Next Article in Journal
Exogenously Applied Gibberellic Acid Enhances Growth and Salinity Stress Tolerance of Maize through Modulating the Morpho-Physiological, Biochemical and Molecular Attributes
Next Article in Special Issue
Dnmt3b Deficiency in Myf5+-Brown Fat Precursor Cells Promotes Obesity in Female Mice
Previous Article in Journal
The Influence of Bloom Index, Endotoxin Levels and Polyethylene Glycol Succinimidyl Glutarate Crosslinking on the Physicochemical and Biological Properties of Gelatin Biomaterials
Previous Article in Special Issue
Metformin Targets Foxo1 to Control Glucose Homeostasis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 11
Issue 7
10.3390/biom11071004
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of the Clock Modulator Nobiletin on Circadian Rhythms and Pathophysiology in Female Mice of an Alzheimer’s Disease Model

by
Eunju Kim
1,†,
Kazunari Nohara
1,†,
Marvin Wirianto
1,
Gabriel Escobedo, Jr.
2,
Ji Ye Lim
1,
Rodrigo Morales
2,3,
Seung-Hee Yoo
1 and
Zheng Chen
1,*
1
Department of Biochemistry and Molecular Biology, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA
2
Department of Neurology, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA
3
Centro Integrativo de Biologia y Química Aplicada (CIBQA), Universidad Bernardo O’Higgins, Santiago 8370993, Chile
*
Author to whom correspondence should be addressed.
†
These authors contributed equally.
Biomolecules 2021, 11(7), 1004; https://doi.org/10.3390/biom11071004
Submission received: 5 June 2021 / Revised: 3 July 2021 / Accepted: 7 July 2021 / Published: 9 July 2021
(This article belongs to the Collection Molecular Mechanisms of Obesity, Diabetes, Inflammation and Aging)
Browse Figures
Versions Notes

Abstract

:
Alzheimer’s disease (AD) is an age-related neurodegenerative disorder and the most common cause of dementia. Various pathogenic mechanisms have been proposed to contribute to disease progression, and recent research provided evidence linking dysregulated circadian rhythms/sleep and energy metabolism with AD. Previously, we found that the natural compound Nobiletin (NOB) can directly activate circadian cellular oscillators to promote metabolic health in disease models and healthy aging in naturally aged mice. In the current study, using the amyloid-β AD model APP/PS1, we investigated circadian, metabolic and amyloid characteristics of female mice and the effects of NOB. Female APP/PS1 mice showed reduced sleep bout duration, and NOB treatment exhibited a trend to improve it. While glucose tolerance was unchanged, female APP/PS1 mice displayed exaggerated oxygen consumption and CO2 production, which was mitigated by NOB. Likewise, cold tolerance in APP/PS1 was impaired relative to WT, and interestingly was markedly enhanced in NOB-treated APP/PS1 mice. Although circadian behavioral rhythms were largely unchanged, real-time qPCR analysis revealed altered expression of several core clock genes by NOB in the cerebral cortex, notably Bmal1, Npas2, and Rora. Moreover, NOB was also able to activate various clock-controlled metabolic genes involved in insulin signaling and mitochondrial function, including Igf1, Glut1, Insr, Irs1, Ucp2, and Ucp4. Finally, we observed that NOB attenuated the expression of several AD related genes including App, Bace1, and ApoE, reduced APP protein levels, and strongly ameliorated Aβ pathology in the cortex. Collectively, these results reveal novel genotype differences and importantly beneficial effects of a natural clock-enhancing compound in biological rhythms and related pathophysiology, suggesting the circadian clock as a modifiable target for AD.

1. Introduction

Alzheimer’s disease is the most common form of dementia affecting the aged population, with pathological hallmarks of extracellular amyloid-β (Aβ) plaques and intracellular neurofibrillary tau tangles [1]. The vast majority of human AD cases are sporadic in nature, with years and decades between first emergence of pathological changes and clinical manifestation. Therefore, a number of pathophysiological processes have been proposed to contribute to its pathogenesis. In recent years, dysregulated circadian/sleep cycles have emerged as a contributory mechanism for AD [2,3,4,5]. While aging is known to correlate with sleep fragmentation and reduced amplitude (e.g., shorter bout duration), sleep in AD patients is even more severely disrupted, accompanied by nocturnal activity/daytime sleepiness, eventually deteriorating into almost reversed cycles which requires institutionalization [4]. A number of studies have reported that extracellular Aβ and Tau abundance undergoes diurnal fluctuation which is altered by sleep deprivation and orexin drugs that promote sleep [6,7,8,9,10]. Importantly, human studies have shown that sleep fragmentation or perturbed daily activity patterns first arise during the pre-symptomatic phase of AD, which can be used as a marker to predict cognitive deficits, pathological Aβ deposition and dementias [11,12].
The circadian clock plays a key role in sleep regulation [13,14]. In mammals, the clock consists of cell-autonomous molecular oscillators containing positive (CLOCK, NPAS2, BMAL1, RORs) and negative (PERs, CRYs, REV-ERBs) factors organized into interlocked transcription/translation feedback loops [15]. These oscillators are synchronized by the master pacemaker located in the suprachiasmatic nuclei (SCN) in the hypothalamus, primarily functioning to control gene expression and downstream physiological functions throughout the body [16,17]. For example, genomic and molecular studies have revealed oscillatory expression and clock regulation of key genes involved in AD, including Bace1 [8,18,19]. While brains from AD patients have also been shown to exhibit altered expression of circadian genes [20], more direct evidence of potential causality comes from loss-of-function studies. It has been shown that clock gene mutation or jet-lag paradigms disrupting circadian rhythmicity cause neurodegeneration and cognitive deficits [3]. For example, Bmal1 disruption was recently found to increase amyloid burden in an AD mouse model [19].
Another emerging AD risk factor is dysregulated energy metabolism. Epidemiological evidence shows that type 2 diabetes (T2D) increases the risk of AD by 2–3-fold [21]. Furthermore, diabetes and obesity were found to aggravate amyloid pathology and cognitive impairments in AD mice [22,23,24]. Insulin can cross the blood–brain barrier into the brain, regulating energy homeostasis, cognition and behavior, and pilot studies suggest a functional relationship between AD and brain insulin resistance [25,26,27]. For example, analysis of post-mortem AD brains uncovered broadly impaired gene expression and kinase activation reminiscent of insulin resistance in T2D, prompting the investigators to refer to AD as type 3 diabetes [28]. Examination of insulin sensitivity ex vivo using post-mortem brain tissues further revealed a positive correlation of cognitive deficits in AD and insulin resistance [29]. Mitochondrial dysfunction is closely related to insulin resistance [30], and improving mitochondrial function has been shown to enhance insulin sensitivity [31]. There is also a strong link between mitochondria and AD. On the one hand, amyloids promote ROS production in mitochondria [21,32]; on the other, mitochondrial dysfunction in fact precedes disease manifestation and promotes pathogenesis [32]. Several dietary interventions, particularly intermittent fasting, have shown efficacies to bolster brain mitochondrial function and/or neuronal stress resistance, which correlates with robust anti-aging and anti-AD effects [33].
An important discovery from circadian research over the past two decades is the critical regulatory role of circadian clocks in energy homeostasis and physiological fitness [34]. Key metabolic genes in different tissues are controlled by the clock, and manipulating the clock, either by disrupting or enhancing clock functions, can have major consequences on energy metabolism [34,35]. Dietary interventions such as caloric restriction and time-restricted feeding have been shown to consolidate feeding and activity to a restricted time window, thereby increasing circadian amplitude in gene expression and metabolism [36,37,38]. Likewise, various small molecules have been reported to manipulate circadian rhythms and downstream physiology [39,40,41]. For example, we previously identified a natural compound called Nobiletin (NOB) capable of activating RORs and the circadian oscillator and promoting various metabolic and physiological functions in both young and aged mice [42,43,44,45]. NOB is a polymethoxylated flavonoid that is enriched in citrus peels and shows excellent safety and bioavailability profiles [46]. Functional studies have reported a wide variety of beneficial roles of NOB, including chemopreventive, anti-inflammatory and anti-oxidative efficacies in many disease and aging models [47,48,49,50]. In particular, growing evidence indicates neuroprotective effects of NOB in various rodent models for dementia, including AD [51,52]. In the current study, we aimed to investigate how NOB alters circadian rhythms, including sleep, and related pathophysiology in AD model mice.

