Next Article in Journal
The Influence of Energy Balance, Lipolysis and Ketogenesis on Metabolic Adaptation in Cows Milked Twice and Three Times Daily
Next Article in Special Issue
Feeding Rainbow Trout with Different Types of Non-Starch Polysaccharides: Impacts on Serum Metabolome and Gut Microbiota
Previous Article in Journal
Dietary Effect of Clostridium autoethanogenum Protein on Growth, Intestinal Histology and Flesh Lipid Metabolism of Largemouth Bass (Micropterus salmoides) Based on Metabolomics
Previous Article in Special Issue
Different Types of Non-Starch Polysaccharides Alter the Growth, Intestinal Flora and Serum Metabolite Profile of Grass Carp, Ctenopharyngodon idella
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Metabolites
Volume 12
Issue 11
10.3390/metabo12111089
metabolites-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂)

by
Xuehe Li
1,2,
Yuanming Yi
1,2,
Jiahua Wu
1,2,
Qihui Yang
1,2,3,*,
Beiping Tan
1,2 and
Shuyan Chi
1,2
1
College of Fisheries, Guangdong Ocean University, Zhanjiang 524088, China
2
Aquatic Animals Precision Nutrition and High Efficiency Feed Engineering Research Center of Guangdong Province, Zhanjiang 524088, China
3
Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Zhanjiang 524088, China
*
Author to whom correspondence should be addressed.
Metabolites 2022, 12(11), 1089; https://doi.org/10.3390/metabo12111089
Submission received: 18 October 2022 / Revised: 4 November 2022 / Accepted: 6 November 2022 / Published: 10 November 2022
(This article belongs to the Special Issue Nutrient Metabolism and Intestinal Health Studies in Aquatic Animals)
Browse Figures
Review Reports Versions Notes

Abstract

:
In a context where the search for plant-derived additives is a hot topic, glycerol monolaurate (GML) was chosen as our subject to study its effect on grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Seven gradient levels of GML (0, 600, 1200, 1800, 2400, 3000, and 3600 mg/kg) were used for the experiment. Based on our experiments, 1800 mg/kg GML significantly increased the final body weight (FBW) and weight gain rate (WGR). GML increased the activity of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) and decreased malondialdehyde (MDA). Adding 1800 mg/kg GML also significantly increased the levels of lauric acid (C12:0) (LA), n-3 polyunsaturated fatty acids (PFA), and the n-6 PFA-to-n-3/n-6 ratio, while significantly decreasing the levels of saturated fatty acids (SFA). Dietary supplementation with GML significantly inhibited the expression of pro-inflammatory factors and reduced the occurrence of inflammation. GML improved intestinal flora and the abundance of beneficial bacteria (Bacillus, Psychrobacter, Acinetobacter, Acinetobacter, Stenotrophomonas, and Glutamicibacter). It provides a theoretical basis for the application of GML in aquafeed and greatly enhances the possibility of using GML in aquafeed. Based on the above experimental results, the optimum level of GML in grouper feed is 1800 mg/kg.

Graphical Abstract

1. Introduction

Hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) has become one of the most important marine economic fish in China because of its tender meat and delicious taste. In recent years, the production of grouper culture has been rising, and the scale of culture has been expanding. However, the rapid development of the intensive culture of grouper may induce oxidative stress in fish, caused by aquatic animals, and affect the antioxidant protection capacity of aquatic animals [1].
Oxidative stress is caused by the inordinate generation of free radicals and reactive oxygen species (ROS), resulting in a reduction in the body’s antioxidant defenses [2,3]. It causes biomolecular damage and metabolic and physiological dysregulation, which in turn results in an imbalance in the animal’s immune function and inflammatory response [4,5]. Oxidative stress promotes multiple transcription factors that allow for a high expression of pathways associated with inflammation [6]. Inflammation caused by oxidative stress is the etiology of many chronic diseases [7]. Inflammatory diseases can reduce aquatic animal productivity, reproductive performance, and disease resistance, causing huge economic losses not only to farmers but also to consumers [8].
In the past several years, antibiotic treatments have been one of the main treatments to counteract oxidative stress and inflammatory diseases and improve disease resistance in animals [9,10]. However, antibiotics have had a serious impact on sustainable development, human health, and the ecological environment due to drug resistance and residues [11,12]. The European Union (EU) has imposed a ban on the application of antibiotics as additives in animal feed since 2006 [13]. Therefore, further development and research on additives with the potential to replace antibiotics has become a pressing matter of urgency. Plant extracts are recognized as a promising source of antioxidants and anti-inflammatory substances that have been confirmed and suggested for combatting diseases associated with oxidative stress [14].
Glycerol monolaurate (GML) is a naturally occurring compound commonly found in coconut oil and American spice and is a food additive of plant origin permitted by the US Food and Drug Administration (FDA) [15,16,17]. It has excellent antibacterial, antiviral, antioxidant, and emulsifying properties [18,19]. Because GML is a natural compound, it does not cause either resistance in animals or drug residues. Recently, it has been shown that GML has a beneficial effect on terrestrial animals’ (piglets [20], broilers [21,22], laying hens [23], weaned lambs [24]) growth and development, significantly promoting growth, improving antioxidant capacity, and reducing the inflammatory response. However, there is a huge gap in the study of GML in aquatic animals; the main ones known are Litopenaeus vannamei [25], Danio rerio [26], and Pelodiscus sinensis [27]. The aim of this paper is to explore the effects of GML on antioxidant capacity, disease resistance, and inflammatory response in grouper to improve the feasibility of GML application in aquatic animals and to provide a theoretical basis for the further substitution of GML for antibiotics.

2. Materials and Methods

This study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Aquatic Sciences, Guangdong Ocean University. The approval code is GDOU-IACUC-2021-A2013 and the approval date was 11 April 2021.

2.1. Experimental Design and Diets Preparation

This experiment followed the method of the Association of Official Analytical Chemists (AOAC) [28] to prepare a basal diet. Seven iso-nitrogenous and iso-lipidic diets were formulated according to Table 1. The steps for making the feed refer to our previous production process [29].

2.2. Experimental Animals and Breeding Management

Juvenile grouper were sourced from the Yongsheng Fish Hatchery (Zhanjiang, China). Before the start of the experiment, all the grouper were placed in several fiberglass barrels (2 m3) for a fortnight to allow them to acclimatize to the culture conditions and reach the target weight. Feeding was stopped 24 h before the start of the experiment. A total of 840 healthy and active fish (9.09 ± 0.01 g) were chosen and divided into 7 groups of 4 replicates of 30 fish per tank for an 8-week trial. All fish were fed twice daily on a full stomach (7:30, 17:30). The water environment needed to be sustained at the following levels: temperature of 28–30 °C, salinity of 28–30, pH 7.5–8.0, and dissolved oxygen levels of ≥5.0 mg/L.

2.3. Sample Collection

After the breeding experiment, groupers were starved for 24 h before samples were collected [30]. All fish were anesthetized with MS-222 before the sample collection. Four fish in each tank were chosen freely to collect their livers and then transferred to −80 °C after being temporarily frozen in liquid nitrogen until analysis. Four fish were randomly selected from each tank, and the head kidneys were taken, placed in RNA later at 4 °C 24 h, and then kept at −80 °C. The above sample collection procedures were conducted on ice and were based on previous experimental methods [31,32].

2.4. Liver Antioxidant Enzyme Activity Analysis

The activities of catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA), and lysozyme (LZM) were analyzed using commercial ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China). Liver samples were homogenized into 10% homogenate (EasyWeLL Series JY98-IIIN Model Cell Disruptor) with iced saline (sterile) at a ratio of 1:9. After cryogenic homogenization (2500 rpm, 10 min), the supernatant was extracted and then analyzed according to the instructions. The above measurements of enzyme activity were performed on ice.

2.5. Gene Expression Analysis

The head kidney total mRNA was obtained using an RNA extraction kit (TansGen Biotech, Co., Ltd. (Beijing, China)). The complementary DNA (cDNA) was transcribed using an Evo M-MLV RT kit (Accurate Biotechnology (Accurate Biotechnology Co., Ltd. (Changsha, China)).
The gene expressions of toll-like receptor 2 (TLR2), myeloid differentiation primary response gene 88 (myd88), interleukin 1β (IL-1β), interleukin 10 (IL10), interleukin 8 (IL8) were performed on Roche Light Cycler 480Ⅱ (Switzerland) using an SYBR® Green Pro Taq HS Premix II kit (Accurate Biotechnology Co., Ltd. (Changsha, China)). The primer sequences of genes are shown in Table 2. The results of real-time qPCR were analyzed by previous authors [33].

2.6. Vibrio parahaemolyticus Challenge Test

The Vibrio parahaemolyticus used for the bacterial challenge test was provided by the Key Laboratory of Pathogenesis Biology and Epidemiology of Aquatic Economic Animals of Guangdong Province. The strains were taken out from −80 °C and thawed and shaken well, and then 200 µL were taken and inoculated into Luria–Bertani (LB) solid medium for rejuvenation of the strain (37 °C, 24 h). Single colonies with strong growth were added to LB liquid medium and incubated at 37 °C for 18–24 h. At the end of the culture, the bacteria were collected by centrifugation at 4 °C (4000 rpm, 10 min), washed with sterile phosphate-buffered saline (PBS), and then centrifuged again. This process was repeated 2–3 times until the solution was clarified. Different volumes of PBS were added for dilution until OD = 1 (109 cfu/mL). Then the solution was diluted to 108, 107, and 106 for the pre-test. The results show that the median lethal dose (LD50) was 2 × 107 cfu/mL. Ten grouper were collected randomly from each tank and injected with 200 μL of the bacterial solution slowly into the abdominal cavity for a 7 d bacterial challenge test. At the end of the 7 d challenge test, four livers were collected from each vessel to detect immune and antioxidant-related enzyme activities.

2.7. Statistical Analysis

Statistical analysis of the experimental data was conducted using SPSS 17.0 software. One-way ANOVA was used to analyze the data, and Duncan’s multiple comparisons were applied if there was a significant difference (p < 0.05). The experimental data were expressed as means ± standard deviation (X ± SD).

3. Results

3.1. Effects of Dietary GML Levels on the Antioxidant Index in Liver and Serum for Grouper

FBW and WGR increased and then decreased with the addition of GML, and both had a maximal value in the G1800 group (p < 0.05). However, there was no significant effect of SR between the groups (p > 0.05) (Figure 1).

3.2. Effects of Dietary GML Levels on the Antioxidant Index in Liver and Serum for Grouper

All antioxidant indices are shown in Table 3. In the serum, the group supplemented with GML significantly reduced the MDA content (p < 0.05); SOD activity was significantly increased (p < 0.05); GSH-Px was significantly higher in the G1800, G2400, and G3000 groups than in the control group (p < 0.05). In the liver, the G1800 group had the lowest values of MDA and the highest values of SOD activity (p < 0.05). The difference in CAT activity between the liver and serum was not statistically significant (p > 0.05).

3.3. Effects of Dietary GML Levels on Muscle Fatty Acid Composition for Grouper

The composition of muscle fatty acid (FA) is shown in Table 4. The G1800 group had significantly increased levels of lauric acid (C12:0) (LA), n-3 polyunsaturated fatty acids (PUFA), n-6 PUFA, and the n-3/n-6 PUFA ratio and significantly decreased levels of saturated fatty acids (SFA) compared to the control group.

3.4. Effects of Dietary GML Levels on the Relative Expression of myd88 and IL10 in Head Kidney for Grouper

In this study, the expressions of inflammation-related genes in the head kidney were determined (Figure 2). The expression of TLR2 in the G1200, G1800, G2400, and G3000 groups was significantly lower than that in the G0 group. The addition of GML significantly reduced the expressions of myd88 and IL-1β, which was significantly higher in the control group (G0) than in the other groups (p < 0.05). GML significantly increased IL10 expression, which was significantly higher in the G1800, G2400, and G3000 groups than in the G0 group (p < 0.05). There was no significant effect of GML on IL8 (p > 0.05).

3.5. Vibrio parahaemolyticus Challenge Test Results

3.5.1. Effects of Dietary GML Levels on Survival Rate in Vibrio parahaemolyticus Challenge Test

After 7 days of the bacteria challenge test with Vibrio parahaemolyticus, the G1800 and G2400 groups showed the highest survival rates (p < 0.05) but were not significantly different from each other (p > 0.05) (Figure 3).

3.5.2. Effects of Dietary GML Levels on Enzyme Activity of LZM in Bacterial Challenge Test

The activity of LZM in the G600, G1800, and G2400 groups was significantly increased in the bacterial experiment test (p < 0.05) and had the highest value in the G1800 group (p < 0.05) (Figure 4A).

3.5.3. Effects of Dietary GML Levels on Enzyme Activity of SOD in Vibrio parahaemolyticus Challenge Test

The SOD activities of G1200, G1800, G2400, G3000, and G3600 were significantly higher than that in the G0 group before the test (p < 0.05). The activities of SOD were significantly higher in the G1800, G2400, and G3600 groups than in G0 after the test (p < 0.05) (Figure 4B).

3.5.4. Effects of Dietary GML Levels on MDA Content in Vibrio parahaemolyticus Challenge Test

The content of MDA was significantly lower in the G2400 group than in the control group before the test (p < 0.05). The MDA contents of the G1800, G2400, G3000, and G3600 groups did not change significantly after the test but were significantly lower than that of the control group (p > 0.05) (Figure 4C).

3.6. Effects of Dietary GML Levels on Intestinal Flora for Hybrid Grouper

3.6.1. Effects of Dietary GML Levels on Relative Abundance of Species for Hybrid Grouper

As seen in Figure 5A, the top four intestinal flora of grouper at the phylum level were Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes. The highest relative abundance of Firmicutes was found in the G1800 (12.37%) and G2400 groups (27.89%). At the genus level, G1800 (11.91%) and G2400 (27.68%) had the highest relative abundance of Bacillus, while Vibrio (2.05% and 2.595%) and Enterovibrio (0.13% and 0.77%) were significantly lower than the G0 group (Figure 5B).

3.6.2. Effects of Dietary GML Levels on Shannon and Simpson Indices for Juvenile Grouper

There were no significant differences in the Shannon and Simpson indices among the seven groups (Figure 6) (p > 0.05).

3.6.3. Analysis of the Association between GML and Intestinal Flora

The level of GML addition showed a significant positive correlation with Acinetobacter, Acinetobacter, Stenotrophomonas, and Glutamicibacter (p < 0.05), while a highly significant positive correlation was found with Bacillus and Psychrobacter (p < 0.01). However, the addition of GML inhibited Photobacterium, with a significant negative correlation (p < 0.05) (Figure 7).

4. Discussion

Our experimental results show that the addition of GML significantly improved the FBW and WGR of the grouper. Similar results have been verified in terrestrial animals [20,21,22,23,24]. However, the application of GML in aquatic animals [25,26] is still very rare and needs further extensive research.
Enzymatic and non-enzymatic systems make up the antioxidant system of an organism. The enzymatic system includes antioxidant enzymes such as SOD, CAT, and others, while the non-enzymatic system mainly includes oxidation products such as MDA, GSH, and other non-enzymatic antioxidants [34]. The antioxidant system scavenges excess ROS and superoxide anion radicals (O2−) from the body and reduces oxidative damage to the body [35]. Our experiment indicated that the addition of 1800 and 2400 mg/kg GML significantly raised the activities of SOD and GSH-Px and significantly reduced the content of MDA in the serum. The study in Litopenaeus vannamei demonstrated that GML significantly improved the activities of SOD and CAT [25]. A previous study showed that the SOD activity of Procambarus clarkii was significantly elevated because of the supplementation of GML [36]. Studies on laying hens [37], Lateolabrax maculatus [38], and weaned lambs [24] have shown that GML increased SOD and GSH-Px activities. Famurewa et al. showed that the addition of coconut oil (containing approximately 45% LA) significantly increased the activities of SOD, CAT, and GSH-Px in mice while reducing MDA levels [39]. The results of the above studies are similar to the present experiment, probably because medium-chain fatty acids (MCFAs) can supply energy more efficiently than carbohydrates for animals. As a typical derivative of MCFAs, GML can be added to the diet of juvenile animals for energy supply. GML can enter the mitochondria of hepatocytes freely for oxidation and is not dependent on carnitine carriers, allowing for a rapid energy supply [40]. The metabolic energy consumption of other nutrients and mitochondrial energy production are reduced, resulting in lower free radical production and less damage to the body due to oxidative stress [41]. Based on the above experimental results, the optimum level of GML in grouper feed is 1800 mg/kg.
FA composition is one of the most valuable indices of the nutritional value and quality of meat [42]. Experiments with Trionyx sinensis [27] and chickens [22,23,37] have shown that the addition of GML significantly reduced the SFA content. There was a tendency to reduce muscle SFA in rhododendrons by adding GML to the feed [43]. Our experimental results show that supplementation with GML (1800 mg/kg) reduced the SFA levels, which is generally consistent with the previous results described. SFA is the main cause of elevated human cholesterol (CHOL), triglycerides (TG), and low-density lipoprotein cholesterol (LDL-C) [44]. In this experiment, the addition of GML significantly reduced the SFA content, which both improved the muscle quality of groupers and reduced the harm caused by excessive SFA. Medium-chain fatty acids (MCFAs) have good antibacterial properties and can regulate the balance of the intestinal micro-ecosystem by inhibiting the proliferation of harmful bacteria [45]. GML, as a type of MFA, can be rapidly oxidized to provide energy to the organism [46]. The content of LA in muscle was positively correlated with the addition of GML, and the nutritional value was significantly increased. The n-6 PUFA and n-3 PUFA cannot be synthesized in the human body and can only be consumed from external sources; thus, they are called essential fatty acids (EFAs) [47,48]. The n-6 PUFA can be consumed in large quantities from vegetable oils, such as soybean oil. Fish (especially marine fish) and seal oils, are the main sources of n-3 PUFA intake for humans, but the intake of n-3 PUFA is severely inadequate [49]. Excessive intake of n-6 PUFA increases cellular inflammation and induces obesity, which is detrimental in humans [50]. The present experiment demonstrated that GML supplementation significantly increased the contents of the n-3 PUFA-to-n-6 PUFA ratio and improved n-3 PUFA intake and dietary balance. Supplementation of GML promotes the digestion and absorption of fat in animals due to its good emulsification properties [51]. Changes in the FA composition of grouper muscle also reflect the positive effect of GML on the nutritional quality of grouper.
Oxidative stress also causes damage to biomolecules and metabolic and physiological dysregulation, which in turn causes imbalances in the immune function and inflammatory response of animals. The TLR signaling pathway is a signaling pathway closely related to anti-inflammatory immune mechanisms, and it plays an important role in the development of tissue inflammation [52]. TLR2 induces a myd88-dependent pathway that regulates other pro-inflammatory factors to indirectly induce a series of chain reactions that increase the expressions of pro-inflammatory factors [53,54]. The expression of myd88 was significantly increased in mice that were fed a high-fat diet, whereas myd88 expression was suppressed by the addition of 1600 mg/kg GML [55]. IL10 has significant effects on physiological processes, such as immune response and inflammation [56]. The expression of IL10 was significantly enhanced, and IL-1β tended to decrease in Danio rerio after the addition of 750 mg/kg of GML to the diet [26]. A study on piglets showed that the addition of 1000 mg/kg of α-GML resulted in a significant increase in the IL10 concentration [55]. The results of our experiment demonstrate that the addition of GML could reduce the expression of the pro-inflammatory factor IL-1β by decreasing the signaling of TLR4 and inhibiting the myd88-dependent pathway. The anti-inflammatory capacity of the organism was remarkably enhanced and could be sufficient to resist the inflammatory response brought about by oxidative stress, which was greatly related to the enhanced activity of the antioxidant enzyme system. The above experimental results demonstrate that GML could have a positive effect on reducing oxidative stress and improving immune function in grouper by regulating inflammation-related factors and increasing the activity of the antioxidant system.
When grouper are exposed to external stimuli, excess reactive oxygen species (ROS) are produced in the organism. ROS promotes lipid peroxidation in cell membranes, resulting in oxidative damage to the body and various diseases [57]. Similar to mammals, fish have both non-specific and specific immune functions, with various immune cells and factors in the blood, mucosal barriers, and tissues working together to protect against pathogens [58]. LZM is an important component of the specific immune function of fish. It lyses the bacterial cell wall by binding to the β-1,4 glycosidic bond between the hydrolysis sites N-Acetylmuramicacid (NAM) and N-Acetylglucosamine (NAG), resulting in the lysis of the bacteria [59]. Qian et al. found that GML (3000 mg/kg) significantly increased the survival rate and SOD activity of Procambarus clarkii infected with white spot syndrome virus (WSSV) [36]. An experiment in piglets showed that the addition of GML significantly reduced the MDA content and significantly increased the SOD activity of porcine epidemic diarrhea virus (PEDV)-infected piglets, while the change in CAT activity was not significant but tended to increase [56]. This study shows that the survival rate of grouper in a bacterial challenge test was significantly increased using GML (1800 and 2400 mg/kg). The LZM activity increased significantly after the bacterial challenge test and reached the maximum value in the G1800 and G2400 groups. At the same time, the bacterial challenge test had no significant effect on the MDA content when the GML addition level was greater than 1800 mg/kg. The possible mechanism for this is that GML can attach to the majority of G+ surfaces and a small amount of G-, leading to cell wall rupture and the efflux of intracellular material [59,60,61], significantly enhancing the ability of LZM to eliminate bacteria. The liver SOD activity increased significantly after the bacterial challenge test, with the highest activity in the G1800 and G2400 groups. At the same time, the bacterial challenge test had no significant effect on the liver MDA content when the GML addition level was greater than 1800 mg/kg. This indicates that the addition of GML resulted in a decrease in the accumulated ROS content of the organism and protected the body from oxidative damage.
The main metabolite of Firmicutes is butyric acid (BA) [62]. BA is a type of short-chain fatty acid that plays an active role in intestinal health. It is a major source of energy for intestinal epithelial cells and may promote intestinal health by increasing epithelial absorptive cells. The addition of GML, which significantly increased the abundance of thick-walled bacterial phylum in this experiment, could increase the accumulation of BA content and promote intestinal health [63]. In the association analysis between GML and intestinal flora, GML was correlated with Bacillus, Psychrobacter, Acinetobacter, Acinetobacter, Stenotrophomonas, and Glutamicibacter. Bacillus is one of the most widely used probiotics in aquaculture. Bacillus, as a probiotic, can improve antioxidant capacity, effectively scavenging free radicals and protecting the body from oxidative damage [64]. Bacillus can produce antimicrobial substances with broad-spectrum antimicrobial properties, inhibiting a wide range of pathogenic Gram-positive and Gram-negative bacteria (but more so for G+) and improving the immune system [65,66,67]. Cha et al. demonstrated that the addition of Bacillus to the diet significantly improved the immunity and disease resistance of Paralichthysolivaceus [68]. The above results have also been confirmed in Oreochromis niloticus [69] and Litopenaeus vannamei [70]. The results of this experiment show that GML promoted the growth of Bacillus, and the immune capacity, antioxidant capacity, and disease resistance were also improved. The carbohydrate utilization ability of carnivorous fish is much worse than that of terrestrial animals, and excessive carbohydrate content will lead to a decrease in fish resistance. Enteroglucagon has the function of promoting insulin secretion and inhibiting glucagon secretion, which can achieve hypoglycemic effect; however, it is easily degraded and inactivated by dipeptidyl peptidase-IV (DDP-IV) and cannot be effective. Yu et al. found that Lysinibacillus could inhibit DDP-IV activity in Cyprinus carpio, thus indirectly reducing blood glucose and promoting the health of the organism [71]. The application of Lysinibacillus to the culture of Litopenaeus vannamei significantly reduced the harmful nitrogen levels in the water and significantly increased the survival rate [72]. There is experimental evidence for the synthesis of silver nanoparticles from the extracellular filtrate of Lysinibacillus sphaericus, which have bactericidal activity against G- and G+ and are non-toxic to cells [73]. Studies have shown that Glutamicibacter uratoxydans KIBGE-IB41 produces chitinase, which hydrolyzes the cell wall of the fungus and enhances the ability of the organism to resist the fungus [74]. However, no study of Glutamicibacter in aquatic animals has been found, and this may also be considered a new finding. Studies in aquatic animals have shown that both Acinetobacter and Psychrobacter can secrete lipase [75], which is an important digestive enzyme for the body that hydrolyzes lipids and accelerates catabolism [76]. GML was significantly and positively correlated with Acinetobacter and Psychrobacter to increase the digestive activity of lipase and promote intestinal health in grouper.

5. Conclusions

In conclusion, the addition of GML significantly improved the antioxidant capacity, anti-inflammatory activity, and disease resistance of grouper, which effectively resisted oxidative damage caused by oxidative stress, enhanced the nutritional value of muscles, regulated intestinal flora, and increased immune capacity. This provides a theoretical basis for the application of GML in aquafeeds and greatly enhances the possibility of using GML in aquafeeds. Based on the above experimental results, the optimum level of GML in grouper feed is 1800 mg/kg.

Author Contributions

Investigation, conceptualization, software, and writing—original draft, X.L.; supervision and software, Y.Y. and J.W.; conceptualization, supervision, funding acquisition, methodology, software, writing—review and editing, Q.Y.; investigation, methodology, and resources, B.T. and S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation (31802316); the Correspondent for Science and Technology of Guangdong Province (GDKTP2021048400); the National Key Research and Development Program (2019YFD0900200); the Postgraduate Education Innovation Project of Guangdong Ocean University (202247).

Institutional Review Board Statement

This study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Aquatic Sciences, Guangdong Ocean University. The approval code is GDOU-IACUC-2021-A2013 and the approval date was 11 April 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to [the original data is only stored on private computers and not published to public databases].

Conflicts of Interest

The authors confirm that there was no conflict of interest with this experiment.

References

  1. Tuerxun, M.; Muhda, A.; Yin, L. The molecular mechanisms of signal pathway activating effect of E2F-1/NF-kappaB/GSK-3beta on cognitive dysfunction of alzheimer rats. Bioengineered 2021, 12, 10000–10008. [Google Scholar] [CrossRef] [PubMed]
  2. Park, J.Y.; Kwon, Y.W.; Lee, S.C.; Park, S.D.; Lee, J.H. Herbal formula SC-E1 suppresses lipopolysaccharide-stimulated inflammatory responses through activation of Nrf2/HO-1 signaling pathway in RAW 264.7 macrophages. BMC Complement. Altern. Med. 2017, 17, 374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Yeon, L.J.; Jin, S.S.; Sik, S.J.; Kang, S.S.; Hwa, C.S. Bone-healing capacity of pcl/plga/duck beak scaffold in critical bone defects in a rabbit model. Biomed Res. Int. 2016, 2016, 2136215. [Google Scholar]
  4. Hjelmgren, O.; Gummesson, A.; Bergstrm, G.; Schmidt, C. Beta-cell function, self-rated health, and lifestyle habits in 64-year-old swedish women with metabolically healthy obesity phenotype. J. Obes. Metab. Syndr. 2020, 29, 39–46. [Google Scholar] [CrossRef] [Green Version]
  5. Zhao, Y.; Tang, Z.; Nan, X.; Sun, F.; Xiong, B. Effects of Lonicera japonica extract on performance, blood biomarkers of inflammation and oxidative stress during perinatal period in dairy cows. Asian-Australas. J. Anim. Sci. 2019, 33, 1096. [Google Scholar] [CrossRef] [Green Version]
  6. Fan, H.; Li, D.; Guan, X.; Yang, Y.; Yan, J.; Shi, J.; Ma, R.; Shu, Q. MsrA suppresses inflammatory activation of microglia and oxidative stress to prevent demyelination via inhibition of the NOX2-MAPKs/NF-kappaB signaling pathway. Drug Des. Dev. Ther. 2020, 14, 1377–1389. [Google Scholar] [CrossRef] [Green Version]
  7. Federico, A.; Morgillo, F.; Tuccillo, C.; Ciardiello, F.; Loguercio, C. Chronic inflammation and oxidative stress in human carcinogenesis. Int. J. Cancer 2010, 121, 2381–2386. [Google Scholar] [CrossRef]
  8. Rajkumar, K.; Bhattacharya, A.; David, S.; Balaji, S.H.; Hariharan, R.; Jayakumar, M.; Balaji, N. Socio-demographic study on extent of knowledge, awareness, attitude, and risks of zoonotic diseases among livestock owners in Puducherry region. Vet. World 2016, 9, 1018–1024. [Google Scholar] [CrossRef] [Green Version]
  9. Mazzoli, A.; Donadio, G.; Lanzilli, M.; Saggese, A.; Isticato, R. Bacillus megaterium SF185 spores exert protective effects against oxidative stress in vivo and in vitro. Sci. Rep. 2019, 9, 12082. [Google Scholar] [CrossRef] [Green Version]
  10. Sadat, A.; Shata, R.R.; Farag, A.M.; Ramadan, H.; Alkhedaide, A.; Soliman, M.M.; Elbadawy, M.; Abugomaa, A.; Awad, A. Prevalence and characterization of PVL-positive staphylococcus aureus isolated from raw cow’s milk. Toxins 2022, 14, 97. [Google Scholar] [CrossRef]
  11. Lindberg, J.E. Fiber effects in nutrition and gut health in pigs. J. Anim. Sci. Biotechnol. 2014, 5, 15. [Google Scholar] [CrossRef] [PubMed]
  12. Kurjogi, M.; Mohammad, Y.; Alghamdi, S.; Abdelrahman, M.; Jogaiah, S. Detection and determination of stability of the antibiotic residues in cow’s milk. PLoS ONE 2019, 14, e0223475. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, Z.W.; Li, X.X.; Zhang, L.Y.; Wu, J.P.; Zhao, S.G.; Jiao, T. Effect of oregano oil and cobalt lactate on sheep in vitro digestibility, fermentation characteristics and rumen microbial community. Animals 2022, 12, 118. [Google Scholar] [CrossRef] [PubMed]
  14. Zhuang, Y.; Wu, H.; Wang, X.; He, J.; Yin, Y. Resveratrol attenuates oxidative stress-induced intestinal barrier injury through PI3K/Akt-Mediated Nrf2 signaling pathway. Oxid. Med. Cell. Longev. 2019, 2019, 7591840. [Google Scholar] [CrossRef] [Green Version]
  15. Jiang, Z.; Zhao, M.; Zhang, H.; Li, Y.; Liu, M.; Feng, F. Antimicrobial emulsifier-glycerol monolaurate induces metabolic syndrome, gut microbiota dysbiosis and systemic low-grade inflammation in low-fat diet fed mice. Mol. Nutr. Food Res. 2018, 62, 1700547. [Google Scholar] [CrossRef]
  16. Schlievert, P.M.; Kilgore, S.H.; Seo, K.S.; Leung, D. Glycerol monolaurate contributes to the antimicrobial and anti-inflammatory activity of human milk. Sci. Rep. 2019, 9, 14550. [Google Scholar] [CrossRef] [Green Version]
  17. Welch, J.L.; Xiang, J.; Okeoma, C.M.; Schlievert, P.M.; Stapleton, J.T. Glycerol monolaurate, an analogue to a factor secreted by Lactobacillus, is virucidal against enveloped viruses, including HIV-1. mBio 2020, 11, e00686-20. [Google Scholar] [CrossRef]
  18. Seleem, D.; Chen, E.; Benso, B.; Pardi, V.; Murata, R.M. In vitro evaluation of antifungal activity of monolaurin against Candida albicans biofilms. Peer J. 2016, 4, e2148. [Google Scholar] [CrossRef] [Green Version]
  19. Zhang, H.; Wei, H.; Cui, Y.; Zhao, G.; Feng, F. Antibacterial interactions of monolaurin with commonly used antimicrobials and food components. J. Food Sci. 2009, 74, 418–427. [Google Scholar] [CrossRef]
  20. Zhu, Z.K.; Tan, Z.H.; Wang, S.J.; Ning, N.; Wang, M.L.; Wang, L. Effects of glycerol monolaurate on antioxidant function and lipid metabolism gene expression in liver of piglets infected with porcine epidemic diarrhea virus. Chin. J. Anim. Sci. 2022, 58, 209–213. [Google Scholar]
  21. Kong, L.; Wang, Z.; Xiao, C.; Zhu, Q.; Song, Z. Glycerol monolaurate ameliorated intestinal barrier and immunity in broilers by regulating intestinal inflammation, antioxidant balance, and intestinal microbiota. Front. Immunol. 2021, 12, 3913. [Google Scholar] [CrossRef] [PubMed]
  22. Valentini, J.; Silva, A.; Fortuoso, B.F.; Reis, J.H.; Tavernari, F.C. Chemical composition, lipid peroxidation, and fatty acid profile in meat of broilers fed with glycerol monolaurate additive. Food Chem. 2020, 330, 127187. [Google Scholar] [CrossRef] [PubMed]
  23. Zhao, M.; Cai, H.; Liu, M.; Deng, L.; Li, Y.; Zhang, H.; Feng, F. Effects of dietary glycerol monolaurate on productive performance, egg quality, serum biochemical indices, and intestinal morphology of laying hens. J. Zhejiang Univ. Sci. B 2019, 20, 877. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, H.Z.; Li, X.L.; Ma, T.; Ding, H.B. Effects of monoglyceride laurate supplementation on growthperformance serum biochemical indexes and antioxidant capacity of weaned lambs. Chin. J. Anim. Nutr. 2021, 33, 6593–6600. [Google Scholar]
  25. Wang, Y.; Zhang, C.; Li, Y.; Zhang, H.; Wang, J.; Feng, F. Effects of dietary glycerol monolaurate on the growth performance, digestive enzymes, body composition and non-specific immune response of white shrimp (Litopenaeus vannamei). Aquacult. Rep. 2020, 18, 100535. [Google Scholar] [CrossRef]
  26. Wang, Y.; Zhong, H.; Wang, J.; Feng, F. Dietary glycerol monolaurate improved the growth, activity of digestive enzymes and gut microbiota in zebrafish (Danio rerio). Aquacult. Rep. 2021, 20, 100670. [Google Scholar] [CrossRef]
  27. Wang, Y.C.; Du, J.; Li, Y.; Zhang, H.; Feng, F.Q. Effects of glycerol monolaurate on growth, health and nutritional quality ofchinese soft-shelled turtle (Pelodiscus sinensis). Chin. J. Anim. Nutr. 2019, 31, 428–436. [Google Scholar]
  28. AOAC. Official Methods of Analysis of AOAC International, 16th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1995; Volume 2. [Google Scholar]
  29. Ray, G.W.; Liang, D.; Yang, Q.; Tan, B.; Li, R. Effects of replacing fishmeal with dietary soybean protein concentrate (SPC) on growth, serum biochemical indices, and antioxidative functions for juvenile shrimp Litopenaeus vannamei. Aquaculture 2019, 516, 734630. [Google Scholar] [CrossRef]
  30. Lin, H.; Ding, M.; Ray, G.W.; Tan, B.; Yang, Q. Vitamin D promotes growth, feed utilization and gene expression related to lipid metabolism for juvenile orange-spotted grouper Epinephelus coioides. Aquacult. Rep. 2022, 23, 101074. [Google Scholar] [CrossRef]
  31. Yang, Q.; Ding, M.; Tan, B.; Dong, X.; Chi, S.; Shuang, Z.; Liu, H. Effects of dietary vitamin A on growth, feed utilization, lipid metabolism enzyme activities, and fatty acid synthase and hepatic lipase mRNA expression levels in the liver of juvenile orange spotted grouper, Epinephelus coioides. Aquaculture 2017, 479, 501–507. [Google Scholar] [CrossRef]
  32. He, Y.; Guo, X.; Tan, B.; Dong, X.; Yang, Q.; Liu, H.; Zhang, S.; Chi, S. Partial fishmeal protein replacement with peptides from swine blood modulates the nutritional status, immune response, and intestinal microbiota of hybrid groupers (female Epinephelus fuscoguttatus × male E. lanceolatus). Aquaculture 2021, 533, 736154. [Google Scholar]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [PubMed]
  34. Welker, A.F.; Campos, E.G.; Cardoso, L.A.; Hermes-Lima, M. Role of catalase on the hypoxia/reoxygenation stress in the hypoxia-tolerant Nile tilapia. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 302, R1111. [Google Scholar] [PubMed] [Green Version]
  35. Kong, S.Z.; Li, J.C.; Li, S.D.; Liao, M.N.; Li, C.P.; Zheng, P.J.; Guo, M.H.; Tan, W.X.; Zheng, Z.H.; Zhang, H. Anti-Aging Effect of chitosan oligosaccharide on d-galactose-induced subacute aging in mice. Mar. Drugs 2018, 16, 181. [Google Scholar]
  36. Qian, X.; Zhu, F. Use of glycerol monolaurate as a treatment against white spot syndrome virus in crayfish (Procambarus clarkii). Aquaculture 2021, 541, 736853. [Google Scholar]
  37. Liu, M.; Chen, X.; Zhao, H.; Feng, F. Effect of dietary supplementation with glycerol monolaurate on growth performance, digestive ability and chicken nutritional components of broilers. Food Sci. 2018, 39, 67–71. [Google Scholar]
  38. Sun, C.Y.; Dong, H.B.; Wang, W.H.; Li, Y.; Gu, Q.H.; Duan, Y.F.; Zhang, G.S.; Xu, X.D. Effects of glycerol monolaurate on lipid metabolism of Lateolabrax maculatus. South China Fish. Sci. 2021, 17, 67–75. [Google Scholar]
  39. Famurewa, A.C.; Aja, P.M.; Maduagwuna, E.K.; Ekeleme-Egedigwe, C.A.; Ufebe, O.G.; Azubuike-Osu, S.O. Antioxidant and anti-inflammatory effects of virgin coconut oil supplementation abrogate acute chemotherapy oxidative nephrotoxicity induced by anticancer drug methotrexate in rats. Biomed. Pharm. 2017, 96, 905–911. [Google Scholar]
  40. Jack, O. New insights into the utilization of medium-chain triglycerides by the neonate: Observations from a piglet model. J. Nutr. 1997, 127, 1061–1067. [Google Scholar]
  41. An, Y.; Cui, B.; Wang, Y.; Jin, W.; Geng, X.; Yan, X.; Li, B. Functional properties of ovalbumin glycosylated with carboxymethyl cellulose of different substitution degree. Food Hydrocoll. 2014, 40, 1–8. [Google Scholar]
  42. Zhang, T.; Niu, Q.; Wang, T.; Zheng, X.; Li, H.; Gao, X.; Chen, Y.; Gao, H.; Zhang, L.; Liu, G.E. Comparative transcriptomic analysis reveals diverse expression pattern underlying fatty acid composition among different beef cuts. Foods 2022, 11, 117. [Google Scholar] [CrossRef] [PubMed]
  43. Jiang, H.Q. The Effect of Glycerol Monolaurate on Growth, Health and Food Quality of Cultured Large Yellow Croaker. Master’s Thesis, Zhejiang University, Hangzhou, China, 2021. [Google Scholar]
  44. Kim, K.S.; Oh, D.H.; Kim, J.Y.; Lee, B.G.; You, J.S.; Chang, K.J.; Chung, H.; Yoo, M.C.; Yang, H.-I.; Kang, J.-H. Taurine ameliorates hyperglycemia and dyslipidemia by reducing insulin resistance and leptin level in otsukal ong-evans tokushima fatty (OLETF) rats with long-term diabetes. Exp. Mol. Med. 2012, 44, 665–673. [Google Scholar] [CrossRef] [PubMed]
  45. Tyra, M. The effect of replacement of soybean meal with corn dried distillers grains with solubles (cddgs) and differentiation of dietary fat sources on pig meat quality and fatty acid profile. Animals 2021, 11, 1277. [Google Scholar]
  46. Cui, Z.; Wang, X.; Hou, Z.; Liao, S.; Tan, B. Low-protein diet supplemented with medium-chain fatty acid glycerides improves the growth performance and intestinal function in post-weaning piglets. Animals 2020, 10, 1852. [Google Scholar] [CrossRef] [PubMed]
  47. Chang, P.C. Personalised medicine in child and Adolescent Psychiatry: Focus on omega-3 polyunsaturated fatty acids and ADHD. Brain Behav. Immun.-Health 2021, 16, 100310. [Google Scholar] [CrossRef]
  48. Huang, C.B.; George, B.; Ebersole, J.L. Antimicrobial activity of n-6, n-7 and n-9 fatty acids and their esters for oral microorganisms. Arch. Oral Biol. 2010, 55, 555–560. [Google Scholar] [CrossRef] [Green Version]
  49. Zhang, X.; Ning, X.; He, X.; Sun, X.; Wu, Y. Fatty acid composition analyses of commercially important fish species from the Pearl River Estuary, China. PLoS ONE 2020, 15, e0228276. [Google Scholar] [CrossRef] [Green Version]
  50. Halade, G.V.; Norris, P.C.; Kain, V.; Serhan, C.N.; Ingle, K.A. Splenic leukocytes define the resolution of inflammation in heart failure. Sci. Signal. 2018, 11, eaao1818. [Google Scholar] [CrossRef] [Green Version]
  51. Schlievert, P.M.; Peterson, M.L. Glycerol monolaurate antibacterial activity in broth and biofilm cultures. PLoS ONE 2012, 7, e40350. [Google Scholar] [CrossRef] [Green Version]
  52. Liu, Z.; Huang, W.; Chen, Y.; Du, Z.; Zhu, F.; Wang, T.; Jiang, B. Ischemic postconditioning ameliorates acute kidney injury induced by limb ischemia/reperfusion via transforming TLR4 and NF-kappaB signaling in rats. J. Orthop. Surg. Res. 2021, 16, 416. [Google Scholar] [CrossRef]
  53. Martinez, J.; Huang, X.; Yang, Y. Direct TLR2 signaling is critical for NK cell activation and function in response to vaccinia viral infection. PLoS Pathog. 2010, 6, e1000811. [Google Scholar] [CrossRef] [PubMed]
  54. Yang, H.; Wu, L.; Deng, H.; Chen, Y.; Zhou, H.; Liu, M.; Wang, S.; Zheng, L.; Zhu, L.; Lv, X. Anti-inflammatory protein TSG-6 secreted by bone marrow mesenchymal stem cells attenuates neuropathic pain by inhibiting the TLR2/MyD88/NF-kappaB signaling pathway in spinal microglia. J. Neuroinflamm. 2020, 17, 154. [Google Scholar] [CrossRef] [PubMed]
  55. Zhao, M.; Jiang, Z.; Cai, H.; Li, Y.; Feng, F. Modulation of the gut microbiota during high-dose glycerol monolaurate-mediated amelioration of obesity in mice fed a high-fat diet. mBio 2020, 11, e00190-20. [Google Scholar] [CrossRef]
  56. Wei, H.; Li, R.; Yang, Q.; Tan, B.; Ray, G.W.; Dong, X.; Chi, S.; Liu, H.; Zhang, S. Effects of Zn on growth performance, immune enzyme activities, resistance to disease and intestinal flora for juvenile pearl gentian grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀) under low fishmeal diet. Aquacult. Rep. 2021, 21, 100880. [Google Scholar] [CrossRef]
  57. Bao, J.; Li, X.; Xing, Y.; Feng, C.; Jiang, H. Effects of hypoxia on immune responses and carbohydrate metabolism in the Chinese mitten crab, Eriocheir sinensis. Aquacult. Res. 2020, 51, 2735–2744. [Google Scholar] [CrossRef]
  58. Zhu, L.Y.; Nie, L.; Zhu, G.; Xiang, L.X.; Shao, J.Z. Advances in research of fish immune-relevant genes: A comparative overview of innate and adaptive immunity in teleosts. Dev. Comp. Immunol. 2013, 39, 39–62. [Google Scholar] [CrossRef] [PubMed]
  59. Bergsson, G.; Steingrímsson, Ó.; Thormar, H. Bactericidal effects of fatty acids and monoglycerides on Helicobacter pylori. Int. J. Antimicrob. Agents 2002, 20, 258–262. [Google Scholar] [CrossRef]
  60. Peterson, M.L.; Schlievert, P.M. Glycerol monolaurate inhibits the effects of Gram-positive select agents on eukaryotic cells. Biochemistry 2006, 45, 2387–2397. [Google Scholar] [CrossRef] [Green Version]
  61. Schlievert, P.M.; Strandberg, K.L.; Brosnahan, A.J.; Peterson, M.L.; Pambuccian, S.E.; Nephew, K.R.; Brunner, K.G.; Schultz-Darken, N.J.; Haase, A.T. Glycerol monolaurate does not alter rhesus macaque (Macaca mulatta) vaginal lactobacilli and is safe for chronic use. Antimicrob. Agents Chemother. 2008, 52, 4448–4454. [Google Scholar] [CrossRef] [Green Version]
  62. Zhou, L.; Zeng, Y.; Zhang, H.; Ma, Y. The role of gastrointestinal microbiota in functional dyspepsia: A review. Front. Physiol. 2022, 13, 910568. [Google Scholar] [CrossRef]
  63. Kolba, N.; Zarei, A.; Cheng, J.; Agarwal, N.; Dadmohammadi, Y.; Khazdooz, L.; Abbaspourrad, A.; Tako, E. Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives. Nutrients 2022, 14, 3130. [Google Scholar] [CrossRef] [PubMed]
  64. Alkushi, A.; Abdelfattah-Hassan, A.; Eldoumani, H.; Elazab, S.T.; Mohamed, S.A.; Metwally, A.S.; SEl-Shetry, E.; Saleh, A.A.; ElSawy, N.A.; Ibrahim, D. Probiotics-loaded nanoparticles attenuated colon inflammation, oxidative stress, and apoptosis in colitis. Sci. Rep. 2022, 12, 5116. [Google Scholar] [CrossRef] [PubMed]
  65. Dong, S.; Xu, S.; Zhang, J.; Hussain, R.; Lu, H.; Ye, Y.; Mehmood, K.; Zhang, H.; Shang, P. First report of fecal microflora of wild bar-headed goose in Tibet Plateau. Front. Vet. Sci. 2021, 8, 791461. [Google Scholar] [CrossRef] [PubMed]
  66. Ilinskaya, O.N.; Ulyanova, V.V.; Yarullina, D.R.; Gataullin, I.G. Secretome of intestinal Bacilli: A natural guard against pathologies. Front. Microbiol. 2017, 8, 1666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Kuebutornye, F.K.A.; Abarike, E.D.; Lu, Y. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol. 2019, 87, 820–828. [Google Scholar]
  68. Cha, J.H.; Rahimnejad, S.; Yang, S.Y.; Kim, K.W.; Lee, K.J. Evaluations of Bacillus spp. as dietary additives on growth performance, innate immunity and disease resistance of olive flounder (Paralichthys olivaceus) against Streptococcus iniae and as water additives. Aquaculture 2013, 402–403, 50–57. [Google Scholar] [CrossRef]
  69. Aly, S.M.; Abdel-Galil Ahmed, Y.; Abdel-Aziz Ghareeb, A.; Mohamed, M.F. Studies on Bacillus subtilis and Lactobacillus acidophilus, as potential probiotics, on the immune response and resistance of Tilapia nilotica (Oreochromis niloticus) to challenge infections. Fish Shellfish Immunol. 2008, 25, 128–136. [Google Scholar] [CrossRef]
  70. Tseng, D.Y.; Ho, P.L.; Huang, S.Y.; Cheng, S.C.; Shiu, Y.L.; Chiu, C.S.; Liu, C.H. Enhancement of immunity and disease resistance in the white shrimp, Litopenaeus vannamei, by the probiotic, Bacillus subtilis E20. Fish Shellfish Immunol. 2009, 26, 339–344. [Google Scholar] [CrossRef]
  71. Yu, J.F.; Xia, B.H.; Hao, Q.R.; Zou, H.B.; Wang, P.; Chen, Z.X.; Gao, L.; Wu, S.; Huang, L.; Qin, D.L.; et al. Screening, identification and culture medium optimization of a hypoglycemic Lysinibacillus fusiformis strain from common carp. J. Dalian Ocean Univ. 2022, 37, 611–619. [Google Scholar]
  72. Guan, L.P.; Xie, J.J.; Li, W.H.; Chen, H.L.; Wen, Z.Z.; Sun, C.B. Effects of a Lysinibacillus strain on the growth and water quality of Litopenaeus Vannamei. Fish. Mod. 2022, 49, 1–7. [Google Scholar]
  73. Saratale, R.G.; Cho, S.K.; Saratale, G.D.; Ghodake, G.S.; Bharagava, R.N.; Kim, D.S.; Nair, S.; Shin, H.S. Efficient bioconversion of sugarcane bagasse into polyhydroxybutyrate (PHB) by Lysinibacillus sp. and its characterization. Bioresour. Technol. 2021, 324, 124673. [Google Scholar] [CrossRef] [PubMed]
  74. Asif, T.; Javed, U.; Zafar, S.B.; Ansari, A.; Ul Qader, S.A.; Aman, A. Bioconversion of colloidal chitin using novel chitinase from glutamicibacter uratoxydans exhibiting anti-fungal potential by hydrolyzing chitin within fungal cell wall. Waste Biomass Valorization 2019, 11, 4129–4143. [Google Scholar] [CrossRef]
  75. Breuil, C.; Kushner, D.J. Lipase and esterase formation by psychrophilic and mesophilic Acinetobacter species. Can. J. Microbiol. 1975, 21, 423–433. [Google Scholar] [CrossRef] [PubMed]
  76. Kim, D.H.; Park, Y.H.; Lee, J.S.; Jeong, H.I.; Lee, K.W.; Kang, T.H. Anti-obesity effect of DKB-117 through the inhibition of pancreatic lipase and alpha-amylase activity. Nutrients 2020, 12, 3053. [Google Scholar] [CrossRef]
Metabolites 12 01089 g001 550
Figure 1. Effects of dietary GML levels on growth performance for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). (A) FBW: weight body weight. (B) WGR: weight gain rate. (C) SR: survival rate.
Figure 1. Effects of dietary GML levels on growth performance for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). (A) FBW: weight body weight. (B) WGR: weight gain rate. (C) SR: survival rate.
Metabolites 12 01089 g001
Metabolites 12 01089 g002 550
Figure 2. Effects of dietary GML levels on relative expressions of TLR2, myd88, TL-1β, IL10, and IL8 in head kidney inflammatory factors genes in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). TLR2: toll-like receptor 2; myd88: myeloid differentiation primary response gene 88; IL-1β: interleukin 1β; IL10: interleukin 10; IL8: interleukin 8.
Figure 2. Effects of dietary GML levels on relative expressions of TLR2, myd88, TL-1β, IL10, and IL8 in head kidney inflammatory factors genes in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). TLR2: toll-like receptor 2; myd88: myeloid differentiation primary response gene 88; IL-1β: interleukin 1β; IL10: interleukin 10; IL8: interleukin 8.
Metabolites 12 01089 g002
Metabolites 12 01089 g003 550
Figure 3. Effects of dietary GML levels on survival rate in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values had different letters are significantly different (p < 0.05).
Figure 3. Effects of dietary GML levels on survival rate in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values had different letters are significantly different (p < 0.05).
Metabolites 12 01089 g003
Metabolites 12 01089 g004 550
Figure 4. Effects of dietary GML levels on liver MDA (A), SOD (B) and LZM (C) activities in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). LZM: lysozyme. SOD: superoxide dismutase. MDA: malondialdehyde.
Figure 4. Effects of dietary GML levels on liver MDA (A), SOD (B) and LZM (C) activities in bacterial challenge test for juvenile grouper. Data represent means of three tanks in each group; error bar indicates S.D. Values with different letters are significantly different (p < 0.05). LZM: lysozyme. SOD: superoxide dismutase. MDA: malondialdehyde.
Metabolites 12 01089 g004
Metabolites 12 01089 g005 550
Figure 5. Effects of dietary GML levels on relative abundance of species at phylum (A) and genus (B) levels for juvenile grouper.
Figure 5. Effects of dietary GML levels on relative abundance of species at phylum (A) and genus (B) levels for juvenile grouper.
Metabolites 12 01089 g005
Metabolites 12 01089 g006 550
Figure 6. Effects of dietary GML levels on (A) Shannon and (B) Simpson indices for juvenile grouper.
Figure 6. Effects of dietary GML levels on (A) Shannon and (B) Simpson indices for juvenile grouper.
Metabolites 12 01089 g006
Metabolites 12 01089 g007 550
Figure 7. The association analysis of dietary GML and grouper intestinal flora genus. * represents significant difference, p < 0.05; ** represents highly significant difference, p < 0.01.
Figure 7. The association analysis of dietary GML and grouper intestinal flora genus. * represents significant difference, p < 0.05; ** represents highly significant difference, p < 0.01.
Metabolites 12 01089 g007
Table
Table 1. Ingredients and chemical compositions of experimental diets (% DM basis).
Table 1. Ingredients and chemical compositions of experimental diets (% DM basis).
Groups
G0G600G1200G1800G2400G3000G3600
Brown fish meal30.00 30.00 30.00 30.00 30.00 30.00 30.00
American soybean meal18.00 18.00 18.00 18.00 18.00 18.00 18.00
Corn gluten meal9.50 9.50 9.50 9.50 9.50 9.50 9.50
Peanut meal10.00 10.00 10.00 10.00 10.00 10.00 10.00
Chicken powder6.00 6.006.00 6.00 6.00 6.00 6.00
Wheat flour18.59 18.5918.59 18.59 18.59 18.59 18.59
fish oil2.00 2.00 2.00 2.00 2.00 2.00 2.00
Soybean oil2.00 2.00 2.00 2.00 2.00 2.00 2.00
Soybean lecithin1.00 1.00 1.00 1.00 1.00 1.00 1.00
Ca(H2PO4)2 1.00 1.00 1.00 1.00 1.00 1.00 1.00
Premix1.00 1.00 1.00 1.00 1.00 1.00 1.00
Choline chloride0.50 0.50 0.50 0.50 0.50 0.50 0.50
vitamin C0.05 0.05 0.05 0.05 0.05 0.05 0.05
Microcrystalline cellulose0.36 0.30 0.24 0.18 0.12 0.06 0.00
GML0.00 0.06 0.12 0.18 0.24 0.30 0.36
Total100.00 100.00 100.00 100.00 100.00 100.00 100.00
Nutrient levels
Crude protein49.74 49.19 49.65 49.66 49.19 49.32 49.40
Crude lipid9.42 9.46 9.38 9.37 9.28 9.29 9.18
Premix (g/kg premix): vitamin A (675,000 IU), vitamin D3 (180,000 IU), vitamin E (6000 mg), vitamin K3 (1200 mg), vitamin B1 (900 mg), vitamin B2 (1350 mg), vitamin B6 (1050 mg), vitamin B12 (7.5 mg), calcium pantothenate (4500 mg), nicotinic acid (6750 mg), folic acid (375 mg), biotin (15 mg), vitamin C phosphate (42,860 mg), inositol (10,000 mg), FeSO4·H2O (64,286 mg), ZnSO4·H2O (26,283 mg), MnSO4·H2O (19,688 mg), Ca (IO3)2·H2O (128.6 mg), CoCl2·6H2O (323 mg), CuSO4·5H2O (2357 mg), Na2SeO3 (87.6 mg).
Table
Table 2. Primers pair sequences for real-time qPCR.
Table 2. Primers pair sequences for real-time qPCR.
Nucleotide Sequence (5′–3′)Genbank Accession No.
β-actinF: GATCTGGCATCACACCTTCT
R: CATCTTCTCCCTGTTGGCTT		AY510710.2
TLR2F: AGGGTTCAGAAGGGTTGCTAT
R: CAGGAAGGAAGTCCCGTTTGT		HM357230.1
myd88F: AGCTGGAGCAGACGGAGTG
R: GAGGCTGAGAGCAAACTTGGTC		JF271883.1
IL-1βF: AACCTCATCATCGCCACACA
R: AGTTGCCTCACAACCGAACAC		XP_049460451.1
IL-10F: ACACAGCGCTGCTAGACGAG
R: GGGCAGCACCGTGTTCAGAT		KJ741852.1
IL8F: GGCCGTCAGTGAAGGGAGTC
R: TCAGAGTGGCAATGATCTCA		GU988706.1
TLR2: toll-like receptor 2; myd88: myeloid differentiation primary response gene 88; IL-1β: interleukin 1β; IL10: interleukin 10; IL8: interleukin 8.
Table
Table 3. Effects of dietary GML levels on antioxidant index of juvenile grouper.
Table 3. Effects of dietary GML levels on antioxidant index of juvenile grouper.
G0G600G1200G1800G2400G3000G3600
Liver
MDA/nmol/mL1.57 ± 0.26 d1.27 ± 0.21 bc1.08 ± 0.02 b0.86 ± 0.11 a1.28 ± 0.01 bc1.40 ± 0.01 cd1.14 ± 0.13 c
SOD/U/mL 16.91 ± 0.46 a17.31 ± 0.31 a22.04 ± 0.42 c26.01 ± 0.73 d23.54 ± 1.14 cd21.38 ± 4.01 b18.64 ± 1.57 ab
CAT/U/mL8.29 ± 1.159.37 ± 0.1110.19 ± 1.499.64 ± 0.799.31 ± 0.519.51 ± 0.978.84 ± 0.50
GSH-Px/U/mL94.56 ± 12.43 a94.90 ± 13.80 a96.16 ± 5.01 ab113.53 ± 3.60 c108.86 ± 7.95 c106.96 ± 7.04 bc97.64 ± 8.87 ab
Serum
MDA/nmol/mL1.66 ± 0.13 e1.73 ± 0.07 e1.12 ± 0.17 c0.79 ± 0.07 a1.00 ± 0.11 bc0.91 ± 0.11 ab1.36 ± 0.07 d
SOD/U/mL 8.61 ± 0.56 a13.33 ± 1.94 b13.62 ± 2.12 b17.14 ± 0.67 c17.95 ± 1.71 c15.74 ± 2.34 bc17.01 ± 3.03 c
Data are means ± SEM of three replicates (n = 3). Values within the same line with different superscripts are significantly different (p < 0.05). MDA: malondialdehyde; CAT: catalase; GSH-Px: glutathione catalase; SOD: superoxide dismutase.
Table
Table 4. Effects of dietary GML levels on fatty acid composition of juvenile grouper (%).
Table 4. Effects of dietary GML levels on fatty acid composition of juvenile grouper (%).
G0G600G1200G1800G2400G3000G3600
C12:00.00 ± 0.00 a0.27 ± 0.01 b0.61 ± 0.01 c0.75 ± 0.04 d0.83 ± 0.01 e1.25 ± 0.12 f1.37 ± 0.03 g
C14:02.56 ± 0.07 a2.77 ± 0.00 bc2.68 ± 0.08 ab2.70 ± 0.25 ab2.94 ± 0.01 c2.94 ± 0.01 c2.78 ± 0.02 bc
C16:019.87 ± 0.16 b20.41 ± 0.09 c19.73 ± 0.08 b19.11 ± 0.05 a20.48 ± 0.32 c20.36 ± 0.21 c19.81 ± 0.07 b
C16:1n72.85 ± 0.03 a3.41 ± 0.02 f3.04 ± 0.02 c2.95 ± 0.03 b3.29 ± 0.02 e3.24 ± 0.02 d3.03 ± 0.03 c
C17:00.35 ± 0.01 b0.35 ± 0.01 b0.39 ± 0.01 c0.41 ± 0.01 c0.40 ± 0.01 c0.41 ± 0.02 c0.29 ± 0.03 a
C18:08.18 ± 0.13 f6.89 ± 0.03 a7.77 ± 0.09 e7.45 ± 0.03 c7.25 ± 0.04 b7.74 ± 0.04 e7.62 ± 0.01 d
C18:1n9c17.84 ± 0.28 a19.94 ± 0.14 e18.91 ± 0.03 d18.63 ± 0.06 bc19.11 ± 0.13 d18.62 ± 0.26 bc18.32 ± 0.06 b
C18:2n6c24.09 ± 0.08 c25.25 ± 0.10 e24.98 ± 0.05 d25.30 ± 0.08 e23.91 ± 0.22 bc23.14 ± 0.14 a23.79 ± 0.21 b
C18:3n30.00 ± 0.00 a3.98 ± 0.14 c3.54 ± 0.04 b3.55 ± 0.03 b0.00 ± 0.00 a0.00 ± 0.00 a0.00 ± 0.00 a
C20:00.45 ± 0.01 e0.31 ± 0.00 abc0.33 ± 0.02 bcd0.30 ± 0.01 ab0.34 ± 0.02 cd0.34 ± 0.01 d0.29 ± 0.02 a
C20:13.32 ± 0.04 b0.00 ± 0.00 a0.00 ± 0.00 a0.00 ± 0.00 a3.56 ± 0.02 d3.50 ± 0.06 d3.42 ± 0.07 c
C20:23.32 ± 0.04 b0.00 ± 0.00 c0.00 ± 0.00 d0.00 ± 0.00 e3.56 ± 0.02 a3.50 ± 0.06 bc3.42 ± 0.07 d
C20:3n60.34 ± 0.01 d0.23 ± 0.02 b0.28 ± 0.03 c0.26 ± 0.01 c0.28 ± 0.01 c0.38 ± 0.01 e0.20 ± 0.01 a
C20:4n61.31 ± 0.04 e1.02 ± 0.02 ab1.04 ± 0.04 abc1.09 ± 0.03 e0.99 ± 0.06 a1.10 ± 0.01 c1.17 ± 0.05 d
C20:5n36.12 ± 0.10 d5.80 ± 0.02 b5.58 ± 0.04 a5.96 ± 0.07 bc5.90 ± 0.04 bc5.89 ± 0.04 bc6.11 ± 0.06 d
C22:00.45 ± 0.00 d0.30 ± 0.02 b0.38 ± 0.03 c0.32 ± 0.01 c0.31 ± 0.02 b0.34 ± 0.02 b0.24 ± 0.01 a
C22:1n90.36 ± 0.01 bc0.39 ± 0.00 c0.35 ± 0.03 b0.37 ± 0.03 bc0.31 ± 0.01 a0.34 ± 0.02 ab0.35 ± 0.02 b
C22:6n38.92 ± 0.14 c7.50 ± 0.13 a8.39 ± 0.05 b9.23 ± 0.08 d8.86 ± 0.02 c8.92 ± 0.14 c9.62 ± 0.20 e
C24:1n90.87 ± 0.07 d0.53 ± 0.03 a1.08 ± 0.03 e0.59 ± 0.03 ab0.62 ± 0.02 bc0.68 ± 0.06 c0.66 ± 0.06 bc
∑SFA31.86 ± 0.21 b31.29 ± 0.08 a31.88 ± 0.11 b31.04 ± 0.16 a32.56 ± 0.31 c33.38 ± 0.18 d32.41 ± 0.08 c
∑n-315.04 ± 0.12 b17.28 ± 0.02 d17.51 ± 0.09 d18.74 ± 0.16 e14.75 ± 0.05 a14.81 ± 0.19 ab15.73 ± 0.24 c
∑n-625.74 ± 0.12 c26.49 ± 0.07 de26.30 ± 0.08 d26.65 ± 0.06 e25.19 ± 0.27 b24.62 ± 0.13 a25.15 ± 0.19 b
∑n-3/∑n-60.58 ± 0.00 a0.65 ± 0.00 d0.67 ± 0.00 d0.70 ± 0.01 e0.59 ± 0.01 a0.60 ± 0.01 b0.63 ± 0.01 c
SFA: saturated fatty acid; n-3: n-3 polyunsaturated fatty acids; n-6: n-6 polyunsaturated fatty acids. Values within the same line with different superscripts are significantly different (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, X.; Yi, Y.; Wu, J.; Yang, Q.; Tan, B.; Chi, S. Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Metabolites 2022, 12, 1089. https://doi.org/10.3390/metabo12111089

AMA Style

Li X, Yi Y, Wu J, Yang Q, Tan B, Chi S. Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Metabolites. 2022; 12(11):1089. https://doi.org/10.3390/metabo12111089

Chicago/Turabian Style

Li, Xuehe, Yuanming Yi, Jiahua Wu, Qihui Yang, Beiping Tan, and Shuyan Chi. 2022. "Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂)" Metabolites 12, no. 11: 1089. https://doi.org/10.3390/metabo12111089

APA Style

Li, X., Yi, Y., Wu, J., Yang, Q., Tan, B., & Chi, S. (2022). Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Metabolites, 12(11), 1089. https://doi.org/10.3390/metabo12111089

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop