Next Article in Journal
Preparation and Mechanical Properties of Layered Cu/Gr Composite Film
Next Article in Special Issue
Protective Effect of Resveratrol against Hepatotoxicity of Cadmium in Male Rats: Antioxidant and Histopathological Approaches
Previous Article in Journal
Synthesis of Cubic Aluminum Nitride (AlN) Coatings through Suspension Plasma Spray (SPS) Technology
Previous Article in Special Issue
Neurological Alterations and Testicular Damages in Aging Induced by D-Galactose and Neuro and Testicular Protective Effects of Combinations of Chitosan Nanoparticles, Resveratrol and Quercetin in Male Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Coatings
Volume 11
Issue 5
10.3390/coatings11050501
coatings-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
Expression of Concern published on 15 September 2021, see Coatings 2021, 11(9), 1112.
Expression of Concern published on 9 April 2024, see Coatings 2024, 14(4), 448.
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antioxidant, Antigenotoxic, and Hepatic Ameliorative Effects of Quercetin/Zinc Complex on Cadmium-Induced Hepatotoxicity and Alterations in Hepatic Tissue Structure

by
Moamen S. Refat
1,*,
Reham Z. Hamza
2,*,
Abdel Majid A. Adam
1,
Hosam A. Saad
1,
Adil A. Gobouri
1,
Ehab Azab
3,
Fawziah A. Al-Salmi
2,
Tariq A. Altalhi
1,
Ebtihal Khojah
3,
Ahmed Gaber
2 and
Samy M. El-Megharbel
1
1
Department of Chemistry, Main Campus, College of Sciences, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
2
Biology Department, Main Campus, College of Science, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
3
Food Science and Nutrition Department, Main Campus, College of Sciences, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Coatings 2021, 11(5), 501; https://doi.org/10.3390/coatings11050501
Submission received: 31 March 2021 / Revised: 18 April 2021 / Accepted: 22 April 2021 / Published: 24 April 2021
(This article belongs to the Special Issue Biomedical Application of Natural Plant Extracts)
Browse Figures
Versions Notes

Abstract

:
Applications of medicinal uses of metals and their complexes have been gaining major clinical significance, especially during the COVID-19 pandemic. The ligation behavior of quercetin (Q), a flavonoid, and Zn metal, i.e., the Zn/Q complex, was fully characterized based on molar conductance, infrared (IR) spectra, elemental analysis, electronic spectra, thermogravimetric analysis, proton nuclear magnetic resonance (1H-NMR), and transmission electron microscopy (TEM) in our lab. Hepatotoxicity was induced by cadmium (CdCl2). A total of 40 male albino rats were randomly distributed into the following four groups: Control, hepatotoxic group (CdCl2), Zn/Q-treated group, and group treated with a combination of CdCl2 and Zn/Q. Serum hepatic enzymes (AST, ALT, and LDH), total protein, and enzymatic and nonenzymatic antioxidant levels were determined. Histology and TEM for hepatic tissues, in addition to the gene expression of SOD as an antioxidant enzyme in the hepatic tissues, were evaluated. The Q/Zn treatment demonstrated potent protective effects against CdCl2-induced sever oxidative stress and suppressed hepatic toxicity, genotoxicity, liver enzyme disturbances, and structural alterations. In conclusion, the Zn/Q complex produced a high potent antioxidant effect against the oxidative injury and genotoxicity induced by CdCl2 and could be considered to be a potent ameliorative hepatoprotective agent against CdCl2 hepatotoxicity, which could be beneficial during the COVID-19 pandemic.

1. Introduction

Cadmium (Cd) is a widespread heavy metal [1]. Cd has been listed among the toxic chemicals recognized by the WHO [1]. Mclellan et al. [2] demonstrated that Cd absorption by humans occurs very slowly after oral exposure, thus generating cumulative hepatotoxicity. Studies have reported that Cd mainly accumulates in hepatic tissues [3].
Several studies have demonstrated that exposure to CdCl2 results in large amounts of excessive free radical generation, thus eliciting high oxidative stress in almost all the body systems [4,5].
Cadmium has the ability to elevate both p53 and Bax gene levels and decrease the gene expression of Bcl-2, thus elevating the cellular apoptosis [6].
Excessive sources of Cd output such as coatings, alloys, cadmium batteries with nickel, chemical stabilizers, plastics, and ceramics are causing Cd pollution to rise year after year [3,4].
Cd is also found in cigarette smoke, which contributes to smokers’ addiction. The biological half-life of Cd, which is long, is known to be the most harmful impact because of the prolonged accumulation of Cd in biological organs over long periods of time [7]. Consequently, The International Agencies for Cancer Research listed Cd as a carcinogenic compound because of its cumulative impact and involvement in the progression of cancer [8,9].
A previous study demonstrated that Cd could cause severe hepatic damage, including the increase of free radicals, thus triggering oxidative stress, hepatic hemorrhage, edema, necrosis, and hepatic toxicity in addition to a decline hepatic cellular viability [10].
The proposed cellular mechanism that is primarily responsible for Cd-induced organ toxicity occurs through a variety of pathways, including cellular degeneration, inhibition of apoptotic mechanisms, and the blocking of DNA-repair mechanisms [11]. Additionally, the major molecular cytotoxicity induced by Cd is due to the increased of oxidative stress and the production of reactive oxygen species (ROS).
Quercetin (Q) is a flavonoid that has recently gained prominence as a potent antioxidant compound. It is mainly found in vegetables [12]. Studies have shown that Q is the most potent antioxidant agent due to its high ability to reduce free radicals [13,14]. Therefore, Q is considered to be an effective antioxidant supplement.
Previous studies have shown that Q significantly diminished several types of toxicity in rats exposed to CdCl2 by reducing the rate of oxidative injury [15,16].
Although there have been several reports about the amelioration effects of Q on different types of toxicity in male rats, it remains intriguing, especially in the case of complexation of this potent antioxidant (Q) with metals such as (Zn), which may increase its effectiveness and minimize any induced toxicity as reported in our previous study [17].
Due to its therapeutic relevance and reported antioxidant activities, complexation of flavonoids with metals has gained attention [17]. Based on the expression of Zn gene “ZnT8,” there was a correlation between changes in Zn levels and metabolic dysfunction [18]. In addition, Zn was reported to be a beneficial ion in the treatment of inflammatory diseases [19]. A previous study found that supplementation with Zn prevented a variety of diseases. Lowering Zn ion intake also decreased tolerance to a variety of infections [20].
In the current study, we investigated the impact of Cd exposure on the liver, as well as the potential ameliorative effect of a novel Zn/Q complex (a strong antioxidant) on Cd-induced hepatic toxicity.

2. Materials and Methods

2.1. Chemicals and Analyses

The chemicals used in this study (Q and ZnCl2) were purchased from Sigma-Aldrich (Steinheim, Germany). The Q complex with zinc (II) was synthesized according to the following methodology [17].

2.2. Synthesis of Zn/Q Complex

According to our previously published study and as demonstrated by Refat et al. [17], we added 30 mL of methanol to 1 mmol Q dissolved in 1 mmol of Zn(NO3)2.6H2O. The yield product was continuously stirred for about 4 h at 25 °C. A greenish yellow product resulted after continuous stirring, which was filtered and evaporated at 25 °C and then washed with MeOH. Chemical characterization has been confirmed by Refat et al. [17]. We confirmed the stability and chemical formula of our novel ZN/Q complex by IR, UV, TEM, and H1NMR.

2.3. Experimental Animals

In total, 40 three-month-old adult male Wistar albino rats with weights ranging from 180 g to 200 g were obtained from faculty of the pharmacy at Zagazig University (Zagazig, Egypt). Rats were kept in metal cages under pathogenic-free conditions. Extensive efforts were made to minimize suffering of the animals. The experimental protocol, as shown in Figure 1, was ethically approved (Zu-IACUC/1/f/41 I2018) and followed the animal international guidelines.

2.4. Experimental Protocol

After 2 weeks of acclimatization, the male albino rats were randomly divided into 4 groups. Group I (control group) was orally administrated physiological saline, group II (CdCl2 group) was orally treated with CdCl2 (5 mg/kg−1) [21], group III was orally treated with the novel Zn/Q complex (30 mg/kg) [14], and group V was orally treated with CdCl2, followed with Zn/Q complex at the same previous doses.

2.5. Blood Sample Collection

The rats were sacrificed under light doses of ketamine/xylazine anesthesia, and efforts were made to reduce stress and pain to the rats. Blood samples were collected from the eye plexus under light anesthesia. The samples of blood were continuously for 20 min centrifuged at 5000 rpm for the biochemical analyses. The male rats were decapitated immediately ethically, and the hepatic tissues were preserved at −80 °C for the molecular examination.

2.6. Preparation of Homogenate of the Hepatic Tissues

Small pieces of the hepatic tissues were used for assessment of the antioxidant enzymes and estimating of the marker of lipid peroxidation (MDA). Hepatic tissues were continuously homogenized in buffer saline in cold medium (approximately 5 mL) and centrifuged at approximately 6000 r.p.m for 1/2 h. The supernatant was used for analyses of the antioxidant enzymes.

2.7. Determination of the Oxidative Stress Biomarkers

The hepatic tissue homogenates were used for estimation of GPx according to Sedlak and Lindsay (1968) Approximately 100 µL of each hepatic tissue homogenates was mixed with 1.5 mL of 20% glacial acetic acid, 1.5 mL of 0.8% thiobarbituric acid, 200 µL of 8.1% SDS, and 600 µL of dist. H2O. The mixture was heated at 95 °C for 1 h in a water bath. The absorbance was measured at 532 nm using a UV-spectrophotometer (PerkinElmer, Waltham, MA, USA). [22]. MDA content was determined using thiobarbituric acid of ≥99% purity (Sigma Chemical Co., St. Louis, MO, USA) as described previously according to Ohkawa et al. (1979) [23]. CAT levels were estimated according to Beers and Sizer (1952) [24] by assaying the hydrolysis of H2O2 and the resulting decrease in absorbance at 240 nm over a 3 min period at 25 °C. Before determining the CAT activity, samples were diluted 1:9 with 1% (v/v) Triton X-100. CAT activity is expressed as mmol/mg protein. SOD activity was determined according to previous methodology by assaying the autoxidation of pyrogallol at 440 nm for 3 min. One unit of SOD activity was calculated as the amount of protein that caused the inhibition of 50% pyrogallol autoxidation. SOD activity is expressed as U/mg protein. Three replicates were measured per sample and the final concentrations are presented/g tissue.

2.8. Transmission Electron Microscopic Study (TEM)

Liver portion was fixed in 2.5% glutaraldehyde for the ultrastructural examination. The liver specimens were washed in slightly basic buffer phosphate for about 20 min, followed by further processing (Hayat, 1986) [25].
Ultrathin sections were mounted on Cu- grids and examined by transmission electron microscope (JEOL JEM-1200 EX II, Tokyo, Japan).

2.9. Comet Assay of the Hepatic Tissues

Hepatic tissues were placed in a Petri dish with lysing solution, and the cellular viability was determined as described by Singh et al. [26]. For each sample, 3 slides were prepared, and random cells were selected for imaging using the fluorescence microscope.

2.10. Histological Analysis of Liver Tissues

Hepatic tissues were kept in buffered formalin (10%). After the fixation step, the hepatic tissues were embedded in paraffin and then stained for further processing.

2.11. RNA Isolation and Semiquantitative Ploymerase Chain Reaction (PCR)

Total RNA was isolated from the hepatic tissues using TRIzol reagent, followed by the addition of RNAse-free DNAse. Amplification data were analyzed using the 2−ΔΔCt method. The isolated RNA was dissolved in diethyl pyrocarbonate-treated water and then stored at −80 °C until use. The observed values were comparable to those of β-actin. PCR of the liver β-actin, SOD, CAT and GPx were performed by using specific primers of rat’s SOD and -actin genes purchased from "Macrogen" (Beotkkot-ro, Gasan-dong, Geumcheon-gu, Seoul) (Korea). The sequences of the primers are listed in Table 1.
The PCR conditions were as follows: 95° C for about 5 min, followed by cycles of 95 °C for 1 min, an annealing temperature step at 60 °C for 1 min, and 72 °C for 1 min [20].

2.12. Statistical Analysis

The statistical analysis was performed using SPSS software version 27 (IBM, 2020) and Open Epi version 2.3.1 [27]. Data were summarized as mean and standard deviation. The Shapiro–Wilk test was used to determine the distribution characteristics of variables and variance homogeneity [28].

3. Results

3.1. Characterization and Interpretations of (Zn/Q)

Analytical analysis was performed to confirm Zn/Q novel complex structure of (Figure 2). The Zn/Q complex was soluble in DMSO. The value of the molar conductivity (Λm) novel Zn/Q complex was “15 ohm−1.cm2.mol−1,” and the Zn/Q was non-electrolytic in nature [17].
The complexity of the prepared Zn/Q was confirmed by its C, H, and N analysis as follows: MF: C15H23NO17Zn; molecular weight: 554.73 g/mol; experimental analysis (%): Zn 11.37, C 32.13, N 2.45, and H 4.09. The final product of the Zn/Q complex was approximately 75%. The melting point of the Zn/Q complex was higher than 250 °C.

3.2. TEM Examination of Zn/Q Complex

Zn/Q complex, transmission electron microscopy (TEM) was clearly demonstrated in our previous study [17]. The uniform matrix was clear and confirmed that the novel Zn/Q complex had black and spherical spots.

3.3. Hepatic Effect of (Zn/Q) Complex

The male rats treated with CdCl2 had significantly higher serum AST, ALT, and LDH levels than the control group. In addition, when CdCl2 was combined with the novel Zn/Q complex, serum ALT and AST enzymes were significantly higher than in the control group. In contrast to the CdCl2-treated population, CdCl2 combined with Zn/Q caused substantial reductions in ALT and AST levels (Table 2).
On the one hand, compared with the control group, the results for the CdCl2-treated group showed a significant reduction in total protein levels. On the other hand, the result for the group treated with CdCl2 and Zn/Q showed a small reduction in total protein levels as compared with the control group (Table 2).
Compared with the control group, the results for the group treated with CdCl2 only showed a significant increase in LDH serum levels. Whereas the CdCl2 and Zn/Q group showed a substantial increase (p ≤ 0.05) in LDH levels as compared with the control group, LDH levels in the CdCl2 and Zn/Q group were significantly lower than in the CdCl2-treated group (Table 2).

3.4. Enzymatic and Nonenzymatic Antioxidant Biomarkers

The antioxidant enzymes in the hepatic tissues of the groups treated with CdCl2, Zn/Q, and their combinations were measured (Table 3). The MDA levels of the CdCl2-treated group markedly increased with a significant reduction in the antioxidant enzymes (SOD, CAT, and GPx). Treatment of the male rats with CdCl2 in combination with Zn/Q reduced the MDA levels significantly and elevated the antioxidant capacities more than that of CdCl2 alone (Table 3).

3.5. Histological Examination

Histological examination (Figure 3) showed that Control group showing normal hepatic structure and normal nuclei. Meanwhile, D-galactose-treated group showing experimental rat liver after treatment with CdCl2 with marked toxicity in the form of dilatation, elongation, irregularity of the portal vein, hypertrophy of hepatocytes with the appearance of hydropic degeneration of hepatocytes with vesicular nuclei with new bile duct formation, appearance of mummified cells, and infiltration by inflammatory cells. Zn/Q-treated group showing normal hepatic structure with normal nuclei. CdCl2 and Zn/Q-treated group showing great improvement and restoration of hepatic structures with mild changes in the form of hypertrophy of hepatocytes with granular eosinophilic cytoplasm and vesicular nuclei with a slightly dilated central vein lined by endothelial cells. The histological index for scoring the hepatic structural alterations is shown in Table 4.

3.6. TEM Examination of the Hepatic Tissues of the Treated Groups

The hepatic tissues showed normal structure of the nuclei (Ns) with normal-sized mitochondria (M) (scale bar = 5 µm) (Figure 4A), while the CdCl2-treated group showed severe toxicity in hepatic tissues with the degeneration of most hepatic structures and nuclear components (***) and the appearance of a fatty change (green arrow) (scale bar = 5 µm) (Figure 4B). There was a significant improvement and normal hepatic structures in the group treated with Zn/Q (scale bar = 5 µm) (Figure 4C). However, in the group treated with CdCl2 and Zn/Q, there were hepatic tissues with a near restoration of hepatic structures (scale bar = 5 µm) (Figure 4D).

3.7. Comet Assay of the Hepatic Tissues

A comet assay of the hepatic tissues was assessed. On the one hand, the control group showed intact round nuclei without large tail hallows (Figure 5A). On the other hand, the CdCl2 group showed a high degree of damage, with large apoptotic cells and tail hallows (Figure 5B). The Zn/Q group showed intact nuclei (Figure 5C). The group treated with CdCl2 and Zn/Q showed less DNA damage (Figure 5D).

3.8. Gene Expression in the Liver

A semiquantitative PCR technique was performed to assess the inhibitory effect of Zn/Q on the oxidative injury in hepatic tissues. The relative expression of mRNA of the SOD enzyme was lower in the CdCl2-treated group than that in the Zn/Q and control groups (Figure 6). In the CdCl2 group treated with Zn/Q, the relative SOD mRNA levels were significantly elevated as compared with the CdCl2 group (Figure 6).

4. Discussion

The hepatotoxic effects of CdCl2 have been previously demonstrated [29]. We confirmed that CdCl2 exposure significantly elevated hepatic enzymes (AST and ALT) and hepatic damage markers (LDH). CdCl2 exposure also produced excessive free radicals that triggered oxidative injury in the hepatic tissues and induced genotoxicity. As observed in our previous investigation, the Zn/Q complex has potent antioxidant agents that significantly alleviate oxidative stress and free radical scavenging activities, ameliorate blood glucose levels, and enhance the immune system in diabetics [17]. Therefore, we aimed to use this novel Zn/Q complex against hepatotoxicity and oxidative injury induced by CdCl2 in treated rats.
Previous reports have shown that CdCl2 exposure causes hepatic and renal toxicity, thus affecting the biochemical functions and cellular vitality of the body [29]. Cd administration induced adverse effects on hepatic functions and significantly elevated the hepatic enzymes AST, ALP, ALT, and LDH with a reduction in total protein levels.
The results of the current study are consistent with those found by the authors of [10], who demonstrated a reduction in total protein levels in mice treated with CdCl2. Similar hypoproteinemia was recorded in the CdCl2 group, which may have been to protein synthetic machinery impairment or to excessive excretion upon Cd oral administration [30]. The reduction in total protein levels may have been due to inflammation of the hepatic tissues resulting from CdCl2 exposure, which disturbs and reduces protein biosynthesis [30].
In accordance with the present results, Gaskill et al. [31] demonstrated that hepatic injury was produced after CdCl2 administration. In addition, they reported that continuous administration of CdCl2 and Q reduced the accumulation of free radicals in the serum, testis, and epididymis. These results confirm our finding of significant recovery after administration of the Zn/Q complex, which restored the hepatic tissues to normal states after severe toxicity induced by CdCl2.
Previous studies have demonstrated that Q improved the renal functions in CdCl2-exposed rats by lowering the rate of oxidative stress in the kidneys. Similar results were found in the current study, which showed more improvement in the hepatic tissues after administration of Zn/Q to treat Cd-induced toxicity in male rats [32,33].
Our data are similar to those by Gaskill et al. [31], who demonstrated the induction of severe hepatic damages represented by a marked increment in hepatic enzymes (AST, ALT, and ALP) in a CdCl2 group as compared with a control group. The present results are also in agreement with those found by Newairy et al. [34], who demonstrated that CdCl2 elevated the oxidative damage markers. This oxidative stress might be the first sign of CdCl2 inducing severe hepatotoxicity. Supporting these results, Renugadevi and Prabu [35] demonstrated CdCl2-induced hepatotoxicity and oxidative damage in the hepatic tissues. Hepatic injury caused by CdCl2 treatment was clearly shown by elevated levels of hepatic enzymes, concurrently with increased lipid peroxidation markers. Lakshmi et al. [36] also reinforced the current results by revealing that CdCl2 exposure significantly enhanced the elevation of the hepatic enzyme levels and reduced total protein levels.
The present results are also in agreement with those found by Abu-AlZahab et al. [10], who demonstrated that CdCl2 induced reduction in antioxidant enzymes (SOD, CAT, and GPx), either in the tissue homogenates or gene expression of these enzymes. These results confirmed that heavy metals have adverse effects through the excessive production of free radicals and accumulation of reactive oxygen species such as H2O2, which cause accumulative and excessive oxidative injuries to lipid, nucleic acids, and proteins and eventually cellular death.
An important finding of the current study was the significant elevation of SOD and CAT mRNA expression in Zn/Q complex group, either alone or following treatment with CdCl2, compared to that in CdCl2-treated group. So, we hypothesized that the Q/Zn complex both improves CdCl2-induced hepatotoxicity and oxidative stress complications, possibly by upregulating the expression of SOD, GPx, and CAT mRNAs. This could be due to antioxidant properties of the complex Q/Zn, because studies have suggested an association between chronic oxidative stress state and impaired cellular defense [17].
The toxic effect of CdCl2 on hepatic activity may work through the genotoxic pathway. Additionally, heavy metals such as Cd may infiltrate the blood barrier of the hepatic tissues to disturb the metabolic pathway and thus influence the genetic integrity [37,38].
As part of the toxic hepatic effects of CdCl2, we evaluated the enzymatic antioxidants activities of SOD, CAT, and GPx and the final marker of lipid peroxidation, i.e., MDA. SOD catalyzes the dismutation of O2 to yield H2O2 [39], H2O2 is converted to H2O by the CAT or GPx enzyme without incidence of this mechanism, and H2O2 accumulates and begins to destroy the cellular membranes, then releases high levels of MDA.
The observed reduction in antioxidant enzyme activities such as SOD, CAT, and GPx is consistent with previous studies [40,41,42]. The decreased level of antioxidant enzymes in the hepatic tissues after CdCl2 administration triggered a high concentration of hydrogen peroxide and increments in lipid peroxidation. The increased production of reactive oxygen species in hepatic tissues following CdCl2 administration may contribute to a reduction in antioxidant enzyme levels, which are effectively involved in the elimination of free radicals. It has been suggested that hepatic oxidative stress results from CdCl2 exposure and that it may be responsible for alterations of hepatic structures and enzymes.
Oxidative stress correlates with organ damage. In one study, it was suggested that the high percentage of apoptosis observed in hepatic tissues may have been triggered by oxidative stress. The antioxidant enzyme (SOD) was downregulated in the group treated with CdCl2 as compared with the control group [10].
Previous studies have demonstrated the upregulation of Bax in cadmium-exposed rats [43] and an increment in DNA oxidation [44]. The observed results confirmed that Cd increased the rate of cellular apoptosis and hence decreased antioxidant agents that prevented the incidence of lipid peroxidation, thus stabilizing the cellular membranes. The Zn/Q complex acted effectively to scavenge reactive oxygen species, thus preventing cellular damage. In the current study, CdCl2 significantly reduced the activities of SOD, CAT, and GPx in the liver.
Refat et al. demonstrated that Zn/Q could protect the pancreas from oxygen free radicals and, consequently, support the pancreas in repairing damaged single-strand breaks induced in DNA “genotoxicity” [45]. Moreover, as observed in a histological study, rats that received Zn/Q for 1 h after CdCl2 showed protected liver tissue and significantly decreased hepatic toxicity.
Zn/Q hinders the damaging effects of toxic compounds, drugs, and chemotherapeutic medications that induce free radical formation and oxidative injury to mitochondria [46]. Zn/Q can also modulate DNA damage, cellular proliferation induced by oxidative stress, and DNA single-strand breaks [47]. The protective effect of Zn/Q, owing to its ability to act as a free radical scavenger and eliminate the ROS triggered from Cd [48], prevents the induction of DNA damage.
Previous studies have shown that Q is considered as a potent antioxidant agent, owing to its ability to scavenge free radicals [12,49]. The antioxidant properties of Q may be due to its role as an antioxidant supplement. Previous studies have shown that Q significantly reversed hepatic toxicity in male rats exposed to Cd by lowering oxidative stress [12,49].
A key strength of the present study was the complexation between two potent antioxidants (Q and Zn), which act as enhancers for antioxidant enzymes and alleviate severe oxidative injury as previously confirmed by Refat et al. [17].
Zn deficiency is reported to disturb metabolic mechanisms. Thus, it may affect then cellular metabolism in hepatic tissues [50]. As a result, Zn/Q is a novel complex in alleviating the oxidative stress in the hepatic tissues, thus enhancing the metabolic state and the biochemical parameters and elevating the levels of antioxidant enzymes in the liver.
Olechnowicz et al. [51] demonstrated that Zn as a metal plays a major role in the development of metabolic syndromes and essentially involved in the expression of cytokines. Thus, Zn could share in suppressing inflammation. Zn is important to reinforce the antioxidant enzymes responsible for scavenging the reactive oxygen species by reducing oxidative stress.
Zn has important key roles in metabolic processes. Understanding the properties of Zn may help in the treatment of metabolic syndrome and thus may provide protection against any strokes. We support the very important and vital effect of the novel Zn/Q novel complex for protecting against oxidative injury and hepatic toxicity induced by CdCl2.

5. Conclusions

The current study revealed that hepatic tissues were significantly affected by the toxicity induced by CdCl2 administration and clarified the potential antioxidant effect of a novel antioxidant agent, i.e., the Zn/Q complex, which elevated antioxidant enzymes, inhibited excessive free radicals, and reduced cellular inflammation as compared with CdCl2 alone. The Zn/Q complex was confirmed to be highly efficient and safe for the protection of hepatic tissues against the oxidative damage and genotoxicity induced by CdCl2. The current results offer a new approach to clarify the role of new therapeutic strategies for preventing a series of oxidative stress complications, thereby providing new hope for alleviating severe oxidative stress.

Author Contributions

Conceptualization, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; methodology, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; software, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G., E.K. and E.A.; validation, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; formal analysis, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G., E.K. and E.A.; investigation, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S. and E.K.; resources, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; data curation, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G., E.K. and E.A.; writing—original draft preparation, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; writing—review and editing, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; visualization, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K.; supervision, M.S.R., R.Z.H., A.M.A.A., H.A.S., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G., E.K. and E.A.; project administration, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M. and F.A.A.-S.; funding acquisition, M.S.R., R.Z.H., A.M.A.A., A.A.G., T.A.A., S.M.E.-M., F.A.A.-S., A.G. and E.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the grant from Deanship of Scientific Research, Taif University, Saudi Arabia under Research Group project Grants No. 6144-440-1.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by Ethical Committee approval ZU-IACUC/1/F/41 I2018.

Informed Consent Statement

None.

Data Availability Statement

Data presented is original.

Acknowledgments

This work was supported by the grant from Deanship of Scientific Research, Taif University, Saudi Arabia under Research Group project Grant No. 6144-440-1.

Conflicts of Interest

The authors declare no conflict of interest

References

  1. Nna, V.U.; Ujah, G.A.; Mohamed, M.; Etim, K.B.; Igba, B.O.; Augustine, E.R.; Osim, E.E. Cadmium chloride–induced testicular toxicity in male wistar rats; prophylactic effect of quercetin, and assessment of testicular recovery following cadmium chloride withdrawal. Biomed. Pharmacother. 2017, 94, 109–123. [Google Scholar] [CrossRef] [PubMed]
  2. McLellan, J.S.; Flanagan, P.R.; Chamberlain, M.J.; Valberg, L.S. Measurement of dietary cadmium absorption in humans. J. Toxicol. Environ. Health Part A 1978, 4, 131–138. [Google Scholar] [CrossRef] [PubMed]
  3. Nwokocha, C.R.; Owu, D.U.; Nwokocha, M.I.; Ufearo, C.S.; Iwuala, M.O. Comparative study on the efficacy of Allium sativum (garlic) in reducing some heavy metal accumulation in liver of wistar rats. Food Chem. Toxicol. 2012, 50, 222–226. [Google Scholar] [CrossRef] [PubMed]
  4. Valko, M.; Morris, H.; Cronin, M.T.D. Metals, Toxicity and Oxidative Stress. Curr. Med. Chem. 2005, 12, 1161–1208. [Google Scholar] [CrossRef] [Green Version]
  5. Patra, R.C.; Rautray, A.K.; Swarup, D. Oxidative Stress in Lead and Cadmium Toxicity and Its Amelioration. Vet. Med. Int. 2011, 2011, 1–9. [Google Scholar] [CrossRef] [Green Version]
  6. Eleawa, S.M.; Alkhateeb, M.A.; Alhashem, F.H.; Bin-Jaliah, I.; Sakr, H.F.; Elrefaey, H.M.; Elkarib, A.O.; Alessa, R.M.; Haidara, M.A.; Shatoor, A.S.; et al. Resveratrol reverses cadmium chloride-induced testicular damage and subfertility by downregu-lating p53 and Bax and upregulating gonadotropins and Bcl-2 gene expression. J. Reprod. Dev. 2014, 60, 115–127. [Google Scholar] [CrossRef] [Green Version]
  7. Lafuente, A.; Márquez, N.; Pérez-Lorenzo, M.; Pazo, D.; Esquifino, A.I. Pubertal and postpubertal cadmium exposure differen-tially affects the hypothalamic– pituitary–testicular axis function in the rat. Food Chem. Toxicol. 2000, 38, 913–923. [Google Scholar] [CrossRef]
  8. Akinloye, O.; O Arowojolu, A.; Shittu, O.B.; I Anetor, J. Cadmium toxicity: A possible cause of male infertility in Nigeria. Reprod. Biol. 2006, 6, 17–30. [Google Scholar]
  9. Amara, S.; Abdelmelek, H.; Garrel, C.; Guiraud, P.; Douki, T.; Ravanat, J.-L.; Favier, A.; Sakly, M.; BEN Rhouma, K. Preventive Effect of Zinc Against Cadmium-induced Oxidative Stress in the Rat Testis. J. Reprod. Dev. 2008, 54, 129–134. [Google Scholar] [CrossRef] [Green Version]
  10. Abu-El-Zahab, H.S.; Hamza, R.Z.; Montaser, M.M.; El-Mahdi, M.M.; Al-Harthi, W.A. Antioxidant, antiapoptotic, antigenotoxic, and hepatic ameliorative effects of L-carnitine and selenium on cadmium-induced hepatotoxicity and alterations in liver cell structure in male mice. Ecotoxicol. Environ. Saf. 2019, 173, 419–428. [Google Scholar] [CrossRef]
  11. Rinaldi, M.; Micali, A.; Marini, H.R.; Adamo, E.B.; Puzzolo, D.; Pisani, A.; Trichilo, V.; Altavilla, D.; Squadrito, F.; Minutoli, L. Cadmium, Organ Toxicity and Therapeutic Approaches: A Review on Brain, Kidney and Testis Damage. Curr. Med. Chem. 2017, 24, 3879–3893. [Google Scholar] [CrossRef] [PubMed]
  12. Bu, T.; Mi, Y.; Zeng, W.; Zhang, C. Protective Effect of Quercetin on Cadmium-Induced Oxidative Toxicity on Germ Cells in Male Mice. Anat. Rec. Adv. Integr. Anat. Evol. Biol. 2010, 294, 520–526. [Google Scholar] [CrossRef]
  13. Hamza, R.Z.; Hillal, E.A.; Abdulkader, S.O. The Antioxidant Activity of Quercetin and its Effect on Acrylamide Hepato-toxicity in Liver of Rats. Lat. Am. J. Pharm. 2019, 38, 2057–2062. [Google Scholar]
  14. Hamza, R.Z.; El-Shenawy, N.S.; Ismail, H.A. Protective effects of blackberry and quercetin on sodium fluoride-induced oxidative stress and histological changes in the hepatic, renal, testis and brain tissue of male rat. J. Basic Clin. Physiol. Pharmacol. 2014, 26, 237–251. [Google Scholar] [CrossRef]
  15. Nawrot, T.S.; Staessen, J.A.; Roels, H.A.; Munters, E.; Cuypers, A.; Richart, T.; Ruttens, A.; Smeets, K.; Clijsters, H.; Vangronsveld, J. Cadmium exposure in the population: Fromhealth risks to strategies of prevention. Biometals 2010, 23, 769–782. [Google Scholar] [CrossRef] [Green Version]
  16. De Coster, S.; Van Larebeke, N. Endocrine-disrupting chemicals: Associated disorders and mechanisms of action. J. Environ. Public Health 2012, 2012, 713696. [Google Scholar] [CrossRef] [PubMed]
  17. Refat, M.S.; Hamza, R.Z.; Adam, A.M.A.; Saad, H.A.; Gobouri, A.A.; Al-Harbi, F.S.; Al-Salmi, F.A.; Altalhi, T.; El-Megharbel, S.M. Quercetin/Zinc complex and stem cells: A new drug therapy to ameliorate glycometabolic control and pulmonary dysfunction in diabetes mellitus: Structural characterization and genetic studies. PLoS ONE 2021, 16, e0246265. [Google Scholar] [CrossRef]
  18. Ayako, F.; Yoshio, F. Role of Zinc Homeostasis in the Pathogenesis of Diabetes and Obesity. Int. J. Mol. Sci. 2018, 19, 476. [Google Scholar] [CrossRef] [Green Version]
  19. Prasad, A.S. Discovery of Human Zinc Deficiency: Its Impact on Human Health and Disease. Adv. Nutr. 2013, 4, 176–190. [Google Scholar] [CrossRef]
  20. Lassi, Z.S.; Haider, B.A.; Bhutta, Z.A. Zinc supplementation for the prevention of pneumonia in children aged 2 months to 59 months. Cochrane Database Syst. Rev. 2010, 2016, CD005978. [Google Scholar] [CrossRef] [Green Version]
  21. El-Megharbel, S.M.; Hamza, R.Z.; Gobouri, A.A.; Refat, M.S. Synthesis of new antidiabetic agent by complexity between vanadyl (II) sulfate and vitamin B1: Structural, characterization, anti-DNA damage, structural alterations and antioxidative damage studies. Appl. Organomet. Chem. 2019, 33, e4892. [Google Scholar] [CrossRef]
  22. Sedlak, J.; Lindsay, R.H. Estimation of Total, Protein-Bound, and Nonprotein Sulfhydryl Groups in Tissue with Ellman’s Reagent. Anal. Biochem. 1968, 25, 192. [Google Scholar] [CrossRef]
  23. Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351. [Google Scholar] [CrossRef]
  24. Beers, J.R.; Sizer, I.W. A Spectrophotometric Method for Measuring the Breakdown of Hydrogen Peroxide by Catalase. J. Biol. Chem. 1952, 195, 133. [Google Scholar] [CrossRef]
  25. Hayat, M.A. Basic Techniques for Transmission Electron Microscopy, 1st ed.; Hayat, M.A., Ed.; Macmillan Press: New York, NY, USA, 1986; ISBN 9780123339263. [Google Scholar]
  26. Singh, N.P.; McCoy, M.T.; Tice, R.R.; Schneider, E.L. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp. Cell Res. 1988, 175, 184–191. [Google Scholar] [CrossRef] [Green Version]
  27. Dean, A.; Sullivan, K.; Soe, M. OpenEpi: Open Source Epidemiologic Statistics for Public Health. 2013. Available online: https://www.OpenEpi.com (accessed on 6 May 2013).
  28. Martynov, A.; Sushama, L.; Laprise, R. Simulation of temperate freezing lakes by one-dimensional lake models: Performance assessment for interactive coupling with regional climate models. Boreal Environ. Res. 2010, 15, 143–164. [Google Scholar] [CrossRef]
  29. Alharthi, W.A.; Hamza, R.Z.; Elmahdi, M.M.; Abuelzahab, H.S.H.; Saleh, H. Selenium and L-Carnitine Ameliorate Reproductive Toxicity Induced by Cadmium in Male Mice. Biol. Trace Elem. Res. 2020, 197, 619–627. [Google Scholar] [CrossRef] [PubMed]
  30. Chawla, R. Practical Clinical Biochemistry: Methods and Interpretations, 4th ed.; JP Medical Ltd.: London, UK, 2014. [Google Scholar]
  31. Gaskill, C.L.; Miller, L.M.; Mattoon, J.S.; Hoffmann, W.E.; Burton, S.A.; Gelens, H.C.J.; Ihle, S.L.; Miller, J.B.; Shaw, D.H.; Cribb, A.E. Liver Histopathology and Liver and Serum Alanine Aminotransferase and Alkaline Phosphatase Activities in Epileptic Dogs Receiving Phenobarbital. Vet. Pathol. 2005, 42, 147–160. [Google Scholar] [CrossRef]
  32. Morales, A.I.; Vicente-Sanchez, C.; Sandoval, J.S.; Egido, J.; Mayoral, P.; Arévalo, M.A.; Fernández-Tagarro, M.; López-Novoa, J.M.; Pérez-Barriocanal, F. Protective effect of quercetin on experimental chronic cadmium nephrotoxicity in rats is based on its an-tioxidant properties. Food Chem. Toxicol. 2006, 44, 2092–2100. [Google Scholar] [CrossRef]
  33. Renugadevi, J.; Prabu, S.M. Quercetin protects against oxidative stress-related renal dysfunction by cadmium in rats. Exp. Toxicol. Pathol. 2010, 62, 471–481. [Google Scholar] [CrossRef]
  34. Newairy, A.A.; El-Sharaky, A.S.; Badreldeen, M.M.; Eweda, S.M.; Sheweita, S.A. The hepatoprotective effects of sele-nium against cadmium toxicity in rats. Toxicology 2007, 242, 23–30. [Google Scholar] [CrossRef]
  35. Renugadevi, J.; Prabu, S.M. Cadmium-induced hepatotoxicity in rats and the protective effect of naringenin. Exp. Toxicol. Pathol. 2010, 62, 171–181. [Google Scholar] [CrossRef] [PubMed]
  36. Lakshmi, G.D.; Kumar, P.R.; Bharavi, K.; Annapurna, P.; Rajendar, B.; Patel, P.T.; Kumar, C.S.V.S.; Rao, G.S. Protective effect of Tribulus terrestris linn on liver and kidney in cadmium intoxicated rats. Indian J. Exp. Boil. 2012, 50, 141–146. [Google Scholar]
  37. Mathur, N.; Pandey, G.; Jain, G. Male Reproductive Toxicity of Some Selected Metals: A Review. J. Biol. Sci. 2010, 10, 396–404. [Google Scholar] [CrossRef] [Green Version]
  38. Erkekoglu, P.; Rachidi, W.; Yuzugullu, O.G.; Giray, B.; Favier, A.; Ozturk, M.; Hincal, F. Evaluation of cytotoxicity and oxidative DNA damaging effects of di (2-ethylhexyl)-phthalate (DEHP) and mono (2-ethylhexyl)-phthalate (MEHP) on MA-10 Leydig cells and protection by selenium. Toxicol. Appl. Pharmacol. 2010, 248, 52–62. [Google Scholar] [CrossRef]
  39. Al-Baqami, N.; Hamza, R. Synergistic antioxidant capacities of vanillin and chitosan nanoparticles against reactive oxygen species, hepatotoxicity, and genotoxicity induced by aging in male Wistar rats. Hum. Exp. Toxicol. 2021, 40, 183–202. [Google Scholar] [CrossRef] [PubMed]
  40. Hamza, R.Z.; El-Megharbel, S.M.; Altalhi, T.; Gobouri, A.A.; Alrogi, A.A. Hypolipidemic and hepato-protective synergistic effects of selenium nanoparticles and vitamin. E against acrylamide induced hepatic alterations in male albino mice. Appl. Organomet. Chem. 2020, 34, e5458. [Google Scholar] [CrossRef]
  41. Hamza, R.Z.; Al-Salmi, F.A.; El-Shenawy, N.S. Chitosan and Lecithin Ameliorate Osteoarthritis Symptoms Induced by Monoiodoacetate in a Rat Model. Molecules 2020, 25, 5738. [Google Scholar] [CrossRef]
  42. Hamza, R.Z.; Diab, A.E.A.A. Testicular protective and antioxidant effects of selenium nanoparticles on mon-osodium glutamate-induced testicular structure alterations in male mice. Toxicol. Reports 2020, 7, 254–260. [Google Scholar] [CrossRef] [PubMed]
  43. Jahan, S.; Khan, M.; Ahmed, S.; Ullah, H. Comparative analysis of antioxidants against cadmium induced reproductive toxicity in adult male rats. Syst. Biol. Reprod. Med. 2013, 60, 28–34. [Google Scholar] [CrossRef]
  44. Arroyo, V.; Flores, K.M.; Ortiz, L.B.; Quiroz, L.E.G.; Gutierrez-Ruiz, M.C. Liver and cadmium toxicity. J. Drug. Metab. Toxicol. 2012, 5, 1–7. [Google Scholar]
  45. Ramadan, L.A.; Abd-Allah, A.R.; Aly, H.A.; Saad-El-Din, A.A. Testicular toxicity effects of magnetic field exposure and prophylactic role of coenzyme Q10 and L-carnitine in mice. Pharmacol. Res. 2002, 46, 363–370. [Google Scholar] [CrossRef]
  46. Chang, B.; Nishikawa, M.; Sato, E.; Utsumi, K.; Inoue, M. L-Carnitine inhibits cisplatin-induced injury of the kidney and small intestine. Arch. Biochem. Biophys. 2002, 405, 55–64. [Google Scholar] [CrossRef]
  47. Garcia, C.L.; Filippi, S. The protective effect of L-carnitine in peripheral blood human lymphocytes exposed to oxidative agents. Mutagenesis 2005, 21, 21–27. [Google Scholar] [CrossRef] [Green Version]
  48. Jiang, L.; Cao, J.; An, Y.; Geng, C.; Qu, S.; Jiang, L.; Zhong, L. Genotoxicity of acrylamide in human hepatoma G2 (HepG2) cells. Toxicol. Vitr. 2007, 21, 1486–1492. [Google Scholar] [CrossRef] [PubMed]
  49. Farombi, E.O.; Adedara, I.A.; Akinrinde, S.A.; Ojo, O.O.; Eboh, A.S. Protective effects of kolaviron and quercetin on cadmi-um-induced testicular damage and endocrine pathology in rats. Andrologia 2012, 44, 273–284. [Google Scholar] [CrossRef] [PubMed]
  50. Philip, G.R.; Boyd, L.O. The effect of zinc deficiency on glucose metabolism in meal-fed rats. Br. J. Nutr. 1983, 49, 441. [Google Scholar]
  51. Olechnowicz, J.; Tinkov, A.; Skalny, A.; Suliburska, J. Zinc status is associated with inflammation, oxidative stress, lipid, and glucose metabolism. J. Physiol. Sci. 2018, 68, 19–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Coatings 11 00501 g001 550
Figure 1. Experimental protocol.
Figure 1. Experimental protocol.
Coatings 11 00501 g001
Coatings 11 00501 g002 550
Figure 2. Chemical structure of the Zn/Q complex [17].
Figure 2. Chemical structure of the Zn/Q complex [17].
Coatings 11 00501 g002
Coatings 11 00501 g003 550
Figure 3. (A) Control group showing normal hepatic structure and normal nuclei (H&EX400). (B) D-galactose-treated group showing experimental rat liver after treatment with CdCl2 with marked toxicity in the form of dilatation, elongation, irregularity of the portal vein ( Coatings 11 00501 i001), hypertrophy of hepatocytes with the appearance of binucleated hepatocytes and hydropic degeneration of hepatocytes with vesicular nuclei ( Coatings 11 00501 i002), Ductular reaction with new bile duct formation ( Coatings 11 00501 i003), appearance of mummified cells ( Coatings 11 00501 i004), and infiltration by inflammatory cells ( Coatings 11 00501 i002) (H&EX400). Figure (C): Zn/Q-treated group showing normal hepatic structure with normal nuclei (H&EX400). Figure (D): CdCl2 and Zn/Q-treated group showing great improvement and restoration of hepatic structures with mild changes in the form of hypertrophy of hepatocytes with granular eosinophilic cytoplasm and vesicular nuclei and appearance of some binucleated cells ( Coatings 11 00501 i003), with a slightly dilated central vein lined by endothelial cells and dilated congested blood sinusoids ( Coatings 11 00501 i005), some of which have been infiltrated by mononuclear inflammatory cells ( Coatings 11 00501 i001) (H&EX400). The histological index for scoring the hepatic structural alterations is shown in Table 4.
Figure 3. (A) Control group showing normal hepatic structure and normal nuclei (H&EX400). (B) D-galactose-treated group showing experimental rat liver after treatment with CdCl2 with marked toxicity in the form of dilatation, elongation, irregularity of the portal vein ( Coatings 11 00501 i001), hypertrophy of hepatocytes with the appearance of binucleated hepatocytes and hydropic degeneration of hepatocytes with vesicular nuclei ( Coatings 11 00501 i002), Ductular reaction with new bile duct formation ( Coatings 11 00501 i003), appearance of mummified cells ( Coatings 11 00501 i004), and infiltration by inflammatory cells ( Coatings 11 00501 i002) (H&EX400). Figure (C): Zn/Q-treated group showing normal hepatic structure with normal nuclei (H&EX400). Figure (D): CdCl2 and Zn/Q-treated group showing great improvement and restoration of hepatic structures with mild changes in the form of hypertrophy of hepatocytes with granular eosinophilic cytoplasm and vesicular nuclei and appearance of some binucleated cells ( Coatings 11 00501 i003), with a slightly dilated central vein lined by endothelial cells and dilated congested blood sinusoids ( Coatings 11 00501 i005), some of which have been infiltrated by mononuclear inflammatory cells ( Coatings 11 00501 i001) (H&EX400). The histological index for scoring the hepatic structural alterations is shown in Table 4.
Coatings 11 00501 g003
Coatings 11 00501 g004 550
Figure 4. Photomicrographs of hepatic tissues (A) Normal hepatic tissues and normal nucleus (N) and normal mitochondria (M) (Scale bar = 5 µm). (B) CdCl2 group showing large detached hepatic tissues ( Coatings 11 00501 i001) with the degeneration of nuclear contents (***) and reduced mitochondrial size (scale bar = 5 µm). (C) Zn/Q group showing normal appearance of the hepatic structures, normal round echo-chromatic nucleus (N), and normal sized mitochondria (M) (scale bar = 5 µm). (D) CdCl2+Zn/Q group showing normal hepatic structures with the appearance of normal nucleus (N) and mitochondria (M) (scale bar = 5 µm).
Figure 4. Photomicrographs of hepatic tissues (A) Normal hepatic tissues and normal nucleus (N) and normal mitochondria (M) (Scale bar = 5 µm). (B) CdCl2 group showing large detached hepatic tissues ( Coatings 11 00501 i001) with the degeneration of nuclear contents (***) and reduced mitochondrial size (scale bar = 5 µm). (C) Zn/Q group showing normal appearance of the hepatic structures, normal round echo-chromatic nucleus (N), and normal sized mitochondria (M) (scale bar = 5 µm). (D) CdCl2+Zn/Q group showing normal hepatic structures with the appearance of normal nucleus (N) and mitochondria (M) (scale bar = 5 µm).
Coatings 11 00501 g004
Coatings 11 00501 g005 550
Figure 5. (A) Control group showed normal nuclei. (B) CdCl2-treated group showed greater DNA damage. (C) Zn/Q group showed normal intact DNA. (D) CdCl2 and Zn/Q group showed less DNA damage with almost restoration of normal cellular boundaries.
Figure 5. (A) Control group showed normal nuclei. (B) CdCl2-treated group showed greater DNA damage. (C) Zn/Q group showed normal intact DNA. (D) CdCl2 and Zn/Q group showed less DNA damage with almost restoration of normal cellular boundaries.
Coatings 11 00501 g005
Coatings 11 00501 g006 550
Figure 6. The genes expression of mSOD and mβ-actin in hepatic tissues. 1: Control group; 2: CdCl2 group only; 3: Zn/Q group; and 4: CdCl2+Zn/Q group.
Figure 6. The genes expression of mSOD and mβ-actin in hepatic tissues. 1: Control group; 2: CdCl2 group only; 3: Zn/Q group; and 4: CdCl2+Zn/Q group.
Coatings 11 00501 g006
Table
Table 1. PCR primers and methods for the tested genes.
Table 1. PCR primers and methods for the tested genes.
Gene NamePrimer Sequence (5′–3′)Product SizeAccession Number
SODForward—GGAGAGCAGCGGTCGT BC066063.1
Reverse—TGTGGTATTGGAGGTTGGGTC631 bp
β-actinForward—TATAAAACCCGGCGGCGCA NM_007393
Reverse—ATGGCTACGTACATGGCTGG516 bp
GPxForward—CGGTTTCCCGTGCAATCAGT
Reverse—ACACCGGGGACCAAATGATG		670 bpNM_017006
CATForward—GCCAATGGCAATTACCCGTC
Reverse—AGAATGTCCGCACCTGAGTG		532 bpNM_012520
Table
Table 2. Hepatic enzymes of treated groups with CdCl2, Q/Zn, and their combinations.
Table 2. Hepatic enzymes of treated groups with CdCl2, Q/Zn, and their combinations.
GroupsALT (U/mL)AST (U/mL)LDH (U/L)Total Protein (g/dL)
1—Control group12.42 ± 1.0814.16 ± 1.75130.28 ± 4.588.16 ± 1.82
2—CdCl2 group162.06 ± 4.65 ab182.28 ± 4.05 ab897.19 ± 5.25 ab4.19 ± 0.25 ab
3—Zn/Q group12.52 ± 0.4913.49 ± 1.15127.39 ± 3.028.75 ± 1.55
4—CdCl2 + Zn/Q25.25 ± 2.65 a32.45 ± 4.02 a147.16 ± 4.58 a7.48 ± 1.69
LSD1.91.44.31.7
a Statistically significant different compared to control group. b Statistically significant different compared to other treatment groups. LSD: Least significant difference.
Table
Table 3. Hepatic enzymes of treated groups with CdCl2, Q/Zn, and their combinations.
Table 3. Hepatic enzymes of treated groups with CdCl2, Q/Zn, and their combinations.
GroupsSOD (U/g Tissue)CAT (U/g Tissue)GPx (mg/g Tissue)MDA (nmol/g Tissue)
1—Control group54.36 ± 3.5229.36 ± 2.0315.36 ± 1.668.36 ± 1.02
2—CdCl2 group10.69 ± 1.25 ab8.36 ± 1.36 ab2.36 ± 0.25 ab140.36 ± 4.69 ab
3—Zn/Q group60.9 ± 3.65 a30.25 ± 1.6916.58 ± 1.256.25 ± 2.36 a
4—CdCl2 + Zn/Q44.69 ± 2.69 a24.03 ± 1.69 a12.05 ± 1.69 a30.36 ± 1.02 a
LSD3.31.71.61.7
a Statistically significant different compared to control group. b Statistically significant different compared to other treatment groups. LSD: least significant difference.
Table
Table 4. Histopathological index in the hepatic tissues of rats treated with either CdCl2 and/or Q/Zn.
Table 4. Histopathological index in the hepatic tissues of rats treated with either CdCl2 and/or Q/Zn.
FindingsControl GroupCdCl2 GroupZn/Q GroupCdCl2+Zn/Q
Normal hepatic tissues++++------++++++++
Detached hepatic tissues------++++------------
Normal sized nuclei++++------++++-+++
Inflammatory cells------++++- - - +- - - +
------ Absence of the change in the animals of the studied group. ++++ A change was observed in 90% of the group. -+++ A change was observed in 80% the group. - - ++ A change was observed in 50% of the group. - - - + A change was observed in 25% of the group.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Refat, M.S.; Hamza, R.Z.; A. Adam, A.M.; Saad, H.A.; Gobouri, A.A.; Azab, E.; Al-Salmi, F.A.; Altalhi, T.A.; Khojah, E.; Gaber, A.; et al. Antioxidant, Antigenotoxic, and Hepatic Ameliorative Effects of Quercetin/Zinc Complex on Cadmium-Induced Hepatotoxicity and Alterations in Hepatic Tissue Structure. Coatings 2021, 11, 501. https://doi.org/10.3390/coatings11050501

AMA Style

Refat MS, Hamza RZ, A. Adam AM, Saad HA, Gobouri AA, Azab E, Al-Salmi FA, Altalhi TA, Khojah E, Gaber A, et al. Antioxidant, Antigenotoxic, and Hepatic Ameliorative Effects of Quercetin/Zinc Complex on Cadmium-Induced Hepatotoxicity and Alterations in Hepatic Tissue Structure. Coatings. 2021; 11(5):501. https://doi.org/10.3390/coatings11050501

Chicago/Turabian Style

Refat, Moamen S., Reham Z. Hamza, Abdel Majid A. Adam, Hosam A. Saad, Adil A. Gobouri, Ehab Azab, Fawziah A. Al-Salmi, Tariq A. Altalhi, Ebtihal Khojah, Ahmed Gaber, and et al. 2021. "Antioxidant, Antigenotoxic, and Hepatic Ameliorative Effects of Quercetin/Zinc Complex on Cadmium-Induced Hepatotoxicity and Alterations in Hepatic Tissue Structure" Coatings 11, no. 5: 501. https://doi.org/10.3390/coatings11050501

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop