The Correlation of Two Different Real-Time PCR Devices for the Analysis of CYP2C19 Pharmacogenetic Results
Abstract
1. Introduction
2. Materials and Methods
2.1. Setting
2.2. Materials
2.3. Methods
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Samer, C.F.; Lorenzini, K.I.; Rollason, V.; Daali, Y.; Desmeules, J.A. Applications of CYP450 testing in the clinical setting. Mol. Diagn. Ther. 2013, 17, 165–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pharmacogene Variation Consortium (PharmVar). CYP2C19 [Internet]. Children Mercy. Available online: https://www.pharmvar.org/gene/CYP2C19 (accessed on 20 August 2023).
- Ionova, Y.; Ashenhurst, J.; Zhan, J.; Nhan, H.; Kosinski, C.; Tamraz, B.; Chubb, A. CYP2C19 Allele Frequencies in Over 2.2 Million Direct-to-Consumer Genetics Research Participants and the Potential Implication for Prescriptions in a Large Health System. Clin. Transl. Sci. 2020, 13, 1298–1306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.R.; Luzum, J.A.; Sangkuhl, K.; Gammal, R.S.; Sabatine, M.S.; Stein, C.M.; Kisor, D.F.; Limdi, N.A.; Lee, Y.M.; Scott, S.A.; et al. Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2C19 Genotype and Clopidogrel Therapy: 2022 Update. Clin. Pharmacol. Ther. 2022, 112, 959–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- SlateRunPharma. Inventor VORICONAZOLE- Voriconazole Injection, Powder, Lyophilized, for Solution [Packet Insert]. 2019. Available online: https://dailymed.nlm.nih.gov/dailymed/drugInfo.cfm?setid=7f2e0784-8e48-f565-e053-2991aa0a0746 (accessed on 12 August 2019).
- Moriyama, B.; Kadri, S.; Henning, S.A.; Danner, R.L.; Walsh, T.J.; Penzak, S.R. Therapeutic Drug Monitoring and Genotypic Screening in the Clinical Use of Voriconazole. Curr. Fungal Infect. Rep. 2015, 9, 74–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Job, K.M.; Olson, J.; Stockmann, C.; Constance, J.E.; Enioutina, E.Y.; Rower, J.E.; Linakis, M.W.; Balch, A.H.; Yu, T.; Liu, X.; et al. Pharmacodynamic studies of voriconazole: Informing the clinical management of invasive fungal infections. Expert Rev. Anti-Infect. Ther. 2016, 14, 731–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moriyama, B.; Obeng, A.O.; Barbarino, J.; Penzak, S.R.; Henning, S.A.; Scott, S.A.; Agúndez, J.; Wingard, J.R.; McLeod, H.L.; Klein, T.E.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for CYP2C19 and Voriconazole Therapy. Clin. Pharmacol. Ther. 2017, 102, 45–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ISO 15189:2022; Medical laboratories–Particular Requirements for Quality and Competence. ISO: Geneva, Switzerland, 2022. Available online: https://www.iso.org/standard/76677.html (accessed on 1 September 2023).
- Miler, M.; Šimundić, A.M.; Štefanović, M.; Ferenec-Ružić, D.; Kvaternik, M.; Topic, E.; Vrkic, N. A model for results comparison on two different biochemistry analyzers in laboratory accredited according to the ISO 15189. Biochem. Med. 2009, 19, 287–293. [Google Scholar] [CrossRef] [Scilit]
- Itoh, K.; Inoue, K.; Yanagiwara, S.; Kyoya, H.; Suzuki, T. A rapid and simple detection of genetic defects responsible for the phenotypic polymorphism of cytochrome P450 2C19. Biol. Pharm. Bull. 1999, 22, 77–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lakhan, R.; Kumari, R.; Singh, K.; Kalita, J.; Misra, U.K.; Mittal, B. Possible role of CYP2C9 & CYP2C19 single nucleotide polymorphisms in drug refractory epilepsy. Indian J. Med. Res. 2011, 134, 295–301. [Google Scholar] [PubMed]
- Baldwin, R.M.; Ohlsson, S.; Pedersen, R.S.; Mwinyi, J.; Ingelman-Sundberg, M.; Eliasson, E.; Bertilsson, L. Increased omeprazole metabolism in carriers of the CYP2C19*17 allele; a pharmacokinetic study in healthy volunteers. Br. J. Clin. Pharmacol. 2008, 65, 767–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plebani, M. Laboratory errors: How to improve pre- and post-analytical phases? Biochem. Med. 2007, 17, 5–9. [Google Scholar] [CrossRef] [Scilit]
- Guiñón, L.; Soler, A.; López, R.M.; Pajares, S.; de Aledo, J.M.G.; Argudo-Ramírez, A.; Marín, J.L.; García-Villoria, J.; Sahuquillo, Á.; Alvarez, L. Inter-rater reliability assessment for the new-born screening quality assurance. Biochem. Medica 2022, 32, 030901. [Google Scholar] [CrossRef] [Scilit]
