Desmopressin Stimulates Nitric Oxide Production in Human Lung Microvascular Endothelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures and Experimental Treatment
2.2. Cell Viability Assay
2.3. RT-qPCR Analysis
2.4. Western Blot Analysis
2.5. Determination of Nitric Oxide Production
2.6. Arginine Uptake
2.7. Determination of Arginine Intracellular Concentration
2.8. Fluorescence Resonance Energy Transfer Measurements
2.9. Intracellular Calcium Measurements
2.10. Statistical Analysis
2.11. Materials
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ball, S.G. Vasopressin and disorders of water balance: The physiology and pathophysiology of vasopressin. Ann. Clin. Biochem. 2007, 44, 417–431. [Google Scholar] [CrossRef] [PubMed]
- Demiselle, J.; Fage, N.; Radermacher, P.; Asfar, P. Vasopressin and its analogues in shock states: A review. Ann. Intensive Care 2020, 10, 9. [Google Scholar] [CrossRef] [PubMed]
- Treschan, T.A.; Peters, J. The vasopressin system: Physiology and clinical strategies. Anesthesiology 2006, 105, 599–612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petersen, M.B. The effect of vasopressin and related compounds at V1a and V2 receptors in animal models relevant to human disease. Basic Clin. Pharmacol. Toxicol. 2006, 99, 96–103. [Google Scholar] [CrossRef]
- Manning, M.; Misicka, A.; Olma, A.; Bankowski, K.; Stoev, S.; Chini, B.; Durroux, T.; Mouillac, B.; Corbani, M.; Guillon, G. Oxytocin and vasopressin agonists and antagonists as research tools and potential therapeutics. J. Neuroendocrinol. 2012, 24, 609–628. [Google Scholar] [CrossRef] [Green Version]
- Edwards, C.R.; Kitau, M.J.; Chard, T.; Besser, G.M. Vasopressin analogue DDAVP in diabetes insipidus: Clinical and laboratory studies. Br. Med. J. 1973, 3, 375–378. [Google Scholar] [CrossRef] [Green Version]
- Mannucci, P.M. Desmopressin (DDAVP) in the treatment of bleeding disorders: The first 20 years. Blood 1997, 90, 2515–2521. [Google Scholar] [CrossRef]
- Sobol, N.T.; Solerno, L.M.; Beltran, B.; Vasquez, L.; Ripoll, G.V.; Garona, J.; Alonso, D.F. Anticancer activity of repurposed hemostatic agent desmopressin on AVPR2-expressing human osteosarcoma. Exp. Ther. Med. 2021, 21, 566. [Google Scholar] [CrossRef]
- Joffre, J.; Lloyd, E.; Wong, E.; Chung-Yeh, C.; Nguyen, N.; Xu, F.; Legrand, M.; Hellman, J. Catecholaminergic Vasopressors Reduce Toll-Like Receptor Agonist-Induced Microvascular Endothelial Cell Permeability But Not Cytokine Production. Crit. Care Med. 2021, 49, e315–e326. [Google Scholar] [CrossRef]
- Lopez, E.; Fukuda, S.; Modis, K.; Fujiwara, O.; Enkhtaivan, B.; Trujillo-Abarca, R.; Ihara, K.; Lima-Lopez, F.; Perez-Bello, D.; Szabo, C.; et al. Arginine vasopressin receptor 2 activation promotes microvascular permeability in sepsis. Pharmacol. Res. 2021, 163, 105272. [Google Scholar] [CrossRef]
- Rotoli, B.M.; Barilli, A.; Visigalli, R.; Ferrari, F.; Dall’Asta, V. Endothelial Cell Activation by SARS-CoV-2 Spike S1 Protein: A Crosstalk between Endothelium and Innate Immune Cells. Biomedicines 2021, 9, 1220. [Google Scholar] [CrossRef] [PubMed]
- Gaiani, F.; Rotoli, B.M.; Ferrari, F.; Barilli, A.; Visigalli, R.; Carra, M.C.; de’Angelis, G.L.; de’Angelis, N.; Dall’Asta, V. Monocytes from infliximab-resistant patients with Crohn’s disease exhibit a disordered cytokine profile. Sci. Rep. 2020, 10, 12238. [Google Scholar] [CrossRef] [PubMed]
- Barilli, A.; Visigalli, R.; Ferrari, F.; Di Lascia, M.; Riccardi, B.; Puccini, P.; Dall’Asta, V.; Rotoli, B.M. Organic cation transporters (OCTs/OCTNs) in human primary alveolar epithelial cells. Biochem. Biophys. Res. Commun. 2021, 576, 27–32. [Google Scholar] [CrossRef] [PubMed]
- Barilli, A.; Rotoli, B.M.; Visigalli, R.; Dall’Asta, V. Gliadin activates arginase pathway in RAW264.7 cells and in human monocytes. Biochim. Biophys. Acta 2014, 1842, 1364–1371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moore, W.M.; Webber, R.K.; Jerome, G.M.; Tjoeng, F.S.; Misko, T.P.; Currie, M.G. L-N6-(1-iminoethyl)lysine: A selective inhibitor of inducible nitric oxide synthase. J. Med. Chem. 1994, 37, 3886–3888. [Google Scholar] [CrossRef]
- Rotoli, B.M.; Barilli, A.; Visigalli, R.; Ferrari, F.; Dall’Asta, V. y+LAT1 and y+LAT2 contribution to arginine uptake in different human cell models: Implications in the pathophysiology of Lysinuric Protein Intolerance. J. Cell. Mol. Med. 2020, 24, 921–929. [Google Scholar] [CrossRef] [Green Version]
- Barilli, A.; Rotoli, B.M.; Visigalli, R.; Bussolati, O.; Gazzola, G.C.; Dall’asta, V. Arginine transport in human monocytic leukemia THP-1 cells during macrophage differentiation. J. Leukoc. Biol. 2011, 90, 293–303. [Google Scholar] [CrossRef]
- Rotoli, B.M.; Barilli, A.; Visigalli, R.; Ingoglia, F.; Milioli, M.; Di Lascia, M.; Riccardi, B.; Puccini, P.; Dall’Asta, V. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells. Front. Immunol. 2018, 9, 508. [Google Scholar] [CrossRef]
- Dall’Asta, V.; Bussolati, O.; Sala, R.; Parolari, A.; Alamanni, F.; Biglioli, P.; Gazzola, G.C. Amino acids are compatible osmolytes for volume recovery after hypertonic shrinkage in vascular endothelial cells. Am. J. Physiol. 1999, 276, C865–C872. [Google Scholar] [CrossRef]
- Van der Krogt, G.N.; Ogink, J.; Ponsioen, B.; Jalink, K. A comparison of donor-acceptor pairs for genetically encoded FRET sensors: Application to the Epac cAMP sensor as an example. PLoS ONE 2008, 3, e1916. [Google Scholar] [CrossRef]
- Russo, A.; Ranieri, M.; Di Mise, A.; Dossena, S.; Pellegrino, T.; Furia, E.; Nofziger, C.; Debellis, L.; Paulmichl, M.; Valenti, G.; et al. Interleukin-13 increases pendrin abundance to the cell surface in bronchial NCI-H292 cells via Rho/actin signaling. Pflugers Arch. 2017, 469, 1163–1176. [Google Scholar] [CrossRef] [PubMed]
- Ranieri, M.; Di Mise, A.; Centrone, M.; D’Agostino, M.; Tingskov, S.J.; Venneri, M.; Pellegrino, T.; Difonzo, G.; Caponio, F.; Norregaard, R.; et al. Olive Leaf Extract (OLE) impaired vasopressin-induced aquaporin-2 trafficking through the activation of the calcium-sensing receptor. Sci. Rep. 2021, 11, 4537. [Google Scholar] [CrossRef] [PubMed]
- Grynkiewicz, G.; Poenie, M.; Tsien, R.Y. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 1985, 260, 3440–3450. [Google Scholar] [CrossRef]
- Rembratt, A.; Graugaard-Jensen, C.; Senderovitz, T.; Norgaard, J.P.; Djurhuus, J.C. Pharmacokinetics and pharmacodynamics of desmopressin administered orally versus intravenously at daytime versus night-time in healthy men aged 55-70 years. Eur. J. Clin. Pharmacol. 2004, 60, 397–402. [Google Scholar] [CrossRef] [PubMed]
- Bichet, D.G.; Razi, M.; Lonergan, M.; Arthus, M.F.; Papukna, V.; Kortas, C.; Barjon, J.N. Hemodynamic and coagulation responses to 1-desamino[8-D-arginine] vasopressin in patients with congenital nephrogenic diabetes insipidus. N. Engl. J. Med. 1988, 318, 881–887. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Luo, G.; Jiang, J.; Ma, T.; Lin, X.; Jiang, L.; Cheng, J.; Tao, R. Signaling through hepatocyte vasopressin receptor 1 protects mouse liver from ischemia-reperfusion injury. Oncotarget 2016, 7, 69276–69290. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.P.; Mitchelhill, K.I.; Michell, B.J.; Stapleton, D.; Rodriguez-Crespo, I.; Witters, L.A.; Power, D.A.; Ortiz de Montellano, P.R.; Kemp, B.E. AMP-activated protein kinase phosphorylation of endothelial NO synthase. FEBS Lett. 1999, 443, 285–289. [Google Scholar] [CrossRef] [Green Version]
- Fulton, D.; Gratton, J.P.; Sessa, W.C. Post-translational control of endothelial nitric oxide synthase: Why isn’t calcium/calmodulin enough? J. Pharmacol. Exp. Ther. 2001, 299, 818–824. [Google Scholar]
- Saha, R.N.; Pahan, K. Signals for the induction of nitric oxide synthase in astrocytes. Neurochem Int. 2006, 49, 154–163. [Google Scholar] [CrossRef] [Green Version]
- Rector, T.S.; Bank, A.J.; Tschumperlin, L.K.; Mullen, K.A.; Lin, K.A.; Kubo, S.H. Abnormal desmopressin-induced forearm vasodilatation in patients with heart failure: Dependence on nitric oxide synthase activity. Clin. Pharmacol. Ther. 1996, 60, 667–674. [Google Scholar] [CrossRef]
- Kiyomoto, K.; Tamaki, T.; Tomohiro, A.; Nishiyama, A.; Aki, Y.; Kimura, S.; Abe, Y. Role of nitric oxide in desmopressin-induced vasodilation of microperfused rabbit afferent arterioles. Hypertens. Res. 1997, 20, 29–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Balkom, B.W.; Hoffert, J.D.; Chou, C.L.; Knepper, M.A. Proteomic analysis of long-term vasopressin action in the inner medullary collecting duct of the Brattleboro rat. Am. J. Physiol. Ren. Physiol. 2004, 286, F216–F224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaufmann, J.E.; Iezzi, M.; Vischer, U.M. Desmopressin (DDAVP) induces NO production in human endothelial cells via V2 receptor- and cAMP-mediated signaling. J. Thromb. Haemost. 2003, 1, 821–828. [Google Scholar] [CrossRef] [PubMed]
- Dupont, G.; Combettes, L. What can we learn from the irregularity of Ca2+ oscillations? Chaos 2009, 19, 037112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaspers, L.D.; Pierobon, N.; Thomas, A.P. Intercellular calcium waves integrate hormonal control of glucose output in the intact liver. J. Physiol. 2019, 597, 2867–2885. [Google Scholar] [CrossRef]
- Birnbaumer, M. Vasopressin receptors. Trends Endocrinol. Metab. 2000, 11, 406–410. [Google Scholar] [CrossRef]
- Crudo, F.; Barilli, A.; Mena, P.; Rotoli, B.M.; Rio, D.D.; Dall’Asta, C.; Dellafiora, L. An in vitro study on the transport and phase II metabolism of the mycotoxin alternariol in combination with the structurally related gut microbial metabolite urolithin C. Toxicol. Lett. 2021, 340, 15–22. [Google Scholar] [CrossRef]
- Salhadar, K.; Matthews, A.; Raghuram, V.; Limbutara, K.; Yang, C.R.; Datta, A.; Chou, C.L.; Knepper, M.A. Phosphoproteomic Identification of Vasopressin/cAMP/Protein Kinase A-Dependent Signaling in Kidney. Mol. Pharmacol. 2020, 99, 358–369. [Google Scholar] [CrossRef] [Green Version]
- Moncada, S.; Palmer, R.M.; Higgs, E.A. Nitric oxide: Physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 1991, 43, 109–142. [Google Scholar]
- Dashwood, M.R.; Loesch, A. Inducible nitric oxide synthase and vein graft performance in patients undergoing coronary artery bypass surgery: Physiological or pathophysiological role? Curr. Vasc. Pharmacol. 2014, 12, 144–151. [Google Scholar] [CrossRef]
- Sedoris, K.C.; Ovechkin, A.V.; Gozal, E.; Roberts, A.M. Differential effects of nitric oxide synthesis on pulmonary vascular function during lung ischemia-reperfusion injury. Arch. Physiol. Biochem. 2009, 115, 34–46. [Google Scholar] [CrossRef] [PubMed]
- Maybauer, M.O.; Maybauer, D.M.; Enkhbaatar, P.; Laporte, R.; Wisniewska, H.; Traber, L.D.; Lin, C.; Fan, J.; Hawkins, H.K.; Cox, R.A.; et al. The selective vasopressin type 1a receptor agonist selepressin (FE 202158) blocks vascular leak in ovine severe sepsis*. Crit. Care Med. 2014, 42, e525–e533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene/Protein Name (Gene ID) | Forward Primer | Reverse Primer |
---|---|---|
AVPR1A/V1aR (ID: 552) | CAGCGTGAAGTCCATTTCCC | GCAGACGATGTAAGCCGTCA |
AVPR2/V2R (ID: 554) | CTAGTGGCTTGGGCCTTCTC | TAGGTGCCACGAACACCATC |
ICAM1/ICAM1 (ID: 3383) | TGAACCCCACAGTCACCTATG | CTCGTCCTCTGCGGTCAC |
SELE/ELAM (ID: 6401 | ACCTCCACGGAAGCTATGACT | CAGACCCACACATTGTTGACTT |
IL6/IL-6 (ID: 3569) | AACCTGAACCTTCCAAAGATGG | TCTGGCTTGTTCCTCACTACT |
CCL2/MCP1 (ID: 6347) | CAGCCAGATGCAATCAATGCC | TGGAATCCTGAACCCACTTCT |
NOS2/iNOS (ID: 4843) | Hs01075529_m1 (TaqMan® Assay, ThermoFisher Scientific) | |
NOS3/eNOS (ID: 4846) | TGGTACATGAGCACTGAGATCG | CCACGTTGATTTCCACTGCTG |
RPL15/RPL15 (ID: 6138) | GCAGCCATCAGGTAAGCCAAG | AGCGGACCCTCAGAAGAAAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rotoli, B.M.; Visigalli, R.; Ferrari, F.; Ranieri, M.; Tamma, G.; Dall’Asta, V.; Barilli, A. Desmopressin Stimulates Nitric Oxide Production in Human Lung Microvascular Endothelial Cells. Biomolecules 2022, 12, 389. https://doi.org/10.3390/biom12030389
Rotoli BM, Visigalli R, Ferrari F, Ranieri M, Tamma G, Dall’Asta V, Barilli A. Desmopressin Stimulates Nitric Oxide Production in Human Lung Microvascular Endothelial Cells. Biomolecules. 2022; 12(3):389. https://doi.org/10.3390/biom12030389
Chicago/Turabian StyleRotoli, Bianca Maria, Rossana Visigalli, Francesca Ferrari, Marianna Ranieri, Grazia Tamma, Valeria Dall’Asta, and Amelia Barilli. 2022. "Desmopressin Stimulates Nitric Oxide Production in Human Lung Microvascular Endothelial Cells" Biomolecules 12, no. 3: 389. https://doi.org/10.3390/biom12030389