2. Materials and Methods

2.1. Animals

Animal husbandry and experiments, using female mice, were approved by UTHealth Center for Laboratory Animal Medicine and Care (CLAMC; protocol # AWC-20-0058 and # AWC-18-0064) and were conducted in compliance with IACUC guidelines. The APP/PS1 double transgenic mice (JAX 034829) express a chimeric mouse/human amyloid precursor protein (Mo/HuAPP695swe) and a mutant human presenilin 1 (PS1-dE9). APP/PS1 mice were bred with B6C3F1/J (JAX 100010) in-house to create APP/PS1 and WT littermates. Mice were maintained under 12 h:12 h light:dark (LD) cycles unless otherwise noted. Zeitgeber time (ZT) 0 and 12 represent light on (7 am) and off (7 pm), respectively. Female mice were used for the current study. At 3–4 months of age, mice were treated with regular diets containing equivalent macronutrients with Purina 5053 with or without 0.1% Nobiletin (Research Diets, New Brunswick, NJ, USA). Animals continued with respective diet treatment and were sacrificed at 19–22 months of age.

2.2. Circadian Activity and Period Measurement

Female APP/PS1 mice at approximately 16 months of age were transferred into individual cages with running wheels (300 lux, room temperature at 23–25 °C, and humidity 38–45%). Mice were entrained for ~3 weeks in normal LD cycles, followed by 2–3 weeks in constant darkness (DD) to measure baseline free-running periods during DD. The circadian free-running period was estimated by using the CLOCKLAB software (Actimetrics, Evanston, IL, USA).

2.3. Noninvasive Piezoelectric Transducer Sleep/Wake Recording

Sleep and wake states were determined by using a noninvasive piezoelectric transducer sleep/wake recording system (Signal Solutions LLC, Lexington, KY, USA) as previously descried [42,53]. Briefly, animals (10–11 months old) were housed individually for 48 h prior to data recording in the Piezo system in normal LD cycles. The recording was conducted for five days while mice were maintained in this photoperiod condition with free access to food and water. Data were calculated and extracted by using Sleepstats software (Signal Solutions LLC, Lexington, KY, USA).

2.4. Metabolic Chamber Analysis

Systemic energy metabolism in APP/PS1 mice was analyzed by indirect calorimetry in CLAMS metabolic chambers as previously described [43]. All animals were housed in individual cages in normal LD cycles, and measurements of oxygen consumption and CO2 production were recorded every 8–12 min over the entire course of the experiment.

2.5. Glucose Tolerance and Cold Tolerance Tests

Glucose tolerance and cold tolerance were tested as previously described [42]. For glucose tolerance, after fasting overnight, the mice (10–11 months old) were injected intraperitoneally with glucose (1 mg/kg body weight). Tail vein blood glucose was measured at 0, 15, 30, 60, and 120 min using a glucometer. The area under the curve (AUC) was calculated by the trapezoid method. To assess cold tolerance, initial body temperature of WT and APP/PS1 (~12 months old) mice was measured by the insertion of a rectal probe thermometer (ThermoWorks, Salt Lake City, UT, USA). Individually housed mice were then placed in a 4 °C cold room and provided ab libitum access to their assigned diet and water. The core body temperature was monitored hourly for 6 h.

2.6. Real-Time PCR Analysis

RT-qPCR analysis was conducted as previously described with minor modifications [54,55]. Total RNA was extracted from frozen cortex tissue using TRizol (GenDEPOT, Katy, TX, USA). A total of 1 µg of extracted RNAs was used for cDNA synthesis. Gene expression was analyzed by using QuantStudio 7 (Applied Biosystems, Waltham, MA, USA). Data were analyzed using Prism 8 software (GraphPad). Primer sequences are listed in Table 1.

2.7. Western Blotting

Western blotting was performed as previously described with minor modifications [42]. Three frozen lysate samples per group were randomly chosen and 15 µg of proteins were separated on SDS-polyacrylamide gels. Proteins were transferred onto nitrocellulose membrane and detected by the following specific antibodies from BioLegend (San Diego, CA, USA): 6E10 (previously Covance SIG-39320) and anti-CTF (previously Covance SIG-39150).

2.8. Immunohistochemistry

Immunohistochemical analyses were performed as previously reported [56,57]. Briefly, mouse brain tissues were placed in 10% neutral buffered formalin overnight. Tissues were embedded with paraffin, sectioning and placed on slides. Deparaffinized sections were stained with 4G8 antibody (#800701, BioLegend, San Diego, CA, USA) for amyloid-β (Aβ). Staining was visualized by using HRP-specific DAB substrate kit with nickel (Vector Laboratories, Burlingame, CA, USA) and mounted in DPX mounting medium (Electron Microscopy Sciences, Hatfield, PA, USA). Image files were imported to ImageJ (NIH) for quantification. Approximately 4–6 slices per animal were used and Aβ was quantified using burden threshold.

2.9. Quantifications and Statistical Analysis

Results are presented as mean ± SEM unless otherwise stated. Data were analyzed using Student’s t-test, one-way ANOVA followed by post-hoc analysis using Tukey’s multiple comparison test or two-way ANOVA followed by post-hoc analysis using Tukey’s test as offered by GraphPad Prism. A value of p < 0.05 was considered statistically significant.

3. Results

3.1. Sleep Behavior and Circadian Free-Running Rhythmin Female APP/PS1 Mice and NOB Effects

APP/PS1 is a widely used double transgenic mouse model for AD characterized by pronounced Aβ deposits [58]. In the current study, we used female WT and APP/PS1 mice considering that the female sex is one of the main non-modifiable risk factors for AD. We first conducted non-invasive piezo sleep assays to examine sleep cycles in these mice. Although the sleep amount was largely similar between genotypes under the control treatment (Figure S1A), APP/PS1.Veh mice showed reduced bout durations (Figure 1A) and correspondingly increased bout numbers (Figure S1B) relative to WT.Veh, suggesting impaired sleep consolidation and quality. NOB exhibited a trend to improve these parameters (Figure 1A and Figure S1A). A more detailed examination of bout duration (Figure 1B) revealed that the number of short sleep bouts with a duration of ~60 s was significantly reduced by NOB in APP/PS1 mice. Next, we carried out circadian wheel-running behavioral assays to evaluate circadian free-running rhythms under constant darkness. We did not observe statistically significant changes in behavioral period length (Figure S1C,D) or total activity (Figure S1E), although there may be a slight trend of period shortening in APP/PS1.Veh relative to WT.Veh, which was normalized by NOB (Figure S1D). Together, these results reveal changes in sleep behavior in APP/PS1 mice compared with WT and a trend of NOB to normalize it.

3.2. Effects of NOB on Systemic Metabolism in APP/PS1 Mice

We next examined systemic metabolism in WT and APP/PS1 mice. Glucose tolerance tests did not show any significant difference between the groups (Figure S2A). In contrast, indirect calorimetry in metabolic chambers revealed significant effects on respiratory activities. Specifically, APP/PS1.Veh mice exhibited significantly elevated carbon dioxide production (VCO2) compared with WT.Veh (Figure 2A); in accordance, there was a trend of increase in oxygen consumption (VO2) and heat production (Figure S2B) compared to WT.Veh. Furthermore, monitoring of VO2 and VCO2 over the circadian cycle demonstrated strongly elevated levels of VO2 and VCO2 in APP/PS1.Veh at night-time (Figure 2A,B; see also figure legend), and NOB showed effects to partially normalize these levels in APP/PS1 mice, especially during the late dark phase. On the other hand, respiratory exchange ratio (RER) remained unchanged in the groups examined (Figure S2B,C).
Next, we conducted cold tolerance tests to investigate adaptive thermogenesis. APP/PS1.Veh mice showed significantly lower core body temperature compared to WT.Veh at 4 h and 6 h, and interestingly NOB strongly restored core body temperature in APP/PS1.NOB mice at 6 h (p < 0.01) compared to APP/PS1.Veh (Figure 2C). These results demonstrate systemic effects of NOB on mouse physiology, specifically respiratory activity and adaptive thermogenesis.