- Di Nunno, N.; Esposito, M.; Argo, A.; Salerno, M.; Sessa, F. Pharmacogenetics and Forensic Toxicology: A New Step towards a Multidisciplinary Approach. Toxics 2021, 9, 292. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Gen | PCR | Primer Sequence | Reference |
|---|---|---|---|
| CYP2C19*2 | PCR-1 | F: 5′TTTGAGCCCCTCCCACTT3′ R: 5′CCTCCTGTGCTGATCTCAC3′ | Home made primers and PCR conditions from [11] |
| PCR-2 | F: 5′AATTACAACCAGAGCTTGGC3′ R: 5′TATCACTTTCCATAAAAGCAAG3′ | Primers from [12] and PCR conditions from [11] | |
| CYP2C19*17 | PCR-1 | F: 5′GCCCTTAGCACCAAATTCTC3′ R: 5′ATTTAACCCCCTAAAAAAACACG3′ | Primers and PCR conditions from [13] |
| PCR-2 | F: 5′AAATTTGTGTCTTCTGTTCTCAATG3′ R: 5′AGACCCTGGGAGAACAGGAC3′ |
| SNP CYP2C19_19154G>A (rs4244285) | ||
|---|---|---|
| Sample ID | 7500 Applied Biosystems | QuantStudio12KFlex |
| 1 | No result | No result |
| 2 | Heterozygous AG | Heterozygous AG |
| 3 | No result (no evaluable) | No result (no evaluable) |
| 4 | No result (no evaluable) | No result (no evaluable) |
| 5 | Heterozygous AG | Heterozygous AG |
| 6 | No result (no evaluable) | No result (no evaluable) |
| 7 | Heterozygous AG | Heterozygous AG |
| 8 | Homozygous GG | Homozygous GG |
| 9 | Homozygous GG | Homozygous GG |
| 10 | No result (no evaluable) | No result (no evaluable) |
| 11 | Homozygous GG | Homozygous GG |
| 12 | Heterozygous AG | Heterozygous AG |
| 13 | Homozygous GG | Homozygous GG |
| 14 | Homozygous GG | Homozygous GG |
| 15 | Homozygous GG | Homozygous GG |
| 16 | Homozygous GG | Homozygous GG |
| 17 | Heterozygous AG | Heterozygous AG |
| 18 | Homozygous AA | Homozygous AA |
| 19 | Homozygous AA | Homozygous AA |
| 20 | Homozygous GG | Homozygous GG |
| 21 | Homozygous GG | Homozygous GG |
| 22 | Heterozygous AG | Heterozygous AG |
| 23 | Homozygous AA | Homozygous AA |
| SNP CYP2C19_-806C>T (rs12248560) | ||
|---|---|---|
| Sample ID | 7500 Applied Biosystems | QuantStudio12KFlex |
| 24 | Homozygous CC | Homozygous CC |
| 25 | Heterozygous CT | Heterozygous CT |
| 26 | Homozygous CC | Homozygous CC |
| 27 | Homozygous CC | Homozygous CC |
| 28 | Homozygous CC | Homozygous CC |
| 29 | Heterozygous CT | Heterozygous CT |
| 30 | Heterozygous CT | Heterozygous CT |
| 31 | Homozygous CC | Homozygous CC |
| 32 | Homozygous CC | Homozygous CC |
| 33 | Homozygous CC | Homozygous CC |
| 34 | No result (no evaluable) | No result (no evaluable) |
| 35 | No result (no evaluable) | No result (no evaluable) |
| 36 | Homozygous CC | Homozygous CC |
| 37 | No result (no evaluable) | No result (no evaluable) |
| 38 | Homozygous CC | Homozygous CC |
| 39 | Homozygous CC | Homozygous CC |
| 40 | Homozygous TT | Homozygous TT |
| 41 | Homozygous TT | Homozygous TT |
| 42 | Homozygous TT | Homozygous TT |
| 43 | Homozygous TT | Homozygous TT |
| 44 | Homozygous TT | Homozygous TT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alonso Llorente, A.; Salgado Garrido, J.; Teijido Hermida, O.; González Andrade, F.; Valiente Martín, A.; Fanlo Villacampa, A.; Vicente Romero, J. The Correlation of Two Different Real-Time PCR Devices for the Analysis of CYP2C19 Pharmacogenetic Results. Sci. Pharm. 2023, 91, 51. https://doi.org/10.3390/scipharm91040051
Alonso Llorente A, Salgado Garrido J, Teijido Hermida O, González Andrade F, Valiente Martín A, Fanlo Villacampa A, Vicente Romero J. The Correlation of Two Different Real-Time PCR Devices for the Analysis of CYP2C19 Pharmacogenetic Results. Scientia Pharmaceutica. 2023; 91(4):51. https://doi.org/10.3390/scipharm91040051
Chicago/Turabian StyleAlonso Llorente, Alba, Josefa Salgado Garrido, Oscar Teijido Hermida, Fabricio González Andrade, Alberto Valiente Martín, Ana Fanlo Villacampa, and Jorge Vicente Romero. 2023. "The Correlation of Two Different Real-Time PCR Devices for the Analysis of CYP2C19 Pharmacogenetic Results" Scientia Pharmaceutica 91, no. 4: 51. https://doi.org/10.3390/scipharm91040051
APA StyleAlonso Llorente, A., Salgado Garrido, J., Teijido Hermida, O., González Andrade, F., Valiente Martín, A., Fanlo Villacampa, A., & Vicente Romero, J. (2023). The Correlation of Two Different Real-Time PCR Devices for the Analysis of CYP2C19 Pharmacogenetic Results. Scientia Pharmaceutica, 91(4), 51. https://doi.org/10.3390/scipharm91040051

