ATBF1 Participates in Dual Functions of TGF-β via Regulation of Gene Expression and Protein Translocalization
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents, Primers, and siRNAs
2.2. Cell Culture and TGF-β Treatment
2.3. RNA Interference (RNAi)
2.4. RNA Extraction, RT-PCR, and Real-Time qPCR
2.5. Wound-Healing Assay
2.6. Cell Proliferation Assay
2.7. Immunofluorescence Staining (IF Staining)
2.8. Statistical Analysis
3. Results
3.1. ATBF1 Expression was Down-Regulated during EMT Progression Induced by TGF-β
3.2. ATBF1 Expression Silencing Enhanced EMT Progression under Activation of TGF-β
3.3. ATBF1 Expression Silencing Enhanced Cell Migration under Activation of TGF-β
3.4. TGF-β Treatment Induced ATBF1 Translocalization from Cytoplasm to Nuclear
3.5. ATBF1 Expression Silencing Rescued Inhibition of Cell Proliferation Induced by TGF-β
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Groeneveldt, C.; Van Hall, T.; Van der Burg, S.H.; Dijke, P.T.; Van Montfoort, N. Immunotherapeutic Potential of TGF-β Inhibition and Oncolytic Viruses. Trends Immunol. 2020, 41, 406–420. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.Y.; Liu, X.S.; Huang, X.R.; Yu, X.Q.; Lan, H.Y. Diverse Role of TGF-beta in Kidney Disease. Front Cell Dev. Biol. 2020, 8, 123. [Google Scholar] [CrossRef] [PubMed]
- Parichatikanond, W.; Luangmonkong, T.; Mangmool, S.; Kurose, H. Therapeutic Targets for the Treatment of Cardiac Fibrosis and Cancer: Focusing on TGF-β Signaling. Front. Cardiovasc. Med. 2020, 7, 34. [Google Scholar] [CrossRef] [PubMed]
- Li, S.N.; Wu, J.F. TGF-beta/SMAD signaling regulation of mesenchymal stem cells in adipocyte commitment. Stem. Cell Res. Ther. 2020, 11, 41. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Shi, W. The concomitant apoptosis and EMT underlie the fundamental functions of TGF-beta. Acta Biochim. Biophys. Sin. 2018, 50, 91. [Google Scholar] [CrossRef] [PubMed]
- Colak, S.; Ten-Dijke, P. Targeting TGF-beta Signaling in Cancer. Trends Cancer 2017, 3, 56. [Google Scholar] [CrossRef] [PubMed]
- Huynh, L.K.; Hipolito, C.J.; Ten-Dijke, P. A Perspective on the Development of TGF-beta Inhibitors for Cancer Treatment. Biomolecules 2019, 9, 743. [Google Scholar] [CrossRef] [Green Version]
- Suriyamurthy, S.; Baker, D.; Ten-Dijke, P.; Iyengar, P.V. Epigenetic Reprogramming of TGF-beta Signaling in Breast Cancer. Cancers 2019, 11, 726. [Google Scholar] [CrossRef] [Green Version]
- Wu, F.; Weigel, K.J.; Zhou, H.; Wang, X.J. Paradoxical roles of TGF-beta signaling in suppressing and promoting squamous cell carcinoma. Acta Biochim. Biophys. Sin. 2018, 50, 98. [Google Scholar] [CrossRef] [Green Version]
- Luo, J.; Chen, X.-Q.; Li, P. The Role of TGF-β and Its Receptors in Gastrointestinal Cancers. Transl. Oncol. 2019, 12, 475–484. [Google Scholar] [CrossRef]
- Latifi, Z.; Nejabati, H.R.; Abroon, S.; Mihanfar, A.; Farzadi, L.; Hakimi, P.; Hajipour, H.; Nouri, M.; Fattahi, A. Dual role of TGF-beta in early pregnancy: Clues from tumor progression. Biol. Reprod. 2019, 100, 1417. [Google Scholar] [CrossRef] [PubMed]
- Tzavlaki, K.; Moustakas, A. TGF-beta Signaling. Biomolecules 2020, 10, 487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morinaga, T.; Yasuda, H.; Hashimoto, T.; Higashio, K.; Tamaoki, T. A human alpha-fetoprotein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. Mol. Cell. Boil. 1991, 11, 6041–6049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, X.-Y.; Sun, X.; Guo, P.; Li, Q.; Sasahara, M.; Ishii, Y.; Dong, J.-T. ATBF1 Inhibits Estrogen Receptor (ER) Function by Selectively Competing with AIB1 for Binding to the ER in ER-positive Breast Cancer Cells. J. Boil. Chem. 2010, 285, 32801–32809. [Google Scholar] [CrossRef] [Green Version]
- Jung, C.-G.; Kim, H.-J.; Kawaguchi, M.; Khanna, K.K.; Hida, H.; Asai, K.; Nishino, H.; Miura, Y. Homeotic factor ATBF1 induces the cell cycle arrest associated with neuronal differentiation. Development 2005, 132, 5137–5145. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Fu, X.; Li, J.; Xing, C.; Martin, D.W.; Zhang, H.H.; Chen, Z.; Dong, J.-T. Heterozygous deletion of Atbf1 by the Cre-loxP system in mice causes preweaning mortality. Genesis 2012, 50, 819–827. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Kim, T.-S.; Dong, Y.; Kanazawa, S.; Kawaguchi, M.; Gao, N.; Minato, H.; Takegami, T.; Nojima, T.; Asai, K.; et al. AT motif binding factor 1 (ATBF1) is highly phosphorylated in embryonic brain and protected from cleavage by calpain-1. Biochem. Biophys. Res. Commun. 2012, 427, 537–541. [Google Scholar] [CrossRef]
- Li, M.; Fu, X.; Ma, G.; Sun, X.; Dong, X.; Nagy, T.; Xing, C.; Li, J.; Dong, J.-T. Atbf1 Regulates Pubertal Mammary Gland Development Likely by Inhibiting the Pro-Proliferative Function of Estrogen-ER Signaling. PLoS ONE 2012, 7, 51283. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Frierson, H.F.; Chen, C.; Li, C.; Ran, Q.; Otto, K.B.; Cantarel, B.M.; Vessella, R.L.; Gao, A.C.; Petros, J.; et al. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer. Nat. Genet. 2005, 37, 407–412. [Google Scholar] [CrossRef]
- Zhong, L.; Chen, F.; Qiang, L.I.; Zou, Z.W.; Zheng, W.; Huang, Z.H.; Surgery, D.G. ATBF1 Expression and Correlation with Metastasis in Colorectal Cancer. J. Kunm. Med. Univ. 2014, 36, 957. [Google Scholar]
- Sakata, N.; Kaneko, S.; Ikeno, S.; Miura, Y.; Nakabayashi, H.; Dong, X.Y.; Dong, J.T.; Tamaoki, T.; Nakano, N.; Itoh, S. TGF-beta Signaling Cooperates with AT Motif-Binding Factor-1 for Repression of the alpha -Fetoprotein Promoter. J. Signal Transduct. 2014, 970346. [Google Scholar]
- Dong, X.-Y.; Guo, P.; Sun, X.; Li, Q.; Dong, J.-T. Estrogen Up-regulates ATBF1 Transcription but Causes Its Protein Degradation in Estrogen Receptor-α-positive Breast Cancer Cells. J. Boil. Chem. 2011, 286, 13879–13890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.; Zhao, D.; Ma, G.; Zhang, B.; Fu, X.; Zhu, Z.; Fu, L.; Sun, X.; Dong, J.-T. Upregulation of ATBF1 by progesterone-PR signaling and its functional implication in mammary epithelial cells. Biochem. Biophys. Res. Commun. 2013, 430, 358–363. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Ma, G.; Zhang, X.; He, Y.; Li, M.; Han, X.; Fu, L.; Dong, X.-Y.; Nagy, T.; Zhao, Q.; et al. Zinc Finger Homeodomain Factor Zfhx3 Is Essential for Mammary Lactogenic Differentiation by Maintaining Prolactin Signaling Activity. J. Boil. Chem. 2016, 291, 12809–12820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nishio, E.; Miura, Y.; Kawaguchi, M.; Morita, A. Nuclear translocation of ATBF1 is a potential prognostic marker for skin cancer. Acta Dermatovenerol. Croat. ADC 2012, 20, 239. [Google Scholar] [PubMed]
- Mabuchi, M.; Kataoka, H.; Miura, Y.; Kim, T.S.; Kawaguchi, M.; Ebi, M.; Tanaka, M.; Mori, Y.; Kubota, E.; Mizushima, T.; et al. Tumor suppressor, AT motif binding factor 1 (ATBF1), translocates to the nucleus with runt domain transcription factor 3 (RUNX3) in response to TGF-beta signal transduction. Biochem. Biophys. Res. Commun. 2010, 398, 321. [Google Scholar] [CrossRef]
- Sun, X.; Li, J.; Sica, G.; Fan, S.-Q.; Wang, Y.; Chen, Z.; Müller, S.; Chen, Z.; Fu, X.; Dong, X.-Y.; et al. Interruption of nuclear localization of ATBF1 during the histopathologic progression of head and neck squamous cell carcinoma. Head Neck 2012, 35, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
- Kawaguchi, M.; Hara, N.; Bilim, V.; Koike, H.; Suzuki, M.; Kim, T.-S.; Gao, N.; Dong, Y.; Zhang, S.; Fujinawa, Y.; et al. A diagnostic marker for superficial urothelial bladder carcinoma: Lack of nuclear ATBF1 (ZFHX3) by immunohistochemistry suggests malignant progression. BMC Cancer 2016, 16, 805–811. [Google Scholar] [CrossRef] [Green Version]
- Li, M.; Zhang, C.; Zhong, Y.; Zhao, J. Cellular localization of ATBF1 protein and its functional implication in breast epithelial cells. Biochem. Biophys. Res. Commun. 2017, 490, 492–498. [Google Scholar] [CrossRef]
- Li, M.; Zhang, C.; Li, X.; Lv, Z.; Chen, Y.; Zhao, J. Isoquercitrin promotes the osteogenic differentiation of osteoblasts and BMSCs via the RUNX2 or BMP pathway. Connect. Tissue Res. 2018, 60, 189–199. [Google Scholar] [CrossRef]
- Olsen, O.E.; Hella, H.; Elsaadi, S.; Jacobi, C.; Martinez-Hackert, E.; Holien, T. Activins as Dual Specificity TGF-beta Family Molecules: SMAD-Activation via Activin and BMP-Type 1 Receptors. Biomolecules 2020, 60, 519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, G.; Feng, W.; Wu, j. Down-regulation of SEPT9 inhibits glioma progression through suppressing TGF-beta-induced epithelial-mesenchymal transition (EMT). Biomed. Pharmacother. 2020, 125, 109768. [Google Scholar] [CrossRef] [PubMed]
- Ye, D.; Zhu, J.; Zhao, Q.; Ma, W.; Xiao, Y.; Xu, G.; Zhang, Z. LMP1 Up-regulates Calreticulin to Induce Epithelial-mesenchymal Transition via TGF-beta/Smad3/NRP1 Pathway in Nasopharyngeal Carcinoma Cells. J. Cancer 2020, 11, 1257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, S.; Yin, H.; Tong, H.; Zhan, K.; Yang, G.; Hossain, M.A.; Li, T.; Gou, X.; He, W. Nucleolar and Spindle Associated Protein 1 (NUSAP1) Promotes Bladder Cancer Progression Through the TGF-β Signaling Pathway. OncoTargets Ther. 2020, 13, 813–825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, Y.; Baker, D.; Ten-Dijke, P. TGF-beta-Mediated Epithelial-Mesenchymal Transition and Cancer Metastasis. Int. J. Mol. Sci. 2019, 20, 2767. [Google Scholar] [CrossRef] [Green Version]
- Ahel, J.; Hudorović, N.; Vičić-Hudorović, V.; Nikles, H. TGF-Beta in the Natural History of Prostate Cancer. Acta Clin. Croat. 2019, 58, 128–138. [Google Scholar] [CrossRef] [Green Version]
Gene | Sequence | Length (bps) | |
---|---|---|---|
ATBF1 (RT-PCR) | Forward | CATCAAGGAGGGCGGCAA | 300 |
Reverse | CTCTCGCTTCGCTGGTGCTT | ||
ATBF1 (real-time qPCR) | Forward | TGTTCCAGATCGAGATGGGAAT | 75 |
Reverse | CTTTCCCAGATCCTCTGAGGTTT | ||
E-cad | Forward | TGAAGGTGACAGAGCCTCTGGAT | 151 |
Reverse | TGGGTGAATTCGGGCTTGTT | ||
N-Cad | Forward | GACAATGCCCCTCAAGTGTT | 179 |
Reverse | CCATTAAGCCGAGTGATGGT | ||
c-myc | Forward | TCAAGAGGTGCCACGTCTCC | 80 |
Reverse | TCTTGGCAGCAGGATAGTCCTT | ||
GAPDH | Forward | GGTGGTCTCCTCTGACTTCAACA | 127 |
Reverse | GTTGCTGTAGCCAAATTCGTTGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Zhang, A.; Zheng, Y.; Li, J.; Zhao, J. ATBF1 Participates in Dual Functions of TGF-β via Regulation of Gene Expression and Protein Translocalization. Biomolecules 2020, 10, 807. https://doi.org/10.3390/biom10050807
Li M, Zhang A, Zheng Y, Li J, Zhao J. ATBF1 Participates in Dual Functions of TGF-β via Regulation of Gene Expression and Protein Translocalization. Biomolecules. 2020; 10(5):807. https://doi.org/10.3390/biom10050807
Chicago/Turabian StyleLi, Mei, Anqi Zhang, Yanan Zheng, Jiajing Li, and Jiyuan Zhao. 2020. "ATBF1 Participates in Dual Functions of TGF-β via Regulation of Gene Expression and Protein Translocalization" Biomolecules 10, no. 5: 807. https://doi.org/10.3390/biom10050807