3.3. NOB Regulates Circadian Gene Expression in the Cortex

Our previous study reported that NOB activated RORs in the core circadian oscillator to regulate clock and clock-controlled gene expression [43]. To examine NOB effects on the circadian oscillator at the molecular level, we measured clock gene expression focusing on the cerebral cortex, a tissue prone to Aβ deposition in AD. APP/PS1 mice displayed significantly altered clock gene expression patterns compared with WT mice (Figure 3), indicating circadian alteration in the cortex clock. Interestingly, expression of ROR target genes such as Bmal1 and Npas2 exhibited markedly increased diurnal changes in APP/PS1.NOB mice compared to APP/PS1.Veh. APP/PS1.NOB mice showed higher Bmal1 expression at ZT6 compared with ZT18, suggesting a distinct temporal pattern from other groups. This alteration may be caused by NOB activation of RORs [43] (which directly regulate Bmal1 transcription) and/or phase shifts in these mice. Rora also displayed a stronger diurnal alternation in APP/PS1 mice than Rorb, another Ror subtype that is expressed in the brain [59]. In comparison, expression of several other clock genes including Clock, Per1, Cry2, Nr1d1, and Dbp remained largely unchanged between groups (Figure S3). These results suggest altered circadian oscillators in the cortex of APP/PS1 mice, and NOB strongly modulates circadian time-dependent expression of several ROR target genes in the oscillator.

3.4. NOB Remodels Clock-Controlled Gene Expression in the Cortex

Circadian clocks are known to regulate metabolic and mitochondrial gene expression [34]; furthermore, energy metabolism, particularly the insulin pathway, and mitochondrial function have been implicated as modifying factors for AD [26]. We next examined key genes involved in these processes, many of which have been shown to be subjected to circadian control [18]. A number of genes involved in insulin signaling and metabolic homeostasis were found to be altered in APP/PS1 mice and normalized to varying degrees by NOB in the cortex (Figure 4A). For example, APP/PS1.Veh mice displayed lower levels of Igf1r and Glut1 expression compared to WT.Veh. On the other hand, NOB rescued the expression of Igf1, Glut1, Insr, and Irs1. Of note, NOB enhanced the diurnal alteration of Igf1, Glut1, and Insr expression in both WT and APP/PS1 models.
We next examined neuronal mitochondrial genes involved in respiratory uncoupling (Ucp2 and Ucp4) and fatty acid oxidation (Cpt1c) (Figure 4B). While there was a trend of decreased cortex expression of Ucp4 and Cpt1c in APP/PS1.Veh compared to WT.Veh, NOB was able to significantly elevate expression of Ucp2, Ucp4, and Cpt1c in APP/PS1.NOB. Together, these results indicate a strong effect of NOB on metabolic gene expression in the cortex.

3.5. NOB Attenuates Amyloid Beta (Aβ) Plaque Deposition in APP/PS1 Mice

We first examined NOB effects on cortex expression of AD-related genes. As shown in Figure 5A, NOB reduced App mRNA levels in APP/PS1.NOB mice compared to APP/PS1.Veh, especially at ZT6 (p < 0.01), mitigating the transgene overexpression. In addition, Bace1 and ApoE showed elevated expression in APP/PS1.Veh relative to WT.Veh, and NOB was able to strongly repress their levels in APP/PS1.NOB compared to APP/PS1.Veh at ZT6 (p < 0.0001 for all). Other examined AD-related genes, such as Bace2, Scna, Scnb, and Lrp1, did not show significant changes between APP/PS1.Veh and APP/PS1.NOB (Figure S4A). We next investigated levels of APP proteins and C-terminal cleavage products by Western blotting. As shown in Figure 5B and Figure S4B, the amounts of full-length APP proteins (APP-FL) were significantly reduced by NOB at ZT6, but not at ZT18, concordant with mRNA expression patterns in Figure 5A. The ratio of C-terminal cleavage products, CTFβ and CTFα corresponding to amyloidogenic and non-amyloidogenic pathways, respectively [60,61], was not significantly altered by NOB, although there may be a slight trend (Figure 5B). These results underscore the role of NOB in reducing APP protein expression in the cortex.
Finally, we investigated the effect of NOB on Aβ pathology in APP/PS1 mice. We stained Aβ plaque deposits using immunohistochemistry with the 4G8 antibody and observed significant Aβ plaque deposition in the cortex of APP/PS1.Veh mice, as expected (Figure 5C). Interestingly, the percent area of Aβ plaques in the cortex was strongly reduced by NOB treatment in APP/PS1 mice (p < 0.01), consistent with the above expression analyses. Taken together, these results illustrate a potent role of NOB in modulating AD gene expression and Aβ pathology in the cortex of female APP/PS1 mice.

4. Discussion

The current study aimed to characterize circadian and metabolic alterations in female APP/PS1 mice and investigate effects of the clock-modulating compound NOB. We show that sleep bout duration was reduced in female APP/PS1 mice, suggesting sleep fragmentation and reduced amplitude. NOB showed a trend to restore bout duration, but the effect did not reach statistical significance. NOB did not significantly alter the circadian free-running period or total activity in APP/PS1. Systemic metabolic characterization revealed that while glucose tolerance was largely unchanged irrespective of genotype or treatment, O2 consumption and CO2 production were increased in APP/PS1 mice relative to WT, resulting in a trend of elevated heat production under normal conditions. When subjected to cold challenge, APP/PS1 displayed impaired adaptive thermogenesis, and interestingly NOB was able to rescue it. This result falls in line with the previous observation that a mouse model of AD is susceptible to cold environment and exhibits impaired thermoregulation [62]. In our previous studies using naturally aged mice, we showed that NOB was able to increase sleep bout duration and improve glucose and other metabolic parameters to more significant degrees [42,63]. The relatively moderate systemic effects of NOB in APP/PS1 mice compared with aged mice may indicate more severe abnormalities in the former that are less amenable to manipulation, or alternatively may be attributable to technical factors such as differences in genetic background.
Importantly, when examining the cortex more specifically, we observed strong effects on core clock and clock-controlled output gene expression, and APP protein production and Aβ deposition were significantly alleviated by NOB in a circadian time-dependent manner, with more pronounced effects at ZT6. For example, diurnal expression of Bmal1 and Npas2, both encoding positive circadian transcription factors in the core oscillator, was found to be significantly altered by NOB in APP/PS1 mice. These genes have been shown to be regulated by the ROR receptors and our previous analysis showed that NOB directly activates RORs [15,43]. Furthermore, several clock-controlled genes involved in insulin signaling and mitochondrial function are also modulated by NOB, including Igf1, Igl1r, Glut1, Insr, Irs1, Ucp2, Ucp4, and Cpt1c. These results are, on the one hand, consistent with prior studies showing their altered expression in AD models, particularly APP/PS1 [64,65,66]. For example, APP/PS1 mice have been found to express lower levels of GLUT1 in the hippocampus compared to WT, which negatively correlated with Aβ plaque burden [64]. Changes in the expression of these genes also suggest a regulatory role of mTOR signaling known to be involved in both AD and circadian rhythms [67,68,69,70]. On the other hand, we also observed marked effects of NOB to normalize expression patternsof these key genes; for example, NOB enhanced both the expression levels and diurnal alterations of Igf1, Glut1, and Insr in APP/PS1 mice. These effects suggest a metabolic regulatory function of NOB in the cortex, in accordance with previously demonstrated efficacy of NOB in peripheral tissues [42,43,48,71]. Finally, at both mRNA and protein levels, NOB was able to considerably reduce APP expression, likely contributing to the observed improvement in plaque pathology. Bace1 and ApoE mRNA expression was also elevated in APP/PS1, consistent with previous findings [72], and NOB was able to normalize their levels. Together, these results on core clock, metabolic and AD genes in the cortex are consistent with a role of NOB to activate the circadian oscillator and modulate downstream gene expression, supporting a possible link between circadian physiology and AD.
Previous research has demonstrated many bioactive roles of NOB, including in various dementia and AD rodent models [47,49,51]. For example, NOB treatment of the 3xTg AD model mice harboring triple AD mutations was found to decrease the levels of soluble Aβ in the brain and improve cognitive performance [73]. Importantly, NOB is generally safe, and NOB-rich citrus extract has been applied in a small human study in conjunction with donepezil, an FDA-approved cholinesterase inhibitor, which led to improved cognitive performance in early-stage AD patients [74]. Supported by independent studies from many other labs, we discovered a novel function of NOB to enhance circadian rhythms which may serve as a unifying mechanism for the diverse beneficial effects [50]. A number of metabolic and physiological processes were found to be enhanced in both disease models and naturally aged mice, in a clock-dependent manner. As various pathogenetic mechanisms of AD, including gene regulation, sleep, and metabolism, are known to be regulated by the clock [3,25], understanding the role of circadian rhythms in AD progression may reveal important insights. To this end, the current study characterized the effects of NOB on these AD-related physiological processes in the commonly used APP/PS1 mice. Our results illustrate beneficial effects of NOB on circadian physiology, as well as gene expression and plaque deposition in the cortex, of female APP/PS1 mice, supporting the notion that circadian targeting by NOB may orchestrate distinct cellular processes relevant for AD pathology. Previously, several other studies have reported other clock-modulating small molecules that act on the circadian oscillator to improve AD-related pathophysiology and behaviors [75,76,77,78]. For example, it was shown that inhibition of REV-ERBs by the antagonist compound SR8278 in a highly aggressive AD mouse model (5xFAD) was able to promote amyloid uptake by microglia and consequently ameliorate plaque formation [76]. Since RORs and REV-ERBs are known to compete with each other in the secondary loop of the oscillator [15], these findings are consistent with our study where mice are treated with the ROR agonist NOB and highlight the secondary loop of the oscillator as a potential target for therapeutic development against AD.
There are several questions that await further studies. The detailed mechanisms, at both molecular and physiological levels, remain to be further investigated. For example, it is unclear how circadian oscillators and/or RORs control key genes to elicit the observed physiological and pathological effects. While we observed changes in metabolic processes, including thermogenesis and metabolic gene expression in the cortex, the specific roles of central and systemic metabolism in AD remain to be elucidated. Circadian clocks and NOB are also known to be involved in cellular mechanisms widely believed to contribute to AD pathogenesis, such as ROS/neuroinflammation [3,47]. For example, our previous studies showed that NOB optimizes mitochondrial respiration in skeletal muscle in aged mice, in part via effects on mitochondrial supercomplex formation [42]. It will be interesting to investigate whether NOB can modulate brain ROS production and neuroinflammation in AD mice via circadian pathways. Furthermore, we employed female mice for the current study. Traditionally, female mice are understudied in circadian research, in part due to a potential complication from estrous cycles. Only one third of recent studies of AD mouse models examined female mice [79]. However, AD is known to display a sexual dimorphism, with females accounting for appropriately two thirds of the patient population [80]. Currently, we are conducting studies using male mice in order to better understand the role of sex as a biological variable in AD. Finally, NOB has been shown to activate a broad spectrum of cellular pathways and many of these prior studies were conducted without consideration of circadian time [47,48]. It remains to be investigated whether the cellular effects emanate from circadian and ROR activation by NOB, or a non-circadian target/mechanism is involved. Particularly, future studies are needed to determine whether some of the effects reported herein may be attributable, at least in part, to a non-circadian mode of action by NOB.
In conclusion, our results provide new insights into the function of NOB to modulate circadian rhythms and physiology, which may contribute to the observed beneficial effect on amyloid pathology in female APP/PS1 mice. These results suggest a novel interventional strategy to target the circadian oscillator against AD progression.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/biom11071004/s1, Figure S1: Sleep and circadian behavior in WT and APP/PS1 mice. Figure S2: Glucose tolerance and systemic metabolic phenotypes related to respiration and heat production. Figure S3: mRNA expression of core clock genes in WT and APP/PS1 mice. Figure S4: mRNA expression of AD-related genes and APP protein levels in WT and APP/PS1 mice.

Author Contributions

Z.C. conceived the project; S.-H.Y., Z.C. and R.M. supervised research; E.K., K.N., M.W., G.E.J. and J.Y.L. conducted research; all authors contributed to experimental design and/or data analysis; Z.C., S.-H.Y. and E.K. prepared the manuscript draft; all authors provided information and/or critical comments during manuscript preparation and revision. All authors have read and agreed to the published version of the manuscript.

Funding

This work is in part supported by The Welch Foundation (AU-1731-20190330) and NIH/NIA (R56AG063746, RF1AG061901, R01AG065984-02S1) to Z.C., The Welch Foundation (AU-1971-20180324) and NIH/NIGMS (R03AG063286, R01GM114424) to S.-H.Y., and NIH/NIA (RF1AG072491, RF1AG059321) and Alzheimer’s Association (AARGD-18-566576) to R.M.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request to the corresponding author.

Acknowledgments

We thank Claudio Soto for advice and Kaori Ono and other lab members for technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Scheltens, P. Alzheimer’s disease. Lancet 2016, 388, 505–517. [Google Scholar] [CrossRef]
  2. Videnovic, A.; Lazar, A.; Barker, R.A.; Overeem, S. ‘The clocks that time us’—Circadian rhythms in neurodegenerative disorders. Nat. Rev. Neurol. 2014, 10, 683–693. [Google Scholar] [CrossRef]
  3. Musiek, E.S.; Holtzman, D.M. Mechanisms linking circadian clocks, sleep, and neurodegeneration. Science 2016, 354, 1004–1008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Coogan, A.; Schutová, B.; Husung, S.; Furczyk, K.; Baune, B.T.; Kropp, P.; Häßler, F.; Thome, J. The Circadian System in Alzheimer’s Disease: Disturbances, Mechanisms, and Opportunities. Biol. Psychiatry 2013, 74, 333–339. [Google Scholar] [CrossRef]
  5. Kondratova, A.A.; Kondratov, R.V. The circadian clock and pathology of the ageing brain. Nat. Rev. Neurosci. 2012, 13, 325–335. [Google Scholar] [CrossRef]
  6. Kang, J.E. Amyloid-beta dynamics are regulated by orexin and the sleep-wake cycle. Science 2009, 326, 1005–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Holth, J.K.; Fritschi, S.K.; Wang, C.; Pedersen, N.P.; Cirrito, J.R.; Mahan, T.E.; Finn, M.B.; Manis, M.; Geerling, J.C.; Fuller, P.M.; et al. The sleep-wake cycle regulates brain interstitial fluid tau in mice and CSF tau in humans. Science 2019, 363, 880–884. [Google Scholar] [CrossRef] [PubMed]
  8. Ma, Z.; Jiang, W.; Zhang, E.E. Orexin signaling regulates both the hippocampal clock and the circadian oscillation of Alzheimer’s disease-risk genes. Sci. Rep. 2016, 6, 36035. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Roh, J.H.; Jiang, H.; Finn, M.B.; Stewart, F.R.; Mahan, T.; Cirrito, J.R.; Heda, A.; Snider, B.J.; Li, M.; Yanagisawa, M.; et al. Potential role of orexin and sleep modulation in the pathogenesis of Alzheimer’s disease. J. Exp. Med. 2014, 211, 2487–2496. [Google Scholar] [CrossRef]
  10. Xie, L.; Kang, H.; Xu, Q.; Chen, M.J.; Liao, Y.; Thiyagarajan, M.; O’Donnell, J.; Christensen, D.J.; Nicholson, C.; Iliff, J.J.; et al. Sleep Drives Metabolite Clearance from the Adult Brain. Science 2013, 342, 373–377. [Google Scholar] [CrossRef] [Green Version]
  11. Tranah, G.J.; Ma, T.B.; Stone, K.L.; Ancoli-Israel, S.; Paudel, M.L.; Ensrud, K.; Cauley, J.A.; Redline, S.; Hillier, T.A.; Cummings, S.R.; et al. Circadian activity rhythms and risk of incident dementia and mild cognitive impairment in older women. Ann. Neurol. 2011, 70, 722–732. [Google Scholar] [CrossRef] [Green Version]
  12. Lim, A.S. Modification of the relationship of the apolipoprotein E epsilon4 allele to the risk of Alzheimer disease and neurofibrillary tangle density by sleep. JAMA Neurol. 2013, 70, 1544–1551. [Google Scholar] [CrossRef] [Green Version]
  13. Ashbrook, L.H.; Krystal, A.D.; Fu, Y.-H.; Ptáček, L.J. Genetics of the human circadian clock and sleep homeostat. Neuropsychopharmacology 2020, 45, 45–54. [Google Scholar] [CrossRef] [PubMed]
  14. Mattis, J.; Sehgal, A. Circadian Rhythms, Sleep, and Disorders of Aging. Trends Endocrinol. Metab. 2016, 27, 192–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Takahashi, J.S. Transcriptional architecture of the mammalian circadian clock. Nat. Rev. Genet. 2017, 18, 164–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Mohawk, J.A.; Green, C.B.; Takahashi, J.S. Central and peripheral circadian clocks in mammals. Annu. Rev. Neurosci. 2012, 35, 445–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Liu, A.C.; Welsh, D.K.; Ko, C.H.; Tran, H.G.; Zhang, E.; Priest, A.A.; Buhr, E.D.; Singer, O.; Meeker, K.; Verma, I.M.; et al. Intercellular Coupling Confers Robustness against Mutations in the SCN Circadian Clock Network. Cell 2007, 129, 605–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Zhang, R.; Lahens, N.F.; Ballance, H.I.; Hughes, M.E.; HogenEsch, J.B. A circadian gene expression atlas in mammals: Implications for biology and medicine. In Proceedings of the National Academy of Sciences, Dallas, TX, USA, 19 September 2014; Volume 111, pp. 16219–16224. [Google Scholar]
  19. Kress, G.J. Regulation of amyloid-beta dynamics and pathology by the circadian clock. J. Exp. Med. 2018, 215, 1059–1068. [Google Scholar] [CrossRef]
  20. Cermakian, N.; Lamont, E.W. Circadian clock gene expression in brain regions of Alzheimer’s disease patients and control subjects. J. Biol. Rhythm. 2011, 26, 160–170. [Google Scholar] [CrossRef] [PubMed]
  21. Pasinetti, G.M.; Eberstein, J.A. Metabolic syndrome and the role of dietary lifestyles in Alzheimer’s disease. J. Neurochem. 2008, 106, 1503–1514. [Google Scholar] [CrossRef] [Green Version]
  22. Ho, L.; Qin, W.; Pompl, P.N. Diet-induced insulin resistance promotes amyloidosis in a transgenic mouse model of Alzheimer’s disease. FASEB J. 2004, 18, 902–904. [Google Scholar] [CrossRef] [PubMed]
  23. Takeda, S.; Sato, N. Diabetes-accelerated memory dysfunction via cerebrovascular inflammation and Abeta deposition in an Alzheimer mouse model with diabetes. Proc. Natl. Acad. Sci. USA 2010, 107, 7036–7041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Walker, J.M.; Dixit, S.; Saulsberry, A.C. Reversal of high fat diet-induced obesity improves glucose tolerance, inflammatory response, beta-amyloid accumulation and cognitive decline in the APP/PSEN1 mouse model of Alzheimer’s disease. Neurobiol. Dis. 2017, 100, 87–98. [Google Scholar] [CrossRef] [Green Version]
  25. Loehfelm, A.; Boucsein, A.; Pretz, D.; Tups, A. Timing Matters: Circadian Effects on Energy Homeostasis and Alzheimer’s Disease. Trends Endocrinol. Metab. 2019, 30, 132–143. [Google Scholar] [CrossRef] [PubMed]
  26. Arnold, S.E.; Arvanitakis, Z.; Macauley, S.; Koenig, A.M.; Wang, H.-Y.; Ahima, R.S.; Craft, S.; Gandy, S.; Buettner, C.; Stoeckel, L.E.; et al. Brain insulin resistance in type 2 diabetes and Alzheimer disease: Concepts and conundrums. Nat. Rev. Neurol. 2018, 14, 168–181. [Google Scholar] [CrossRef] [PubMed]
  27. Soto, M.; Cai, W.; Konishi, M.; Kahn, C.R. Insulin signaling in the hippocampus and amygdala regulates metabolism and neurobehavior. Proc. Natl. Acad. Sci. USA 2019, 116, 6379–6384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Steen, E.; Terry, B.M.; Enrique, J.R. Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer’s disease--is this type 3 diabetes? J. Alzheimers Dis. 2005, 7, 63–80. [Google Scholar] [CrossRef] [Green Version]
  29. Talbot, K.; Wang, H.-Y.; Kazi, H.; Han, L.-Y.; Bakshi, K.P.; Stucky, A.; Fuino, R.L.; Kawaguchi, K.R.; Samoyedny, A.J.; Wilson, R.S.; et al. Demonstrated brain insulin resistance in Alzheimer’s disease patients is associated with IGF-1 resistance, IRS-1 dysregulation, and cognitive decline. J. Clin. Investig. 2012, 122, 1316–1338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Petersen, K.F.; Befroy, D.; Dufour, S.; Dziura, J.; Ariyan, C.; Rothman, D.L.; DiPietro, L.; Cline, G.W.; Shulman, G.I. Mitochondrial Dysfunction in the Elderly: Possible Role in Insulin Resistance. Science 2003, 300, 1140–1142. [Google Scholar] [CrossRef] [Green Version]
  31. Sergi, D.; Naumovski, N.N.; Heilbronn, L.H.K.; Abeywardena, M.; O’Callaghan, N.; Lionetti, L.; Luscombe-Marsh, N.L.-M. Mitochondrial (Dys)function and Insulin Resistance: From Pathophysiological Molecular Mechanisms to the Impact of Diet. Front. Physiol. 2019, 10, 532. [Google Scholar] [CrossRef]
  32. Lin, M.T.; Beal, M.F. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature 2006, 443, 787–795. [Google Scholar] [CrossRef]
  33. Mattson, M.P.; Arumugam, T.V. Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States. Cell Metab. 2018, 27, 1176–1199. [Google Scholar] [CrossRef] [Green Version]
  34. Bass, J.; Lazar, M.A. Circadian time signatures of fitness and disease. Science 2016, 354, 994–999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Sulli, G.; Manoogian, E.N.; Taub, P.R.; Panda, S. Training the Circadian Clock, Clocking the Drugs, and Drugging the Clock to Prevent, Manage, and Treat Chronic Diseases. Trends Pharmacol. Sci. 2018, 39, 812–827. [Google Scholar] [CrossRef] [PubMed]
  36. Hatori, M.; Vollmers, C.; Zarrinpar, A.; DiTacchio, L.; Bushong, E.A.; Gill, S.; Leblanc, M.; Chaix, A.; Joens, M.; Fitzpatrick, J.A.; et al. Time-Restricted Feeding without Reducing Caloric Intake Prevents Metabolic Diseases in Mice Fed a High-Fat Diet. Cell Metab. 2012, 15, 848–860. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Acosta-Rodriguez, V.A.; de Groot, M.H.M.; Rijo-Ferreira, F. Mice under Caloric Restriction Self-Impose a Temporal Restriction of Food Intake as Revealed by an Automated Feeder System. Cell Metab. 2017, 26, 267–277. [Google Scholar] [CrossRef] [Green Version]
  38. Makwana, K.; Gosai, N.; Poe, A.; Kondratov, R.V. Calorie restriction reprograms diurnal rhythms in protein translation to regulate metabolism. FASEB J. 2019, 33, 4473–4489. [Google Scholar] [CrossRef]
  39. Kojetin, D.J.; Burris, T.P. REV-ERB and ROR nuclear receptors as drug targets. Nat. Rev. Drug Discov. 2014, 13, 197–216. [Google Scholar] [CrossRef] [Green Version]
  40. Chen, Z.; Yoo, S.-H.; Takahashi, J.S. Development and Therapeutic Potential of Small-Molecule Modulators of Circadian Systems. Annu. Rev. Pharmacol. Toxicol. 2018, 58, 231–252. [Google Scholar] [CrossRef]
  41. Hirota, T.; Kay, S.A. Identification of Small-Molecule Modulators of the Circadian Clock. Methods Enzymol. 2015, 551, 267–282. [Google Scholar] [CrossRef]
  42. Nohara, K.; Mallampalli, V.; Nemkov, T.; Wirianto, M.; Yang, J.; Ye, Y.; Sun, Y.; Han, L.; Esser, K.A.; Mileykovskaya, E.; et al. Nobiletin fortifies mitochondrial respiration in skeletal muscle to promote healthy aging against metabolic challenge. Nat. Commun. 2019, 10, 3923. [Google Scholar] [CrossRef] [Green Version]
  43. He, B.; Nohara, K.; Park, N.; Park, Y.S.; Guillory, B.; Zhao, Z.; Garcia, J.M.; Koike, N.; Lee, C.C.; Takahashi, J.S.; et al. The Small Molecule Nobiletin Targets the Molecular Oscillator to Enhance Circadian Rhythms and Protect against Metabolic Syndrome. Cell Metab. 2016, 23, 610–621. [Google Scholar] [CrossRef] [Green Version]
  44. Nohara, K.; Shin, Y.; Park, N.; Jeong, K.; He, B.; Koike, N.; Yoo, S.-H.; Chen, Z. Ammonia-lowering activities and carbamoyl phosphate synthetase 1 (Cps1) induction mechanism of a natural flavonoid. Nutr. Metab. 2015, 12, 23. [Google Scholar] [CrossRef] [Green Version]
  45. Nohara, K.; Kim, E.; Wirianto, M.; Mileykovskaya, E.; Dowhan, W.; Chen, Z.; Yoo, S.-H. Cardiolipin Synthesis in Skeletal Muscle Is Rhythmic and Modifiable by Age and Diet. Oxid. Med. Cell. Longev. 2020, 2020, 1–12. [Google Scholar] [CrossRef]
  46. Evans, M.; Sharma, P.; Guthrie, N. Bioavailability of Citrus Polymethoxylated Flavones and Their Biological Role in Metabolic Syndrome and Hyperlipidemia. In Readings Advanced Pharmacokinetics—Theory, Methods and Applications; InTech: London, UK, 2012; pp. 1–19. [Google Scholar]
  47. Huang, H.; Li, L.; Shi, W. The Multifunctional Effects of Nobiletin and Its Metabolites In Vivo and In Vitro. Evid. Based Complementary Alternat. Med. 2016, 2016, 2918796. [Google Scholar]
  48. Mulvihill, E.E.; Burke, A.C.; Huff, M.W. Citrus Flavonoids as Regulators of Lipoprotein Metabolism and Atherosclerosis. Annu. Rev. Nutr. 2016, 36, 275–299. [Google Scholar] [CrossRef]
  49. Walle, T. Methoxylated flavones, a superior cancer chemopreventive flavonoid subclass? Semin. Cancer Biol. 2007, 17, 354–362. [Google Scholar] [CrossRef] [Green Version]
  50. Mileykovskaya, E.; Yoo, S.-H.; Dowhan, W.; Chen, Z. Nobiletin: Targeting the Circadian Network to Promote Bioenergetics and Healthy Aging. Biochemistry 2020, 85, 1554–1559. [Google Scholar] [CrossRef]
  51. Nakajima, A.; Ohizumi, Y. Potential Benefits of Nobiletin, A Citrus Flavonoid, against Alzheimer’s Disease and Parkinson’s Disease. Int. J. Mol. Sci. 2019, 20, 3380. [Google Scholar] [CrossRef] [Green Version]
  52. Cirmi, S.; Ferlazzo, N.; Lombardo, G.E.; Ventura-Spagnolo, E.; Gangemi, S.; Calapai, G.; Navarra, M. Neurodegenerative Diseases: Might Citrus Flavonoids Play a Protective Role? Molecules 2016, 21, 1312. [Google Scholar] [CrossRef] [Green Version]
  53. Han, C.; Wirianto, M.; Kim, E.; Burish, M.; Yoo, S.-H.; Chen, Z. Clock-Modulating Activities of the Anti-Arrhythmic Drug Moricizine. Clocks Sleep 2021, 3, 22. [Google Scholar] [CrossRef] [PubMed]
  54. Kim, H.K.; Lee, S.-Y.; Koike, N.; Kim, E.; Wirianto, M.; Burish, M.J.; Yagita, K.; Lee, H.K.; Chen, Z.; Chung, J.M.; et al. Circadian regulation of chemotherapy-induced peripheral neuropathic pain and the underlying transcriptomic landscape. Sci. Rep. 2020, 10, 1–13. [Google Scholar] [CrossRef] [PubMed]
  55. Wirianto, M.; Yang, J.; Kim, E. The GSK-3beta-FBXL21 Axis Contributes to Circadian TCAP Degradation and Skeletal Muscle Function. Cell Rep. 2020, 32, 108140. [Google Scholar] [CrossRef] [PubMed]
  56. Duran-Aniotz, C.; Moreno-Gonzalez, I.; Gamez, N.; Perez-Urrutia, N.; Vegas-Gomez, L.; Soto, C.; Morales, R. Amyloid pathology arrangements in Alzheimer’s disease brains modulate in vivo seeding capability. Acta Neuropathol. Commun. 2021, 9, 1–13. [Google Scholar] [CrossRef]
  57. Morales, R.; Bravo-Alegria, J.; Moreno-Gonzalez, I. Transmission of cerebral amyloid pathology by peripheral administration of misfolded Abeta aggregates. Mol. Psychiatry 2021. [Google Scholar] [CrossRef]
  58. Jankowsky, J.L.; Fadale, D.J.; Anderson, J. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: Evidence for augmentation of a 42-specific gamma secretase. Hum. Mol. Genet. 2004, 13, 159–170. [Google Scholar] [CrossRef] [Green Version]
  59. Jetten, A.M. Retinoid-Related Orphan Receptors (RORs): Critical Roles in Development, Immunity, Circadian Rhythm, and Cellular Metabolism. Nucl. Recept. Signal. 2009, 7, e003. [Google Scholar] [CrossRef] [Green Version]
  60. Marwarha, G.; Schommer, J.; Lude, J. Palmitate-induced C/EBP homologous protein activation leads to NF-kappaB-mediated increase in BACE1 activity and amyloid beta genesis. J. Neurochem. 2018, 144, 761–779. [Google Scholar] [CrossRef] [Green Version]
  61. Wang, X.; Song, R.; Lu, W.; Liu, Z.; Wang, L.; Zhu, X.; Liu, Y.; Sun, Z.; Li, J.; Li, X. YXQN Reduces Alzheimer’s Disease-Like Pathology and Cognitive Decline in APPswePS1dE9 Transgenic Mice. Front. Aging Neurosci. 2017, 9, 157. [Google Scholar] [CrossRef]
  62. Vandal, M.; White, P.J.; Thornissac, M. Impaired thermoregulation and beneficial effects of thermoneutrality in the 3xTg-AD model of Alzheimer’s disease. Neurobiol. Aging 2016, 43, 47–57. [Google Scholar] [CrossRef]
  63. Nohara, K.; Nemkov, T.; D’Alessandro, A.; Yoo, S.-H.; Chen, Z. Coordinate Regulation of Cholesterol and Bile Acid Metabolism by the Clock Modifier Nobiletin in Metabolically Challenged Old Mice. Int. J. Mol. Sci. 2019, 20, 4281. [Google Scholar] [CrossRef] [Green Version]
  64. Hooijmans, C.R.; Graven, C.; Dederen, P.J.; Tanila, H.; van Groen, T.; Kiliaan, A.J. Amyloid beta deposition is related to decreased glucose transporter-1 levels and hippocampal atrophy in brains of aged APP/PS1 mice. Brain Res. 2007, 1181, 93–103. [Google Scholar] [CrossRef] [PubMed]
  65. Das, T.K.; Chakrabarti, S.K.; Zulkipli, I.N.; Hamid, M.R.A. Curcumin Ameliorates the Impaired Insulin Signaling Involved in the Pathogenesis of Alzheimer’s Disease in Rats. J. Alzheimer’s Dis. Rep. 2019, 3, 59–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. He, Y.; Yang, X.; Jiao, M.; Anoopkumar-Dukie, S.; Zeng, Y.; Mei, H. Housefly (Musca domestica) larvae powder, preventing oxidative stress injury via regulation of UCP4 and CyclinD1 and modulation of JNK and P38 signaling in APP/PS1 mice. Food Funct. 2018, 10, 235–243. [Google Scholar] [CrossRef]
  67. Perluigi, M.; Di Domenico, F.; Barone, E.; Butterfield, D. mTOR in Alzheimer disease and its earlier stages: Links to oxidative damage in the progression of this dementing disorder. Free Radic. Biol. Med. 2021, 169, 382–396. [Google Scholar] [CrossRef]
  68. Burillo, J.; Marqués, P.; Jiménez, B.; González-Blanco, C.; Benito, M.; Guillén, C. Insulin Resistance and Diabetes Mellitus in Alzheimer’s Disease. Cells 2021, 10, 1236. [Google Scholar] [CrossRef]
  69. Uddin, M.S.; Kabir, M.; Niaz, K.; Jeandet, P.; Clément, C. Molecular Insight into the Therapeutic Promise of Flavonoids against Alzheimer’s Disease. Molecules 2020, 25, 1267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  70. Morris, A.R.; Stanton, D.; Roman, D.; Liu, A.C. Systems Level Understanding of Circadian Integration with Cell Physiology. J. Mol. Biol. 2020, 432, 3547–3564. [Google Scholar] [CrossRef]
  71. Petrenko, V.; Gandasi, N.R.; Sage, D.; Tengholm, A.; Barg, S.; Dibner, C. In pancreatic islets from type 2 diabetes patients, the dampened circadian oscillators lead to reduced insulin and glucagon exocytosis. Proc. Natl. Acad. Sci. USA 2020, 117, 2484–2495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Mao, Y.F.; Guo, Z.; Zheng, T.; Jiang, Y.; Yan, Y.; Yin, X. Intranasal insulin alleviates cognitive deficits and amyloid pathology in young adult APPswe/PS1dE9 mice. Aging Cell 2016, 15, 893–902. [Google Scholar] [CrossRef] [Green Version]
  73. Nakajima, A.; Aoyama, Y.; Shin, E.J.; Nam, Y. Nobiletin, a citrus flavonoid, improves cognitive impairment and reduces soluble ABeta levels in a triple transgenic mouse model of Alzheimer’s disease. Behav. Brain Res. 2015, 289, 69–77. [Google Scholar] [CrossRef]
  74. Seki, T.; Kamiya, T.; Furukawa, K.; Azumi, M. Nobiletin-rich Citrus reticulata peels, a kampo medicine for Alzheimer’s disease: A case series. Geriatr. Gerontol. Int. 2013, 13, 236–238. [Google Scholar] [CrossRef]
  75. Sundaram, S.; Nagaraj, S.; Mahoney, H.; Portugues, A. Inhibition of casein kinase 1delta/epsilon improves cognitive-affective behavior and reduces amyloid load in the APP-PS1 mouse model of Alzheimer’s disease. Sci. Rep. 2019, 9, 13743. [Google Scholar] [CrossRef] [Green Version]
  76. Lee, J.; Kim, D.E.; Griffin, P.; Sheehan, P.; Kim, D.; Musiek, E.S.; Yoon, S. Inhibition of REV-ERBs stimulates microglial amyloid-beta clearance and reduces amyloid plaque deposition in the 5XFAD mouse model of Alzheimer’s disease. Aging Cell 2019, 19, e13078. [Google Scholar] [CrossRef] [Green Version]
  77. Ni, J.; Wu, Z.; Meng, J.; Saito, T.; Saido, T.C.; Qing, H.; Nakanishi, H. An impaired intrinsic microglial clock system induces neuroinflammatory alterations in the early stage of amyloid precursor protein knock-in mouse brain. J. Neuroinflamm. 2019, 16, 1–15. [Google Scholar] [CrossRef] [Green Version]
  78. Roby, D.A.; Ruiz, F.; Kermath, B.A.; Voorhees, J.R. Pharmacological activation of the nuclear receptor REV-ERB reverses cognitive deficits and reduces amyloid-beta burden in a mouse model of Alzheimer’s disease. PLoS ONE 2019, 14, e0215004. [Google Scholar] [CrossRef] [PubMed]
  79. Waters, A.N.; Society for Women’s Health Research Alzheimer’s Disease; Laitner, M.H. Biological sex differences in Alzheimer’s preclinical research: A call to action. Alzheimers Dement. 2021, 7, e12111. [Google Scholar]
  80. Toro, C.A.; Zhang, L.; Cao, J.; Cao, D. Sex differences in Alzheimer’s disease: Understanding the molecular impact. Brain Res. 2019, 1719, 194–207. [Google Scholar] [CrossRef]
Biomolecules 11 01004 g001 550
Figure 1. Sleep alterations in APP/PS1 mice and effects of Nobiletin (NOB). (A) Average of sleep bout duration (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 unpaired Student’s t-test. (B) Histogram of sleep bout duration (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 unpaired Student’s t-test. # p < 0.05, ## p < 0.01 one-way ANOVA with Tukey’s multiple comparisons test.
Figure 1. Sleep alterations in APP/PS1 mice and effects of Nobiletin (NOB). (A) Average of sleep bout duration (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 unpaired Student’s t-test. (B) Histogram of sleep bout duration (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 unpaired Student’s t-test. # p < 0.05, ## p < 0.01 one-way ANOVA with Tukey’s multiple comparisons test.
Biomolecules 11 01004 g001
Biomolecules 11 01004 g002 550
Figure 2. Nobiletin improves systemic metabolism in APP/PS1 mice. (A, B) Total average (left panels) and hourly average (right panels) of carbon dioxide production (VCO2) and oxygen consumption (VO2) using CLAMS metabolic chambers (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 t-test. For the hourly average of VCO2: * p < 0.05 at the time points of 19.3 and 22.8 h, two-way ANOVA with Tukey’s multiple comparison test (APP/PS1.Veh vs. APP/PS1.NOB). For hourly average of VO2: * p < 0.05 at the time points of 13.5, 15, and 16.3 h, two-way ANOVA with Tukey’s multiple comparison test (WT.Veh vs. APP/PS1.Veh). (C) Cold tolerance test (n = 6–10/each group). Data represented by mean ± SEM. # p < 0.05, ## p < 0.01 unpaired student t-test (WT.Veh vs WT.NOB). * p < 0.05 unpaired student t-test (APP/PS1.Veh vs APP/PS1.NOB). †† p < 0.01 one-way ANOVA with Tukey’s multiple comparisons test (APPS/PS1.Veh vs. APP/PS1.NOB).
Figure 2. Nobiletin improves systemic metabolism in APP/PS1 mice. (A, B) Total average (left panels) and hourly average (right panels) of carbon dioxide production (VCO2) and oxygen consumption (VO2) using CLAMS metabolic chambers (n = 6–10/each group). Data represented by mean ± SEM. * p < 0.05 t-test. For the hourly average of VCO2: * p < 0.05 at the time points of 19.3 and 22.8 h, two-way ANOVA with Tukey’s multiple comparison test (APP/PS1.Veh vs. APP/PS1.NOB). For hourly average of VO2: * p < 0.05 at the time points of 13.5, 15, and 16.3 h, two-way ANOVA with Tukey’s multiple comparison test (WT.Veh vs. APP/PS1.Veh). (C) Cold tolerance test (n = 6–10/each group). Data represented by mean ± SEM. # p < 0.05, ## p < 0.01 unpaired student t-test (WT.Veh vs WT.NOB). * p < 0.05 unpaired student t-test (APP/PS1.Veh vs APP/PS1.NOB). †† p < 0.01 one-way ANOVA with Tukey’s multiple comparisons test (APPS/PS1.Veh vs. APP/PS1.NOB).
Biomolecules 11 01004 g002
Biomolecules 11 01004 g003 550
Figure 3. Effects of NOB on expression of core clock genes in WT and APP/PS1 mice. mRNA expression of core clock genes in cortex tissues was measured via real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01 two-way ANOVA with Tukey’s multiple comparisons.
Figure 3. Effects of NOB on expression of core clock genes in WT and APP/PS1 mice. mRNA expression of core clock genes in cortex tissues was measured via real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01 two-way ANOVA with Tukey’s multiple comparisons.
Biomolecules 11 01004 g003
Biomolecules 11 01004 g004 550
Figure 4. Nobiletin alters metabolic and mitochondrial gene expression in APP/PS1 mice. mRNA expression of (A) insulin signaling and glucose transporter-related genes and (B) mitochondrial thermogenic genes in cortex tissues was measured using real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, two-way ANOVA with Tukey’s multiple comparisons.
Figure 4. Nobiletin alters metabolic and mitochondrial gene expression in APP/PS1 mice. mRNA expression of (A) insulin signaling and glucose transporter-related genes and (B) mitochondrial thermogenic genes in cortex tissues was measured using real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001, two-way ANOVA with Tukey’s multiple comparisons.
Biomolecules 11 01004 g004
Biomolecules 11 01004 g005 550
Figure 5. NOB modulates AD gene expression and ameliorates Aβ deposits in APP/PS1 mice. (A) mRNA expression of AD-related genes in WT and APP/PS1 mice. mRNA expressions of core clock genes in cortex tissues were measured using real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. (B) Protein levels of APP-FL and CTFs were detected by using human 6E10 and carboxyl-terminal fragments (CTFs)-specific antibodies in cortex lysates at ZT6 and ZT18. GAPDH served as the loading control. Left panels: representative blot images. See Figure S4B for the whole blot images and size markers. Right panels: quantification of APP-FL and CTFs (n = 3/group). Data represented by mean ± SEM. * p < 0.05, unpaired Student’s t-test. (C) Immunohistochemistry of Aβ in APP/PS1 mice using the 4G8 antibody in the cortex (n = 6–11). Right panels: Quantification of amyloid burden (4–6 slices/mouse). Data represented by mean ± SEM. One-way ANOVA with Tukey’s multiple comparison test shows significant statistical difference between APP/PS1.Veh and APP/PS1.NOB (**, p < 0.01).
Figure 5. NOB modulates AD gene expression and ameliorates Aβ deposits in APP/PS1 mice. (A) mRNA expression of AD-related genes in WT and APP/PS1 mice. mRNA expressions of core clock genes in cortex tissues were measured using real-time qPCR (n ≥ 3/each group). Mice were sacrificed at ZT6 and ZT18 under the LD condition. Data represented by mean ± SEM in bar graph. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. (B) Protein levels of APP-FL and CTFs were detected by using human 6E10 and carboxyl-terminal fragments (CTFs)-specific antibodies in cortex lysates at ZT6 and ZT18. GAPDH served as the loading control. Left panels: representative blot images. See Figure S4B for the whole blot images and size markers. Right panels: quantification of APP-FL and CTFs (n = 3/group). Data represented by mean ± SEM. * p < 0.05, unpaired Student’s t-test. (C) Immunohistochemistry of Aβ in APP/PS1 mice using the 4G8 antibody in the cortex (n = 6–11). Right panels: Quantification of amyloid burden (4–6 slices/mouse). Data represented by mean ± SEM. One-way ANOVA with Tukey’s multiple comparison test shows significant statistical difference between APP/PS1.Veh and APP/PS1.NOB (**, p < 0.01).
Biomolecules 11 01004 g005
Table
Table 1. Primer sequences for RT-qPCR.
Table 1. Primer sequences for RT-qPCR.
Forward (5′–3′)Reverse (5′–3′)
ClockCCTTCAGCAGTCAGTCCATAAACAGACATCGCTGGCTGTGTTAA
Bmal1CCACCTCAGAGCCATTGATACAGAGCAGGTTTAGTTCCACTTTGTCT
Per1TTCGTGGACTTGACACCTCTTGGGAACGCTTTGCTTTAGAT
Per2ATGCTCGCCATCCACAAGAGCGGAATCGAATGGGAGAAT
Cry1CTGGCGTGGAAGTCATCGTCTGTCCGCCATTGAGTTCTATG
Npas2CAACAGACGGCAGCATCATCTTTCTGATCCATGACATCCGC
RoraGCACCTGACCGAAGACGAAAGAGCGATCCGCTGACATCA
RorbGACCCACACCTACGAGGAAAGTGATCTGGATGGCACACTG
Nr1d1CATGGTGCTACTGTGTAAGGTGTGTCACAGGCGTGCACTCCATAG
DbpCTGGCCCGAGTCTTTTTGCCCAGGTCCACGTATTCCACG
AppAGCACCGAGAGAGAATGTCCGCAAGTTCTTGGCTTGACG
Bace1ACATTGCTGCCATCACTGAAGCCTGGCAATCTCAGCATAG
Bace2TGAGGACCTTGTCACCATCCCAAATGGCCAAAGCAGCATAAGCAAGTC
ApoEATTGCGAAGATGAAGGCTCTCCACTCGAGCTGATCTGTCA
ScnaTGACAGCAGTCGCTCAGACATGTCTTCCAGGATTCCTTC
ScnbGGAGGAGCTGTGTTCTCTGGTCCTCTGGCTTCAGGTCTGT
Lrp1ATTGAGGGCAAGATGACACACCAGTCTGTCCAGTACATCCAC
Igf1TGGTGACCGGCTACGTGAAGCAAAGTACATCTTTCCGGACC
Igf1rATCGCGATTTCTGCGCCAACATTCTTCTCTTCATCGCCGCAGACT
Glut1AGCCCTGCTACAGTGTATAGGTCTCGGGTCACATC
Glut3TAAACCAGCTGGGCATCGTTGTTGAATGATGGTTAAGCCAAGGAGCCC
InsrGACAGCCACCACACTCACACTTCGTGCAGCTCCTCATCACCATATCG
Irs1CCAGCCTGGCTATTTAGCTGTTCTCTAGGAGCTGGGTGGA
Irs2TCTTTCACGACTGTGGCTTCCTTCACTGGAGCTTTGCCCTCTGC
LeprGTGTGAGGAGGTACGTGGTGAAGCCGAGGGAATTGACAGCCAGAAC
Ucp2ATGGTTGGTTTCAAGGCCACACGGTATCCAGAGGGAAAGTGAT
Ucp4TCGAGACAAACAAGGAAGGGGGACCAAGGGGTCATTCTCAGC
Cpt1cGCAGGAGATCTCACCGACATCCCTGGAATCCGTGTAGTGT
GapdhCAAGGTCATCCATGACAACTTTGGGCCATCCACAGTCTTCTGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kim, E.; Nohara, K.; Wirianto, M.; Escobedo, G., Jr.; Lim, J.Y.; Morales, R.; Yoo, S.-H.; Chen, Z. Effects of the Clock Modulator Nobiletin on Circadian Rhythms and Pathophysiology in Female Mice of an Alzheimer’s Disease Model. Biomolecules 2021, 11, 1004. https://doi.org/10.3390/biom11071004

AMA Style

Kim E, Nohara K, Wirianto M, Escobedo G Jr., Lim JY, Morales R, Yoo S-H, Chen Z. Effects of the Clock Modulator Nobiletin on Circadian Rhythms and Pathophysiology in Female Mice of an Alzheimer’s Disease Model. Biomolecules. 2021; 11(7):1004. https://doi.org/10.3390/biom11071004

Chicago/Turabian Style

Kim, Eunju, Kazunari Nohara, Marvin Wirianto, Gabriel Escobedo, Jr., Ji Ye Lim, Rodrigo Morales, Seung-Hee Yoo, and Zheng Chen. 2021. "Effects of the Clock Modulator Nobiletin on Circadian Rhythms and Pathophysiology in Female Mice of an Alzheimer’s Disease Model" Biomolecules 11, no. 7: 1004. https://doi.org/10.3390/biom11071004

APA Style

Kim, E., Nohara, K., Wirianto, M., Escobedo, G., Jr., Lim, J. Y., Morales, R., Yoo, S. -H., & Chen, Z. (2021). Effects of the Clock Modulator Nobiletin on Circadian Rhythms and Pathophysiology in Female Mice of an Alzheimer’s Disease Model. Biomolecules, 11(7), 1004. https://doi.org/10.3390/biom11071004

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop