Next Article in Journal
In Vitro Antifungal Activity of Chimeric Peptides Derived from Bovine Lactoferricin and Buforin II against Cryptococcus neoformans var. grubii
Previous Article in Journal
Studies Regarding the Antimicrobial Behavior of Clotrimazole and Limonene
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 12
10.3390/antibiotics11121817
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Genetic Epidemiology of an Emerging Antimicrobial-Resistant Klebsiella pneumoniae Clone (ST307) Obtained from Clinical Isolates in Central Panama

by
Virginia Núñez-Samudio
1,2,*,
Gumercindo Pimentel-Peralta
1,
Mellissa Herrera
3,
Maydelin Pecchio
1,4,
Johana Quintero
1 and
Iván Landires
1,5,*
1
Instituto de Ciencias Médicas, Las Tablas, Los Santos 0710, Panama
2
Sección de Epidemiología, Departamento de Salud Pública, Región de Salud de Herrera, Ministry of Health, Chitré, Herrera 0601, Panama
3
Laboratorio Clínico, Hospital Luis Chicho Fábrega, Región de Salud Veraguas, Ministry of Health, Santiago, Veraguas 0923, Panama
4
Unidad de Infectología, Hospital Dr. Gustavo N. Collado R, Caja de Seguro Social, Chitré, Herrera 0601, Panama
5
Hospital Regional Dr. Joaquín Pablo Franco Sayas, Región de Salud de Los Santos, Ministry of Health, Las Tablas, Los Santos 0710, Panama
*
Authors to whom correspondence should be addressed.
Antibiotics 2022, 11(12), 1817; https://doi.org/10.3390/antibiotics11121817
Submission received: 5 November 2022 / Revised: 7 December 2022 / Accepted: 13 December 2022 / Published: 14 December 2022
Review Reports Versions Notes

Abstract

:
Klebsiella pneumoniae has been among the main pathogens contributing to the burden of antimicrobial resistance (AMR) in the last decade, and K. pneumoniae AMR strains predominantly cluster in the ST258 clonal complex. However, ST307 is emerging as an important high-risk clone. In Central America, there have been few studies on the molecular epidemiology of the K. pneumoniae strains involved in infections. Materials and Methods: We conducted an epidemiological study in three reference hospitals in the central region of Panama, using isolates of K. pneumoniae involved in infections, and identifying their AMR profile, associated clinical risk factors, and molecular typing using a multilocus sequence typing (ST) scheme. Results: Six STs were detected: 307 (55%), 152, 18, 29, 405, and 207. CTX-M-15- and TEM-type beta-lactamases were identified in 100% of ESBL-producing strains; substitutions in gyrA Ser83Ile and parC Ser80Ile were identified in all ST307s; and in ST152 gyrA Ser83Phe, Asp87Ala, and parC Ser80Ile, the qnrB gene was detected in all strains resistant to ciprofloxacin. Conclusions: We present the first report on ST307 in three reference hospitals in the central region of Panama, which is a high-risk emerging clone and represents a public health alert for potential difficulties in managing K. pneumoniae infections in Panama, and which may extend to other Central American countries.

1. Introduction

Klebsiella pneumoniae is an opportunistic enterobacterium that is responsible for infections in susceptible populations, such as the elderly, neonates, and patients with diabetes or immunosuppressed states, as well as healthcare-associated infections [1]. K. pneumoniae represents one of the main pathogens contributing to the burden of antimicrobial resistance (AMR) and associated deaths [2], which is why the World Health Organization (WHO) includes K. pneumoniae with AMR in the list of Priority 1 (critical group) pathogens resistant to antibiotics [3].
β-lactam and fluoroquinolone antibiotics are widely prescribed to treat infections caused by K. pneumoniae [4]. However, AMR to this antibiotic group is increasing worldwide [5]. K. pneumoniae can undergo various mechanisms conferring resistance to commonly used antibiotics, the most frequent of which is extended-spectrum β-lactamases (ESBL) such as SHV, TEM, and CTX-M: a group of enzymes that confer resistance to oxyminocephalosporins (i.e., cefotaxime, ceftazidime, cefuroxime, cefepime) and to monobactams (i.e., aztreonam), but not cephamycins (i.e., cefoxitin, cefotetan) or carbapenems (i.e., imipenem, meropenem, ertapenem) [6,7,8]. Within the mechanisms of resistance to quinolones, K. pneumoniae may contain chromosomal amino acid substitutions within the regions determining resistance to quinolones (QRDR) of the gyrA and parC genes, which are the targets of quinolones. A third resistance mechanism described for K. pneumoniae is the acquisition of plasmid-mediated quinolone resistance (PMQR) genes, among which the qnr genes (qnrA, qnrS, qnrB, qnrC, and qnrD) and aac(6’)-Ib-cr have typically been identified [9].
K. pneumoniae strains with AMR mainly belong to certain sequence types (STs) that represent high-risk international clones. In the last decade, hospital outbreaks have been predominantly attributed to isolates belonging to the clonal complex 258 (i.e., ST258, ST11, and ST512) [10]. However, ST307 has emerged in different parts of the world, with involvement in hospital outbreaks in Africa, Asia, Europe, and the Americas [11]. In Latin America, ST307 has been described in the last decade in countries such as Colombia [12], Brazil [13,14], Mexico [15], and Ecuador [16].
K. pneumoniae ST307 is frequently associated with AMR, especially because it tends to carry plasmid-mediated ESBL CTX-M-15 and carbapenemases, which hydrolyze carbapenems. These plasmids also carry genes conferring resistance to aminoglycosides and quinolones, emerging globally as an important AMR organism [4]. The most commonly identified carbapenemases in ST307 are KPC-2, KPC-3, OXA-48, and NDM-1. In addition, resistance to combined beta-lactam inhibitors, such as ceftazidime/avibactam and colistin, has been reported [17]. Previous studies have identified chromosome- and plasmid-encoded mechanisms of colistin resistance [18,19]. Currently, in Central America, knowledge of the epidemiological and molecular characteristics of the circulating K. pneumoniae strains remains limited. A study conducted on K. pneumoniae isolates carrying blaKPC carbapenemase collected between 2006 and 2015 in various Central American countries, including Panama, identified the high-risk clone ST258 [20].
It is known that a better understanding of the epidemiology of circulating K. pneumoniae strains is crucial to identify the factors contributing to the spread of resistance genes and is essential for the development of specific strategies for infection prevention, control, and new therapeutic strategies [21]. The purpose of this study was to characterize, through molecular epidemiology, the strains of K. pneumoniae isolated in the clinical laboratories of hospitals in the central region of Panama during 2018–2019 and involved in infections in patients prior to the COVID-19 pandemic.

2. Materials and Methods

2.1. Study Design

We conducted a prospective epidemiological study between October 2018 and November 2019 in three reference hospitals in central Panama: Hospitals A and B located in the Azuero region, and Hospital C located in the province of Veraguas. The three hospitals represent the main centers providing medical and laboratory care in central Panama.

2.2. K. pneumoniae Isolates

During the study period, we included K. pneumoniae samples that (a) were isolated from various outpatient and inpatient samples within the first 48 h of admission, (b) were collected as part of routine patient care procedures, and (c) showed resistance to at least one of the antibiotics routinely tested in hospital clinical microbiology laboratories. In vitro antimicrobial activity was determined using the Vitek2 system (BioMérieux; Marcy l’Etoile, France). The test results were interpreted according to the breakpoints defined by the Clinical Laboratory Standards Institute (CLSI) [22].
A technical sheet was completed anonymously for each sample collected, recording the following risk factors: age, sex, hospitalization for 2 or more days in the previous 90 days, antibiotic treatment in the previous 90 days, personal history of immunosuppressive therapy, home wound care, hemodialysis within the previous 90 days, and outpatient chemotherapy.

2.3. Statistical Analyses

Data was recorded in MS Excel (The Microsoft Corporation; Redmond, WA, USA). Data analyses were conducted in Stata v. 11.0 (StataCorp, LLC; College Station, TX, USA). We calculated descriptive statistics and estimates with their respective 95% confidence intervals (CIs). We used Fisher’s exact test to compare proportions, and Mann–Whitney’s U test to compare medians, setting alpha to 0.05 for statistical significance.

2.4. Molecular Typing Analysis and Molecular Identification of β-Lactamase

Molecular typing analyses were conducted using Pasteur’s multilocus sequence typing (MLST) scheme. We performed MLST schemes using a standardized protocol specific for K. pneumoniae [23]. Internal sequencing fragments of seven internal genes (i.e., rpoB, gapA, mdh, pgi, phoE, infB, and tonB) were amplified from the chromosomal DNA of the K. pneumoniae strains. Sequencing of polymerase chain reaction (PCR) amplicons was performed using the services of Macrogen (Macrogen Inc.; Seoul, Republic of Korea). Gene sequences were analyzed using Geneious prime v.2020.5 (Biomatters, Ltd.; Auckland, New Zealand), and allelic profiling was determined using K. pneumoniae MLST databases [24]. All isolates with β-lactam and quinolone resistance phenotypes were analyzed for blaCTX-M, blaTEM, blaSHV, qnrA, qnrB, qnrS, gyrA, and parC genes using specific PCR primers, as previously described. Table 1 summarizes these procedures [25,26,27,28,29]. The PCR amplicons were sequenced and analyzed in the BLASTN program of the National Center for Biotechnology Information (NCBI; https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 15 July 2022). Multiple alignment and assembly of gyrA and parC was performed with the partial sequences AF052258.1 and AF303641.1 obtained from the NCBI (https://www.ncbi.nlm.nih.gov/nuccore/AF052258.1, accessed on 15 July 2022 and https://www.ncbi.nlm.nih.gov/nuccore/AF303641.1, accessed on 15 July 2022).

3. Results

A total of 11 strains of K. pneumoniae with antimicrobial resistance were analyzed, 55% (6/11) from urine cultures, 27% (3/11) from secretions (one endotracheal and two wound samples), and 18% from blood cultures and rectal swabs (1/11 each). Among the samples, 90% (10/11) came from hospitalized patients and 10% (1/11) from an outpatient. Most (64%, 7/11) patients were male and 36% (4/11) were female, with a median (IQR) age of 63 (56–75) years.
Table 2 shows the phenotypic and genotypic profile of antimicrobial resistance of the K. pneumoniae strains analyzed. Sensitivity analyses of the strains showed that 91% (10/11) were sensitive to carbapenems (meropenem, imipenem, ertapenem), 82% (9/11) were resistant to trimetroprim-sulfomethoxazole; 73% (8/11) were resistant to gentamicin, and 64% (7/11) were resistant to ciprofloxacin. CTX-M-15 and TEM-type beta-lactamases were identified in all nine (82%) ESBL-producing strains (Table 2). Using Pasteur’s MLST technique, all 11 strains were typed and six STs were identified among them: 55% (6/11) belonged to ST307 and 45% (5/11) belonged to STs 152, 18, 29, 405, and 2073 (Table 2). Among the ESBL-carrying strains, 67% belonged to ST307, while 33% belonged to the other identified STs (152, 405, and 2073) (p = 0.06). All (100%, 6/6) of the ST307 strains were resistant to quinolones, while only 20% (1/5) of the strains grouped in the other STs were resistant (p = 0.01). Of note, 83% of ST307 strains were resistant to gentamicin, while only 40% (2/5) of strains from the other STs were resistant to gentamicin (p = 0.24).
Table 3 shows the identified PMQRs and QRDRs. We observed that of all the strains with resistance to quinolones, the qnrB gene was detected in all strains resistant to ciprofloxacin and in strain O-2723 with intermediate sensitivity. The qnrA gene was detected in strain O-2723 that showed resistance to nalidixic acid. QRDR analysis determined gyrA: Ser83Ile and parC Ser80Ile substitutions in all ST307s and in ST152 gyrA: Ser83Phe, Asp87Ala, and parC Ser80Ile.
Table 4 summarizes the risk factors identified, along with the median age and distribution by sex, grouped into strains belonging to ST307 and strains belonging to the other STs (i.e., 152, 18, 29, 405, and 2073, grouped under “other STs”).

4. Discussion

K. pneumoniae strains with AMR in the last decade were mainly grouped into certain types of high-risk international clones, predominantly belonging to the clonal complex 258 (i.e., ST258, ST11, and ST512) [11]. However, ST307 is emerging as an important AMR clone. In this study, through molecular analysis with MLST, we identified the presence of the emerging clone ST307 in 55% of K. pneumoniae strains isolated between 2018 and 2019 in three hospitals in the central region of Panama.
ESBL-producing strains of K. pneumoniae have increased in frequency and severity worldwide, causing an impact on the prolongation of hospital stays and delays in appropriate antibiotic therapy, which have led to an increase in healthcare costs [2,30]. We observed that ESBL-producing K. pneumoniae strains mostly belonged to ST307 (67%), identifying the blaCTX-M-15 gene in all ESBL-carrying strains. It has been reported that the movement of plasmids between different species and lineages of enterobacteria represents an important source of AMR; an example of this is the pandemic clone of Escherichia coli ST131, which contributes to the dissemination of ESBL genes (blaCTX- M-15) among Enterobacteriaceae [6,31]. This pandemic clone E. coli ST131, which is a carrier of CTX-M-15, was identified in a recent study in clinical isolates responsible for infections in outpatients and hospitalized patients in Panama, which suggests a high prevalence among Enterobacteriaceae [32].
Most of the global isolates of ST307 described in the literature carry the blaCTX-M-15 gene on FIB-like plasmids and contain several additional AMR determinants responsible for resistance to aminoglycosides, quinolones (qnrB1), and other antimicrobial agents [11,33,34]. These data coincide with our findings, where all ST307 strains were resistant to ciprofloxacin and 83% to gentamicin. Our genetic analyses showed that the qnrB gene was detected in 100% of the ST307 strains, and the QRDR substitutions were observed in gyrA Ser83Ile and parC Ser80Ile in all strains with ST307. Sequencing studies of K. pneumoniae ST307 [11] described that the clone ST307 emerged around 1994 and consists of two deep branching lineages. One lineage containing the gyrA Ser83Ile and parC Ser80Ile substitutions has shown a global distribution and the other lineage, also containing an additional gyrA D87N substitution, has only been present in Texas, United States. One report [11] also proposed there was genomic evidence of between-country movement of patients infected or colonized with isolates of ST307 that belonged to the global lineage. Our data showed that the substitutions observed in the QRDR of the ST307 identified in this study corresponded to the global lineage. This being the first report of clone ST307 in Panama, its origin is not clear. It is plausible that a sensitive strain has acquired a plasmid-carrying blaCTXM-15 from other Enterobacteriaceae (e.g., E. coli ST131), as has previously been identified [32,35], or that a strain of ST307 was introduced before 2018 from another source, which could partly explain the fact that it was distributed in the three participating hospitals, and in different hospitalization wards, such as surgery, internal medicine, the intensive care unit, and outpatient wards.
In a recent study conducted in Colombia with K. pneumoniae isolates, the SHV enzyme (SHV-11 or SHV-1) was identified in all strains studied, as well as other TEM enzymes such as TEM-11 and TEM-1. These data are consistent with the present study, where SHV and TEM were identified in all strains with the ESBL phenotype [12].
In Latin America, the percentage of ESBL-producing K. pneumoniae strains is estimated at 24.7%, a percentage that has increased in the last decade, surpassed only by the Asia-Pacific region [5]. This scenario represents a notable problem, as it demands the use of broader-spectrum antimicrobials, such as carbapenems, resistance to which has already spread worldwide. Correlations between the use of carbapenems in hospitalized patients and the development of resistance have been demonstrated, even after up to 3 months of treatment [36]. The Latin American Antimicrobial Resistance Surveillance Network (ReLAVRA) published a growing trend in K. pneumoniae resistant to carbapenems, with resistance rates reaching an average of 21% [37]. ST307 associates with blaCTX-M-15; however, sufficient indexed literature supports that this lineage could acquire and spread carbapenemases (blaKPC, blaNDM, blaOXA-48, blaOXA-48, blaOXA-181, and blaGES-5) [34]. In Latin America, the first ST307 described was in Colombia in 2015 in a strain of K. pneumoniae carrying blaKPC-2 [12], but it has also been described in Brazil [13,14], Mexico [15], and Ecuador [16]. ST307 behaves as an emerging high-risk clone, whose genetic characteristics contribute to its adaptation to the hospital environment, as well as its potential to acquire carbapenemase-carrying plasmids. The rational use of antibiotics and surveillance are essential to counteract the high potential for plasmid acquisition.
The small number of samples is a noteworthy limitation of this study. The sample size was due, first, to the infrequent request for cultures by the attending physicians and, second, to the limited human and infrastructure resources for processing cultures in clinical laboratories in central Panama.
Limitations aside, this study makes unprecedented contributions to the knowledge of the microbiology and molecular genetic epidemiology of K. pneumoniae strains in Panama and Central America by identifying several STs, including the emerging clone ST307. This draws our attention to the potential difficulties in the treatment of infections originating in hospitals and the community, as well as to the importance of knowing the composition and distribution of antibiotic resistance genotypes, as an important step to establish public policies aimed at limiting the impact of AMR K. pneumoniae infections.

Author Contributions

Conceptualization, V.N.-S. and I.L.; methodology, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; software, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; validation, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; formal analysis, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; investigation, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; resources, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; data curation, V.N.-S. and I.L.; writing—original draft preparation, V.N.-S. and I.L.; writing—review and editing, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; visualization, V.N.-S., M.P., G.P.-P., J.Q., M.H. and I.L.; supervision, V.N.-S. and I.L.; project administration, V.N.-S. and I.L.; funding acquisition, V.N.-S. and I.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was made possible through support from the Panama’s Secretaría Nacional de Ciencia, Tecnología e Innovación (SENACYT), Project ITE15-010.

Institutional Review Board Statement

The study protocol was reviewed and approved by the Bioethics Committee at the University of Panama (No. CBIUP/070/17, dated 10 February 2017).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are available within the article.

Acknowledgments

The authors would like to acknowledge Humberto López Castillo for his review of the manuscript. The authors also wish to express their gratitude to Lucila Ka and Aracelis Bernal, for their contribution in the collection of some isolates of Klebsiella pneumoniae. Virginia Núñez-Samudio and Iván Landires are members of the Sistema Nacional de Investigación (SNI), which is supported by Panama’s Secretaría Nacional de Ciencia, Tecnología e Innovación (SENACYT).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Choby, J.E.; Howard-Anderson, J.; Weiss, D.S. Hypervirulent Klebsiella pneumoniae: Clinical and molecular perspectives. J. Intern. Med. 2020, 287, 283–300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Antimicrobial Resistance Collaborators. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [PubMed]
  3. WHO Publishes List of Bacteria for Which New Antibiotics Are Urgently Needed. Available online: https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 21 July 2022).
  4. Pitout, J.D.D. Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae: Changing epidemiology and drug treatment choices. Drugs 2010, 70, 313–333. [Google Scholar] [CrossRef] [PubMed]
  5. World Health Organization. Antimicrobial Resistance: Global Report on Surveillance; WHO: Geneva, Switzerland, 2014. [Google Scholar]
  6. Chong, Y.; Shimoda, S.; Shimono, N. Current epidemiology, genetic evolution and clinical impact of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Infect. Genet. Evol. 2018, 61, 185–188. [Google Scholar] [CrossRef] [PubMed]
  7. Guzmán-Blanco, M.; Labarca, J.A.; Villegas, M.V.; Gotuzzo, E.; Latin America Working Group on Bacterial Resistance. Extended spectrum β-lactamase producers among nosocomial Enterobacteriaceae in Latin America. Braz. J. Infect. Dis. 2014, 18, 421–433. [Google Scholar] [CrossRef] [Green Version]
  8. Ghenea, A.E.; Zlatian, O.M.; Cristea, O.M.; Ungureanu, A.; Mititelu, R.R.; Balasoiu, A.T.; Vasile, C.M.; Salan, A.I.; Iliuta, D.; Popescu, M.; et al. TEM, CTX-M, SHV genes in ESBL-producing Escherichia coli and Klebsiella pneumoniae isolated from clinical samples in a county clinical emergency hospital: Romania predominance of CTX-M-15. Antibiotics 2022, 11, 503. [Google Scholar] [CrossRef]
  9. Strahilevitz, J.; Jacoby, G.A.; Hooper, D.C.; Robicsek, A. Plasmid-mediated quinolone resistance: A multifaceted threat. Clin. Microbiol. Rev. 2009, 22, 664–689. [Google Scholar] [CrossRef] [Green Version]
  10. Genovese, C.; La Fauci, V.; D’Amato, S.; Squeri, A.; Anzalone, C.; Costa, G.B.; Fedele, F.; Squeri, R. Molecular epidemiology of antimicrobial resistant microorganisms in the 21th century: A review of the literature. Acta Biomed. 2020, 91, 256–273. [Google Scholar]
  11. Wyres, K.L.; Lam, M.M.C.; Holt, K.E. Population genomics of Klebsiella pneumoniae. Nat. Rev. Microbiol. 2020, 18, 344–359. [Google Scholar] [CrossRef]
  12. Ocampo, A.M.; Chen, L.; Cienfuegos, A.V.; Roncancio, G.; Chavda, K.D.; Kreiswirth, B.N.; Jiménez, J.N. A two-year surveillance in five Colombian tertiary care hospitals reveals high frequency of non-cg258 clones of carbapenem-resistant Klebsiella pneumoniae with distinct clinical characteristics. Antimicrob. Agents Chemother. 2016, 60, 332–342. [Google Scholar] [CrossRef] [Green Version]
  13. Dropa, M.; Lincopan, N.; Balsalobre, L.C.; Oliveira, D.E.; Moura, R.A.; Fernandes, M.R.; da Silva, Q.M.; Matté, G.R.; Sato, M.I.Z.; Matté, M.H. Genetic background of novel sequence types of CTX-M-8- and CTX-M-15-producing Escherichia coli and Klebsiella pneumoniae from public wastewater treatment plants in São Paulo, Brazil. Environ. Sci. Pollut. Res. Int. 2016, 23, 4953–4958. [Google Scholar] [CrossRef]
  14. Sartori, L.; Sellera, F.P.; Moura, Q.; Cardoso, B.; Cerdeira, L.; Lincopan, N. Multidrug-resistant CTX-M-15-positive Klebsiella pneumoniae ST307 causing urinary tract infection in a dog in Brazil. J. Glob. Antimicrob. Resist. 2019, 19, 96–97. [Google Scholar] [CrossRef]
  15. Bocanegra-Ibarias, P.; Garza-González, E.; Morfín-Otero, R.; Barrios, H.; Villarreal-Treviño, L.; Rodríguez-Noriega, E.; Garza-Ramos, U.; Petersen-Morfin, S.; Silva-Sanchez, J. Molecular and microbiological report of a hospital outbreak of NDM-1-carrying Enterobacteriaceae in Mexico. PLoS ONE 2017, 12, e0179651. [Google Scholar] [CrossRef]
  16. Villacís, J.E.; Reyes, J.A.; Castelán-Sánchez, H.G.; Dávila-Ramos, S.; Lazo, M.A.; Wali, A.; Bodero, L.A.; Toapanta, Y.; Naranjo, C.; Montero, L.; et al. OXA-48 carbapenemase in Klebsiella pneumoniae sequence type 307 in Ecuador. Microorganisms 2020, 8, E435. [Google Scholar] [CrossRef] [Green Version]
  17. Wyres, K.L.; Hawkey, J.; Hetland, M.A.K.; Fostervold, A.; Wick, R.R.; Judd, L.M.; Hamidian, M.; Howden, B.P.; Löhr, I.H.; Holt, K.E. Emergence and rapid global dissemination of CTX-M-15-associated Klebsiella pneumoniae strain ST307. J. Antimicrob. Chemother. 2019, 74, 577–581. [Google Scholar] [CrossRef] [Green Version]
  18. Gogry, F.A.; Siddiqui, M.T.; Sultan, I.; Husain, F.M.; Al-Kheraif, A.A.; Ali, A.; Haq, Q.M.R. Colistin interaction and surface changes associated with mcr-1 conferred plasmid mediated resistance in E. coli and A. veronii strains. Pharmaceutics 2022, 14, 295. [Google Scholar] [CrossRef]
  19. Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef] [Green Version]
  20. Gomez, S.A.; Rapoport, M.; Piergrossi, N.; Faccone, D.; Pasteran, F.; De Belder, D.; ReLAVRA-Group; Petroni, A.; Corso, A. Performance of a PCR assay for the rapid identification of the Klebsiella pneumoniae ST258 epidemic clone in Latin American clinical isolates. Infect. Genet. Evol. 2016, 44, 145–146. [Google Scholar] [CrossRef]
  21. Peyclit, L.; Baron, S.A.; Rolain, J.M. Drug Repurposing to fight colistin and carbapenem-resistant bacteria. Front. Cell. Infect. Microbiol. 2019, 9, 193. [Google Scholar] [CrossRef]
  22. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2022. [Google Scholar]
  23. Brisse, S.; Fevre, C.; Passet, V.; Issenhuth-Jeanjean, S.; Tournebize, R.; Diancourt, L.; Grimont, P. Virulent clones of Klebsiella pneumoniae: Identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS ONE 2009, 4, e4982. [Google Scholar] [CrossRef] [Green Version]
  24. Institut Pasteur. Klebsiela pneumoniae Sequence Typing. Available online: https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=pubmlst_klebsiella_seqdef (accessed on 3 May 2022).
  25. Gundran, R.S.; Cardenio, P.A.; Villanueva, M.A.; Sison, F.B.; Benigno, C.C.; Kreausukon, K.; Pichpol, D.; Punyapornwithaya, V. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended-spectrum β-Lactamase-producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res. 2019, 15, 227. [Google Scholar] [CrossRef] [PubMed]
  26. Gonggrijp, M.A.; Santman-Berends, I.M.G.A.; Heuvelink, A.E.; Buter, G.J.; Van Schaik, G.; Hage, J.J.; Lam, T.J.G.M. Prevalence and risk factors for extended-spectrum β-lactamase-and AmpC-producing Escherichia coli in dairy farms. J. Dairy Sci. 2016, 99, 9001–9013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Dierikx, C.M.; van Duijkeren, E.; Schoormans, A.H.W.; van Essen-Zandbergen, A.; Veldman, K.; Kant, A.; Huijsdens, X.W.; Van Der Zwaluw, K.; Wagenaar, J.A.; Mevius, D.J. Occurrence and characteristics of extended-spectrum-β-lactamase-and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother. 2012, 67, 1368–1374. [Google Scholar] [CrossRef] [PubMed]
  29. Liao, C.H.; Hsueh, P.R.; Jacoby, G.A.; Hooper, D.C. Risk factors and clinical characteristics of patients with qnr-positive Klebsiella pneumoniae bacteraemia. J. Antimicrob. Chemother. 2013, 68, 2907–2914. [Google Scholar] [CrossRef] [Green Version]
  30. Boucher, H.W.; Talbot, G.H.; Bradley, J.S.; Edwards, J.E.; Gilbert, D.; Rice, L.B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad bugs, no drugs: No ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2009, 48, 1–12. [Google Scholar] [CrossRef] [Green Version]
  31. Peirano, G.; van der Bij, A.K.; Freeman, J.L.; Poirel, L.; Nordmann, P.; Costello, M.; Tchesnokova, V.L.; Pitout, J.D.D. Characteristics of Escherichia coli sequence type 131 isolates that produce extended-spectrum β-lactamases: Global distribution of the h30-rx sublineage. Antimicrob. Agents Chemother. 2014, 58, 3762–3767. [Google Scholar] [CrossRef] [Green Version]
  32. Núñez-Samudio, V.; Pecchio, M.; Pimentel-Peralta, G.; Quintero, Y.; Herrera, M.; Landires, I. Molecular epidemiology of Escherichia coli clinical isolates from Central Panama. Antibiotics 2021, 10, 899. [Google Scholar] [CrossRef]
  33. Villa, L.; Feudi, C.; Fortini, D.; Brisse, S.; Passet, V.; Bonura, C.; Endimiani, A.; Mammina, C.; Ocampo, A.M.; Jiménez, J.N.; et al. Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone. Microb. Genom. 2017, 3, e000110. [Google Scholar] [CrossRef]
  34. Lowe, M.; Kock, M.M.; Coetzee, J.; Hoosien, E.; Peirano, G.; Strydom, K.A.; Ehlers, M.M.; Mbelle, N.M.; Shashkina, E.; Haslam, D.B.; et al. Klebsiella pneumoniae ST307 with blaOXA-181, South Africa, 2014–2016. Emerg. Infect. Dis. 2019, 25, 739–747. [Google Scholar] [CrossRef] [Green Version]
  35. Vega, S.; Acosta, F.; Landires, I.; Morán, M.; Gonzalez, J.; Pimentel-Peralta, G.; Núñez-Samudio, V.; Goodridge, A. Phenotypic and genotypic characteristics of carbapenemase- and extended spectrum β-lactamase-producing Klebsiella pneumoniae ozaenae clinical isolates within a hospital in Panama City. Ther. Adv. Infect. Dis. 2021, 8, 20499361211054918. [Google Scholar] [CrossRef]
  36. Ghenea, A.E.; Cioboată, R.; Drocaş, A.I.; Țieranu, E.N.; Vasile, C.M.; Moroşanu, A.; Țieranu, C.G.; Salan, A.I.; Popescu, M.; Turculeanu, A.; et al. Prevalence and antimicrobial resistance of Klebsiella strains isolated from a county hospital in romania. Antibiotics 2021, 10, 868. [Google Scholar] [CrossRef]
  37. Pan-American Health Organization. Magnitud y Tendencias de la Resistencia a Los Antimicrobianos en Latinoamérica. ReLAVRA 2014, 2015, 2016. Available online: https://www.paho.org/es/documentos/magnitud-tendencias-resistencia-antimicrobianos-latinoamerica-relavra-2014-2015-2016 (accessed on 3 May 2022).
Table
Table 1. Primers used in the study.
Table 1. Primers used in the study.
TargetPrimer5′-3′ SequenceTemperature (°C)Amplicon (bp)Reference
CTX-MCTX-M-FATGTGCAGYACCAGTAARGTKATGGC5559225
CTX-M-RTGGGTRAARTARGTSACCAGAAYSAGCGG
TEMTEM-FGCGGAACCCCTATTTG5096326
TEM-RACCAATGCTTAATCAGTGAG
SHVSHV-FAGCCGCTTGAGCAAATTAAAC6071327
SHV-RATCCCGCAGATAAATCACCAC
CTX group1CTX group1-FTTAGGAARTGTGCCGCTGYA5268827
CTX group1_2-RCGATATCGTTGGTGGTRCCAT
CTX group2CTX group2-FCGTTAACGGCACGATGAC5240427
CTX group1_2-RCGATATCGTTGGTGGTRCCAT
CTX group9CTX group9-FTCAAGCCTGCCGATCTGGT5256127
CTX group9-RTGATTCTCGCCGCTGAAG
CTX group8CTX group8-FAACRCRCAGACGCTCTAC5232627
CTX group8-RTCGAGCCGGAASGTGTYAT
CTX M-15CTX M-15-FCACACGTGGAATTTAGGGACT5099525
CTX M-15-RGCCGTCTAAGGCGATAAACA
gyrAgyrA-FAAATCTGCCCGTGTCGTTGGT5834429
gyrA-RGCCATACCTACGGCGATACC
parCparC-FCTGAATGCCAGCGCCAAATT5716829
parC-RGCGAACGATTTCGGATCGTC
qnrAqnrA-FATTTCTCACGCCAGGATTTG5351628
qnrA-RGATCGGCAAAGGTTAGGTCA
qnrBqnrB-FGATCGTGAAAGCCAGAAAGG5346928
qnrB-RACGATGCCTGGTAGTTGTCC
qnrSqnrS-FACGACATTCGTCAACTGCAA5341728
qnrS-RTAAATTGGCACCCTGTAGGC
Abbreviations: Bp: base pairs, F: forward, R: reverse.
Table
Table 2. Phenotypic and genotypic characteristics of Klebsiella pneumoniae isolates.
Table 2. Phenotypic and genotypic characteristics of Klebsiella pneumoniae isolates.
IsolateMLSTIsolation DateSourceOriginating SiteESBLβ-LactamasesResistance (R) or Susceptibility (S) to Antimicrobials
CEFCAZFEPETPIMIGENAMKCIPSTXNI
S-1226307Oct/2018Wound secretionA/Surg+CTSRRRSSS—RR—
CC4 a307Nov/2018UrineB/IM+CTSRRRSSR—RR—
H18-2354307Nov/2018BloodA/Surg+CTSRRRSSRSRR—
O-3651307Nov/2018UrineA/ICU+CTSRRRSSRSRRR
HR-0054 a307Feb/2019Rectal swabA/Out+CTSRRR—I bRIRR—
164605307Mar/2019Endotracheal secretionC/ICU+CTSRRRSSRSRRI
S-0734 a152May/2019Wound secretionA/Ort+CTSRRRSSR—RRI
36518Jun/2019UrineB/IM−NDSSSSSSSSSR
O-265929Nov/2019UrineA/IM−NDSSSSSSSSSI
O-2723405Nov/2019UrineA/Neu+CTSRRRSSRSIR—
CC52073Nov/2019UrineB/IM+CTSRRRSSRIS cRR
a Resistant to ampicillin/sulbactam. b Intermediate resistance to meropenem. c Resistance to nalidixic acid. Abbreviations: AMK: amikacin; CAZ: ceftazidime; CEF: cephalothin; CIP: ciprofloxacin; CTS: CTX-M-15, TEM, and SHV β-lactamases; ESBL: extended-spectrum β-lactamase; ETP ertapenem; FEP: cefepime; GEN: gentamicin; ICU: intensive care unit; IM: internal medicine ward; IMI: imipenem; MLST: multilocus sequence typing; ND; not determined; Neu: neurology ward; NI: nitrofutantoin; Ort: orthopedics ward; Out: outpatient; Surg: surgical ward; SXT: trimethoprim-sulfamethoxazole.
Table
Table 3. Distribution by ST of QRDR and PMQR genes in isolates resistant to quinolones.
Table 3. Distribution by ST of QRDR and PMQR genes in isolates resistant to quinolones.
IsolateSTPQMRQRDRgyrAparC
83878087
S-1226307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
CC4307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
H18-2354307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
O-3651307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
HR-0054307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
164605307qnrB2Ile (ATC) *Asp (GAC)Ile (ATT) *Glu (GAA)
S-0734152qnrB3Phe (TTC) *Ala (GCC) *Ile (ATC) *Glu (GAA)
O-2723405qnrB0Ser (TCC)Asp (GAC)Ser (AGC)Glu (GAA)
CC52073qnrA0Ser (TCC)Asp (GAC)Ser (AGC)Glu (GAA)
Abbreviations: PMQR: plasmid mediated quinolone resistance; QRDR: quinolone resistance determining region; ST: sequence typing. * Substitutions: Ala: alanine; Asp: aspartic acid; Glu: glutamine; Ile: isoleucine; Phe: phenylalanine; Ser: serine.
Table
Table 4. Risk factors identified in Klebsiella pneumoniae isolates.
Table 4. Risk factors identified in Klebsiella pneumoniae isolates.
VariablesST307 (n = 6)Other ST (n = 5)p Value
Sex >0.99
  Female n (%)2 (33)2 (40)
  Male n (%)4 (67)3 (60)
Age, years, median (IQR)66 (63, 75)63 (56, 66)0.64
Risk factors
  Hospitalized ≥2 d in the prior 90 d5 (83)3 (60)
  Antibiotic treatment in the prior 90 d4 (67)2(40)
  Wound care at home2 (33)1 (20)
  Outpatient chemotherapy2 (33)—
  History of immunosuppressive therapy2 (33)—
  Hemodialysis in the prior 90 d——
  At least 1 risk factor6 (100)3 (60)0.18
  No known risk factors—2 (40)0.06
  ESBL carrier6 (100)2 (40)0.06
Abbreviations: d: days; ESBL: extended-spectrum β-lactamase, ST: sequence typing.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Núñez-Samudio, V.; Pimentel-Peralta, G.; Herrera, M.; Pecchio, M.; Quintero, J.; Landires, I. Molecular Genetic Epidemiology of an Emerging Antimicrobial-Resistant Klebsiella pneumoniae Clone (ST307) Obtained from Clinical Isolates in Central Panama. Antibiotics 2022, 11, 1817. https://doi.org/10.3390/antibiotics11121817

AMA Style

Núñez-Samudio V, Pimentel-Peralta G, Herrera M, Pecchio M, Quintero J, Landires I. Molecular Genetic Epidemiology of an Emerging Antimicrobial-Resistant Klebsiella pneumoniae Clone (ST307) Obtained from Clinical Isolates in Central Panama. Antibiotics. 2022; 11(12):1817. https://doi.org/10.3390/antibiotics11121817

Chicago/Turabian Style

Núñez-Samudio, Virginia, Gumercindo Pimentel-Peralta, Mellissa Herrera, Maydelin Pecchio, Johana Quintero, and Iván Landires. 2022. "Molecular Genetic Epidemiology of an Emerging Antimicrobial-Resistant Klebsiella pneumoniae Clone (ST307) Obtained from Clinical Isolates in Central Panama" Antibiotics 11, no. 12: 1817. https://doi.org/10.3390/antibiotics11121817

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop