyxin b on carbapenem-resistant clinical isolates of acinetobacter baumannii. Microb. Drug Resist. 2018, 24, 1082–1088. [Google Scholar] [CrossRef] [PubMed]
  23. Matuschek, E.; Åhman, J.; Webster, C.; Kahlmeter, G. Antimicrobial susceptibility testing of colistin–Evaluation of seven commercial MIC products against standard broth microdilution for Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter spp. Clin. Microbiol. Infect. 2018, 24, 865–870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Malloy, A.M.; Campos, J.M. Extended-spectrum beta-lactamases: A brief clinical update. Pediatr. Infect. Dis. J. 2011, 30, 1092–1093. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Yong, D.; Lee, K.; Yum, J.H.; Shin, H.B.; Rossolini, G.M.; Chong, Y. Imipenem-edta disk method for differentiation of metallo-beta-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter spp. J. Clin. Microbiol. 2002, 40, 3798–3801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Muüller, D.; Greune, L.; Heusipp, G.; Karch, H.; Fruth, A.; Tschaäpe, H.; Schmidt, M.A. Identification of unconventional intestinal pathogenic escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 2007, 73, 3380–3390. [Google Scholar] [CrossRef] [Green Version]
  27. Borowiak, M.; Fischer, J.A.; Hammerl, J.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [PubMed]
  29. Peirano, G.; Ahmed-Bentley, J.; Woodford, N.; Pitout, J.D. New delhi metallo-beta-lactamase from traveler returning to Canada. Emerg. Infect. Dis. 2011, 17, 242–244. [Google Scholar] [CrossRef] [PubMed]
  30. Szabó, D.; Bonomo, R.A.; Silveira, F.; Pasculle, A.W.; Baxter, C.; Linden, P.K.; Hujer, A.M.; Deeley, K.; Paterson, D.L.; Hujer, K.M. SHV-type extended-spectrum beta-lactamase production is associated with reduced cefepime susceptibility in enterobacter cloacae. J. Clin. Microbiol. 2005, 43, 5058–5064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Poirel, L.; Karim, A.; Mercat, A.; Le Thomas, I.; Vahaboglu, H.; Richard, C.; Nordmann, P. Extended-spectrum β-lactamase-producing strain of Acinetobacter baumannii isolated from a patient in France. J. Antimicrob. Chemother. 1999, 43, 157–158. [Google Scholar] [CrossRef] [PubMed]
  32. Minarini, L.A.; Poirel, L.; Trevisani, N.A.; Darini, A.L.C.; Nordmann, P. Predominance of CTX-M–type extended-spectrum β-lactamase genes among enterobacterial isolates from outpatients in Brazil. Diagn. Microbiol. Infect. Dis. 2009, 65, 202–206. [Google Scholar] [CrossRef]
  33. El Solh, A.A.; Alhajhusain, A. Update on the treatment of Pseudomonas aeruginosa pneumonia. J. Antimicrob. Chemother. 2009, 64, 229–238. [Google Scholar] [CrossRef] [Green Version]
  34. Garnacho, J.; Sole-Violan, J.; Sa-Borges, M.; Diaz, E.; Rello, J. Clinical impact of pneumonia caused by Acinetobacter baumannii in intubated patients: A matched cohort study. Crit. Care Med. 2003, 31, 2478–2482. [Google Scholar] [CrossRef] [PubMed]
  35. Evans, E.M.; Feola, D.J.; Rapp, R.P. Polymyxin B sulfate and colistin: Old antibiotics for emerging multiresistant gram-negative bacteria. Ann. Pharmacother. 1999, 33, 960–967. [Google Scholar] [CrossRef]
  36. Ahmed, S.H.; Daef, E.A.; Badary, M.S.; Mahmoud, M.A.; Abd-Elsayed, A.A. Nosocomial blood stream infection in intensive care units at Assiut University hospitals (Upper Egypt) with special reference to extended spectrum beta-lactamase producing organisms. BMC Res. Notes 2009, 2, 76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Brusselaers, N.; Vogelaers, D.; Blot, S. The rising problem of antimicrobial resistance in the intensive care unit. Ann. Intensiv. Care 2011, 1, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. El-Mokhtar, M.A.; Hetta, H.F. Ambulance vehicles as a source of multidrug-resistant infections: A multicenter study in Assiut City, Egypt. Infect. Drug Resist. 2018, 11, 587–594. [Google Scholar] [CrossRef] [Green Version]
  39. Elgendy, S.G.; Hameed, M.R.A.; El-Mokhtar, M.A. Tigecycline resistance among Klebsiella pneumoniae isolated from febrile neutropenic patients. J. Med. Microbiol. 2018, 67, 972–975. [Google Scholar] [CrossRef] [PubMed]
  40. Mohamed, S.A.; Hassan, A.T.; Mohamed, M.S.; El-Mokhtar, A.M. Acute exacerbations of chronic obstructive pulmonary disease: Etiological bacterial pathogens and antibiotic resistance in Upper Egypt. Egypt. J. Bronchol. 2016, 10, 283. [Google Scholar] [CrossRef]
  41. Eltwisy, H.O.; Abdel-Fattah, M.; Elsisi, A.M.; Omar, M.M.; Abdelmoteleb, A.A.; El-Mokhtar, M.A. Pathogenesis of Staphylococcus haemolyticus on primary human skin fibroblast cells. Virulence 2020, 11, 1142–1157. [Google Scholar] [CrossRef] [PubMed]
  42. Karaiskos, I.; Lagou, S.; Pontikis, K.; Rapti, V.; Poulakou, G. The “old” and the “new” antibiotics for mdr gram-negative pathogens: For whom, when, and how. Front. Public Health 2019, 7, 151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Thabit, A.G.; El-Sabour, E.A.; Nafie, A.M.A.; El-Mokhtar, M.A.; Biomy, Y.E. Detection of proteus species in diabetic wounds and their antibiotic resistance profile analysis. Bull. Pharm. Sci. Assiut 2020, 43, 1–10. [Google Scholar] [CrossRef]
  44. Elkhawaga, A.A.; Hetta, H.F.; Osman, N.S.; Hosni, A.; El-Mokhtar, M.A. Emergence of Cronobacter sakazakii in cases of neonatal sepsis in Upper Egypt: First report in North Africa. Front. Microbiol. 2020, 11, 215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Çetin, Ç.B.; Türk, D.Ö.; Şenol, Ş.; Horasan, G.D.; Tunger, O. Colistin efficacy in the treatment of multidrug-resistant and extremelydrug-resistant gram-negative bacterial infections. Turk. J. Med. Sci. 2016, 46, 1379–1384. [Google Scholar] [CrossRef]
  46. Micek, S.T.; Chew, B.; Hampton, N.; Kollef, M.H. A case-control study assessing the impact of nonventilated hospital-acquired pneumonia on patient outcomes. Chest 2016, 150, 1008–1014. [Google Scholar] [CrossRef]
  47. Zaragoza, R.; Vidal-Cortés, P.; Aguilar, G.; Borges, M.; Diaz, E.; Ferrer, R.; Maseda, E.; Nieto, M.; Nuvials, F.X.; Ramirez, P.; et al. Update of the treatment of nosocomial pneumonia in the ICU. Crit. Care 2020, 24, 1–13. [Google Scholar] [CrossRef]
  48. Wilke, M.; Grube, R. Update on management options in the treatment of nosocomial and ventilator assisted pneumonia: Review of actual guidelines and economic aspects of therapy. Infect. Drug Resist. 2013, 7, 1–7. [Google Scholar] [CrossRef] [Green Version]
  49. Di Pasquale, M.; Aliberti, S.; Mantero, M.; Bianchini, S.; Blasi, F. Non-intensive care unit acquired pneumonia: A new clinical entity? Int. J. Mol. Sci. 2016, 17, 287. [Google Scholar] [CrossRef] [PubMed]
  50. El-Mokhtar, M.A.; Mandour, S.A.; Shahat, A.A. Colistin resistance among multidrug-resistant E. coli isolated from Upper Egypt. Egypt. J. Med. Microbiol. 2019, 28, 11–17. [Google Scholar]
  51. Santimaleeworagun, W.; Thunyaharn, S.; Juntanawiwat, P.; Thongnoy, N.; Harindhanavudhi, S.; Nakee-sathit, S.; Teschumroon, S. The prevalence of colistin-resistant Gram-negative bacteria isolated from hospitalized patients with bacteremia. J. Appl. Pharm. Sci. 2020, 10, 056–059. [Google Scholar]
  52. Devkota, S.P.; Paudel, A. Colistin resistance among Gram-negative isolates in Nepal: A review. J. Biomed. Sci. 2020, 7, 33–39. [Google Scholar] [CrossRef]
  53. Doumith, M.; Godbole, G.; Ashton, P.; Larkin, L.; Dallman, T.; Day, M.; Day, M.; Muller-Pebody, B.; Ellington, M.J.; de Pinna, E.; et al. Detection of the plasmid-mediated mcr-1 gene conferring colistin resistance in human and food isolates of Salmonella enterica and Escherichia coli in England and Wales. J. Antimicrob. Chemother. 2016, 71, 2300–2305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Gales, A.C.; Jones, R.N.; Sader, H.S. Contemporary activity of colistin and polymyxin B against a worldwide collection of Gram-negative pathogens: Results from the SENTRY Antimicrobial Surveillance Program (2006–09). J. Antimicrob. Chemother. 2011, 66, 2070–2074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Bialvaei, A.Z.; Kafil, H.S. Colistin, mechanisms and prevalence of resistance. Curr. Med Res. Opin. 2015, 31, 707–721. [Google Scholar] [CrossRef]
  56. Mezghani Maalej, S.; Rekik Meziou, M.; Mahjoubi, F.; Hammami, A. Epidemiological study of Enterobacte-riaceae resistance to colistin in Sfax (Tunisia). Med. Mal. Infect. 2012, 42, 256–263. [Google Scholar] [CrossRef] [PubMed]
  57. Pitt, T.L.; Sparrow, M.; Warner, M.; Stefanidou, M. Survey of resistance of Pseudomonas aeruginosa from UK patients with cystic fibrosis to six commonly prescribed antimicrobial agents. Thorax 2003, 58, 794–796. [Google Scholar] [CrossRef] [Green Version]
  58. Arroyo, L.A.; Garcia-Curiel, A.; Pachon-Ibanez, M.E.; Llanos, A.C.; Ruiz, M.; Pachon, J.; Aznar, J. Reliability of the E-test method for detection of colistin resistance in clinical isolates of acinetobacter baumannii. J. Clin. Microbiol. 2005, 43, 903–905. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Miftode, E.; Dorneanu, O.; Leca, D.; Teodor, A.; Mihalache, D.; Filip, O.; Luca, V. Antimicrobial resistance profile of E. coli and Klebsiella spp. from urine in the infectious diseases hospital Iasi. Rev. Med. Chir. Soc. Med. Nat. Iasi 2008, 112, 478–482. [Google Scholar]
  60. Piskin, N.; Aydemir, H.; Oztoprak, N.; Akduman, D.; Comert, F.; Kokturk, F.; Celebi, G. Inadequate treat-ment of ventilator-associated and hospital-acquired pneumonia: Risk factors and impact on outcomes. BMC Infect. Dis. 2012, 12, 268. [Google Scholar] [CrossRef] [Green Version]
  61. Elnahriry, S.S.; Khalifa, H.O.; Soliman, A.M.; Ahmed, A.M.; Hussein, A.M.; Shimamoto, T.; Shimamoto, T. Emergence of plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate from Egypt. J. Antimicrob. Chemother. 2016, 60, 3249–3250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Hussein, A.H.M.; Ghanem, I.A.I.; Eid, A.A.M.; Ali, M.A.; Sherwood, J.S.; Li, G.; Nolan, L.K.; Logue, C.M. Molecular and phenotypic characterization of escherichia coli isolated from broiler chicken flocks in Egypt. Avian Dis. 2013, 57, 602–611. [Google Scholar] [CrossRef]
  63. Zafer, M.M.; El-Mahallawy, H.A.; Abdulhak, A.; Amin, M.A.; Al-Agamy, M.H.; Radwan, H.H. Emergence of colistin resistance in multidrug-resistant Klebsiella pneumoniae and Escherichia coli strains isolated from cancer patients. Ann. Clin. Microbiol. Antimicrob. 2019, 18, 1–8. [Google Scholar] [CrossRef] [PubMed]
  64. Yamaguchi, T.; Kawahara, R.; Hamamoto, K.; Hirai, I.; Khong, D.T.; Nguyen, T.N.; Tran, H.T.; Motooka, D.; Nakamura, S.; Yamamoto, Y. High prevalence of colistin-resistant Escherichia coli with chromosomally carried mcr-1 in healthy residents in Vietnam. Msphere 2020, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Castanheira, M.; Griffin, M.A.; Deshpande, L.M.; Mendes, R.E.; Jones, R.N.; Flamm, R.K. Detection of mcr-1 among Escherichia coli clinical isolates collected worldwide as part of the sentry antimicrobial surveillance program in 2014 and 2015. J. Antimicrob. Agents 2016, 60, 5623–5624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Prim, N.; Turbau, M.; Rivera, A.; Rodríguez-Navarro, J.; Coll, P.; Mirelis, B. Prevalence of colistin resistance in clinical isolates of Enterobacteriaceae: A four-year cross-sectional study. J. Infect. 2017, 75, 493–498. [Google Scholar] [CrossRef] [PubMed]
  67. Snesrud, E.; McGann, P.; Chandler, M. The birth and demise of the isapl1-mcr-1-isapl1 composite transpos-on: The vehicle for transferable colistin resistance. MBio 2018, 9. [Google Scholar] [CrossRef] [Green Version]
  68. Blot, S.; Koulenti, D.; Dimopoulos, G.; Martin, C.; Komnos, A.; Krueger, W.A.; Spina, G.; Armaganidis, A.; Rello, J. Prevalence, risk factors, and mortality for ventilator-associated pneumonia in middle-aged, old, and very old critically ill patients. Crit. Care Med. 2014, 42, 601–609. [Google Scholar] [CrossRef] [PubMed]
  69. Vogelaers, D.; De Bels, D.; Forêt, F.; Cran, S.; Gilbert, E.; Schoonheydt, K.; Blot, S. Patterns of antimicrobial therapy in severe nosocomial infections: Empiric choices, proportion of appropriate therapy, and adaptation rates—A multicentre, observational survey in critically ill patients. Int. J. Antimicrob. Agents 2010, 35, 375–381. [Google Scholar] [CrossRef]
  70. Trung, N.V.; Matamoros, S.; Hardon, A.; Mai, N.T.N.; Hieu, T.Q.; Thwaites, G.; De Jong, M.D.; Schultsz, C.; Hoa, N.T.; Carrique-Mas, J.J.; et al. Zoonotic transmission of mcr-1 colistin resistance gene from small-scale poultry farms, Vietnam. Emerg. Infect. Dis. 2017, 23, 529–532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Kieffer, N.; Aires-de-Sousa, M.; Nordmann, P.; Poirel, L. High rate of mcr-1–producing Escherichia coli and Klebsiella pneumoniae among pigs, Portugal. J. Emerg. Infect. Dis. 2017, 23, 2023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Ramadan, H.K.; Mahmoud, M.A.; Aburahma, M.Z.; Elkhawaga, A.A.; El-Mokhtar, M.A.; Sayed, I.M.; Hosni, A.; Hassany, S.M.; Medhat, M.A. Predictors of severity and co-infection resistance profile in COVID-19 patients: First report from upper Egypt. Infect. Drug. Resist. 2020, 13, 3409–3422. [Google Scholar] [CrossRef]
  73. Bradford, P.A.; Kazmierczak, K.M.; Biedenbach, D.J.; Wise, M.G.; Hackel, M.; Sahm, D.F. Correlation of β-lactamase production and colistin resistance among Enterobacteriaceae isolates from a global surveillance program. J. Antimicrob. Agents Chemother. 2016, 60, 1385–1392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Kontopoulou, K.; Protonotariou, E.; Vasilakos, K.; Kriti, M.; Koteli, A.; Antoniadou, E.; Sofianou, D. Hospital outbreak caused by Klebsiella pneumoniae producing KPC-2 beta-lactamase resistant to colistin. J. Hosp. Infect. 2010, 76, 70–73. [Google Scholar] [CrossRef] [PubMed]
  75. Mansour, W.; Haenni, M.; Saras, E.; Grami, R.; Mani, Y.; Ben Haj Khalifa, A.; El Atrouss, S.; Kheder, M.; Fekih Hassen, M.; Boujaafar, N.; et al. Outbreak of colistin-resistant carbapenemase-producing Klebsiella pneu-moniae in Tunisia. J. Glob. Antimicrob. Resist. 2017, 10, 88–94. [Google Scholar] [CrossRef] [PubMed]
  76. Savarino, S.J.; Fasano, A.; Robertson, D.C.; Levine, M.M. Enteroaggregative Escherichia coli elaborate a heat-stable enterotoxin demonstrable in an in vitro rabbit intestinal model. J. Clin. Investig. 1991, 87, 1450–1455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Nataro, J.P.; Steiner, T.; Guerrant, R.L. Enteroaggregative Escherichia coli. Emerg. Infect. Dis. 1998, 4, 251–261. [Google Scholar] [CrossRef] [Green Version]
  78. Foxman, B. The epidemiology of urinary tract infection. Nat. Rev. Urol. 2010, 7, 653–660. [Google Scholar] [CrossRef]
  79. Pitout, J.D.D. Extraintestinal pathogenic Escherichia coli: An update on antimicrobial resistance, laboratory diagnosis and treatment. Expert Rev. Anti-Infect. Ther. 2012, 10, 1165–1176. [Google Scholar] [CrossRef]
  80. Ménard, L.-P.; Dubreuil, J.D. Enteroaggregative Escherichia coli heat-stable Enterotoxin 1 (EAST1): A new toxin with an old twist. Crit. Rev. Microbiol. 2002, 28, 43–60. [Google Scholar] [CrossRef]
  81. Kaur, P.; Chakraborti, A.; Asea, A. Enteroaggregative Escherichia coli: An emerging enteric food Borne pathogen. Interdiscip. Perspect. Infect. Dis. 2010, 2010, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Henderson, I.R.; Czeczulin, J.; Eslava, C.; Noriega, F.; Nataro, J.P. Characterization of Pic, a Secreted Protease of Shigella flexneri and Enteroaggregative Escherichia coli. Infect. Immun. 1999, 67, 5587–5596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Henderson, I.R.; Hicks, S.; Navarro-Garcia, F.; Elias, W.P.; Philips, A.D.; Nataro, J.P. Involvement of the enteroaggregative Escherichia coli plasmid-encoded toxin in causing human intestinal damage. Infect. Immun. 1999, 67, 5338–5344. [Google Scholar] [CrossRef] [Green Version]
  84. Navarro-Garcia, F.; Gutierrez-Jimenez, J.; Garcia-Tovar, C.; Castro, L.A.; Salazar-Gonzalez, H.; Cordova, V. Pic, an autotransporter protein secreted by different pathogens in the enterobacteriaceae family, is a potent mucus secretagogue. Infect. Immun. 2010, 78, 4101–4109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  85. Vincent, J.-L.; Rello, J.; Reinhart, K.; Marshall, J.K.; Silva, E.; Anzueto, A.; Martin, C.D.; Moreno, R.; Lipman, J.; Gomersal, C. International study of the prevalence and outcomes of infection in intensive care units. JAMA 2009, 302, 2323–2329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table
Table 2. Baseline characteristics of the patients admitted to the chest intensive care unit (ICU) with pneumonia.
Table 2. Baseline characteristics of the patients admitted to the chest intensive care unit (ICU) with pneumonia.
Risk FactorsTotal Patients Infected with E. coli
(n = 140)		Colistin-Resistant Group (n = 21)Colistin-Sensitive Group (n = 119)p-Value
Sex (male)76 (45.2%)13 (61.9%)63 (52.9%)0.512
Age (years)54.5 ± 10.357.6 ± 6.453.7 ± 10.90.872
Empiric antibiotic therapy during hospitalization140 (100%)21 (100%)119 (100%)NA
Urinary tract catheter102 (72.9%)17 (81.0%)85 (71.4%)0.366
Diabetes mellitus51 (36.4%)9 (42.9%)42 (35.3%)0.507
Obesity42 (30.0 %)6 (28.6%)36 (30.3%)0.877
Malnutrition39 (27.9%)6 (28.6%)33 (27.7%)0.937
Central venous catheter13 (9.3%)2 (9.5%)11 (9.2%)1.000
Artificial feeding14 (10%)1 (4.8%)13 (10.9%)0.694
Mechanical ventilation22 (15.7%)4 (19.0%)18 (15.1%)0.745
Worsening oxygenation112 (80%)15 (76.2)96 (80.7%)0.732
Pleural effusion20 (14.3%)3 (14.3%)17 (14.3%)0.979
Cavitation on chest radiograph5 (3.5%)1 (4.7%)4 (3.4%)0.891
WBC (×109/L)8.1 ± 3.77.6 ± 3.28.6 ± 3.40.547
Hemoglobin (g/dL)12.6 ± 1.212.3 ± 1.612.9 ± 10.378
Platelets (×103/μL)277 ± 84273 ± 80.1281 ± 840.978
NA = Not applicable.
Table
Table 3. Co-resistance profile and resistance-associated genes for E. coli isolates.
Table 3. Co-resistance profile and resistance-associated genes for E. coli isolates.
AntibioticColistin-Resistant Group
n = 21		Colistin-Sensitive Group
n = 119		p-Value
Amikacin5 (23.8%)23 (19.3%)0.767
Amoxicillin21 (100%)119 (100%)NA
Amoxicillin/clavulanic acid21 (100%)119 (100%)NA
Aztreonam10 (47.6%)70 (58.8%)0.339
Cefaclor7 (33.3%)52 (43.7%)0.375
Ceftriaxone9 (42.9%)43 (36.1%)0.557
Cephazoline6 (28.6%)40 (33.6%)0.650
Chloramphenicol9 (42.9%)57 (47.9%)0.670
Ciprofloxacin9 (42.9%)49 (41.2%)0.885
Levofloxacin2 (9.5%)23 (19.3%)0.367
Meropenem4 (19.0%)24 (20.2%)1.000
Imipenem5 (23.8%)29 (24.4%)0.956
Resistance-associated genes
blaTEM-type5 (23.8%)20 (16.8%)0.124
blaCTX-M-type2 (9.5%)8 (6.7%)0.792
blaSHV-type00NA#
blaIMP-type3 (14.3%)12 (10.1%)0.467
blaNDM-12 (9.5%)9 (7.6%)0.669
NA = Not applicable.
Table
Table 4. Distribution of virulence-related genes among E. coli isolates.
Table 4. Distribution of virulence-related genes among E. coli isolates.
GeneAll E. coli Isolates
n = 140		Colistin-Resistant
n = 21		Colistin-Sensitive
n = 119		p-Value
escV35 (25%)2 (9.5%)33 (27.7%)0.076
bfpB3 (2.1%)2 (9.5%)1 (0.8%)0.059
stx111 (7.9%)2 (9.5%)9 (7.6%)0.670
stx27 (5%)0 (0%)7 (5.9%)NA
elt26 (18.6%)0 (0%)26 (21.8%)NA
estIa8 (5.7%)0 (0%)8 (6.7%)NA
estIb21 (15%)0 (0%)21 (17.6%)NA
invE13 (9.3%)1 (4.8%)12 (10.1%)0.691
astA30 (21.4%)16 (76.2%)14 (11.8%)0.001 *
aggR36 (25.7%)16 (76.2%)20 (16.8%)0.002 *
pic29 (20.7%)11 (52.4%)18 (15.1%)0.001 *
* denotes significance with p < 0.05; NA = not applicable.
Table
Table 5. Colistin resistance among the different E. coli pathotypes.
Table 5. Colistin resistance among the different E. coli pathotypes.
TypeAll E. coli Isolates
n = 140		Colistin-Resistant
n = 21		Colistin-Sensitive
n = 119		p-Value
Enteroaggregative E. coli (EAEC)36 (25.7%)16 (76.2%)20 (16.8%)0.0001 *
Atypical E. coli (ATEC)29 (20.7%)0 (0.0%)29 (24.4%)NA
Enterotoxigenic E. coli (ETEC)33 (23.6%)0 (0.0%)33 (27.7%)NA
Enteropathogenic E. coli (EPEC)3 (2.1%)2 (9.5%)1 (0.8%)0.059
Enteroinvasive E. coli (EIEC)13 (9.3%)1 (4.8%)12 (10.1%)0.691
Shiga toxin-producing E. coli (STEC)18 (12.9%)2 (9.5%)16 (13.4%)1.000
* denotes significance with p < 0.05; NA = not applicable.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

El-Mokhtar, M.A.; Daef, E.; Mohamed Hussein, A.A.R.; Hashem, M.K.; Hassan, H.M. Emergence of Nosocomial Pneumonia Caused by Colistin-Resistant Escherichia coli in Patients Admitted to Chest Intensive Care Unit. Antibiotics 2021, 10, 226. https://doi.org/10.3390/antibiotics10030226

AMA Style

El-Mokhtar MA, Daef E, Mohamed Hussein AAR, Hashem MK, Hassan HM. Emergence of Nosocomial Pneumonia Caused by Colistin-Resistant Escherichia coli in Patients Admitted to Chest Intensive Care Unit. Antibiotics. 2021; 10(3):226. https://doi.org/10.3390/antibiotics10030226

Chicago/Turabian Style

El-Mokhtar, Mohamed A., Enas Daef, Aliae A. R. Mohamed Hussein, Maiada K. Hashem, and Hebatallah M. Hassan. 2021. "Emergence of Nosocomial Pneumonia Caused by Colistin-Resistant Escherichia coli in Patients Admitted to Chest Intensive Care Unit" Antibiotics 10, no. 3: 226. https://doi.org/10.3390/antibiotics10030226

APA Style

El-Mokhtar, M. A., Daef, E., Mohamed Hussein, A. A. R., Hashem, M. K., & Hassan, H. M. (2021). Emergence of Nosocomial Pneumonia Caused by Colistin-Resistant Escherichia coli in Patients Admitted to Chest Intensive Care Unit. Antibiotics, 10(3), 226. https://doi.org/10.3390/antibiotics10030226

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop