Association between Vitamin D Receptor Gene Polymorphisms and Periodontal Bacteria: A Clinical Pilot Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Population Study
2.2. Sampling and DNA Extraction
2.3. Identification and Quantification of Periodontal Pathogens
2.4. Determination of VDR Gene Polymorphisms
2.5. Statistical Analysis
3. Results
3.1. Comparison of Allelic Frequencies with Population Databases
3.2. Genotype Association Analysis
3.3. Haplotype Analysis
3.4. Bacterial Load Assessment
3.5. Genotype Association Analysis between Patients with High and Low Bacterial Load
3.6. Haplotype Analysis in Patients with High and Low Bacterial Load
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abrahamian, L.; Pascual, A.; Barallat, L.; Valles, C.; Herrera, D.; Sanz, M.; Nart, J.; Figuero, E. Intra- and Inter-Examiner Reliability in Classifying Periodontitis according to the 2018 Classification of Periodontal Diseases. J. Clin. Periodontol. 2022. [Google Scholar] [CrossRef] [PubMed]
- Sedghi, L.M.; Bacino, M.; Kapila, Y.L. Periodontal Disease: The Good, The Bad, and The Unknown. Front. Cell. Infect. Microbiol. 2021, 11, 766944. [Google Scholar] [CrossRef]
- Caton, J.G.; Armitage, G.; Berglundh, T.; Chapple, I.L.; Jepsen, S.; Kornman, K.S.; Mealey, B.L.; Papapanou, P.N.; Sanz, M.; Tonetti, M.S. A new classification scheme for periodontal and peri-implant diseases and conditions—Introduction and key changes from the 1999 classification. J. Clin. Periodontol. 2018, 89, S1–S8. [Google Scholar] [CrossRef] [PubMed]
- Deo, P.N.; Deshmukh, R. Oral microbiome: Unveiling the fundamentals. J. Oral Maxillofac. Pathol. 2019, 23, 122–128. [Google Scholar] [CrossRef] [PubMed]
- Rosan, B.; Lamont, R.J. Dental plaque formation. Microbes Infect. 2000, 2, 1599–1607. [Google Scholar] [CrossRef]
- Papapanou, P.N.; Park, H.; Cheng, B.; Kokaras, A.; Paster, B.; Burkett, S.; Watson, C.W.; Annavajhala, M.K.; Uhlemann, A.; Noble, J.M. Subgingival microbiome and clinical periodontal status in an elderly cohort: The WHICAP ancillary study of oral health. J. Periodontol. 2020, 91, S56–S67. [Google Scholar] [CrossRef]
- Bakke, D.; Sun, J. Ancient Nuclear Receptor VDR with New Functions: Microbiome and Inflammation. Inflamm. Bowel Dis. 2018, 24, 1149–1154. [Google Scholar] [CrossRef] [Green Version]
- Zoheir, N.; Kurushima, Y.; Lin, G.-H.; Nibali, L. Periodontal infectogenomics: A systematic review update of associations between host genetic variants and subgingival microbial detection. Clin. Oral Investig. 2022, 26, 2209–2221. [Google Scholar] [CrossRef]
- Hajishengallis, G.; Lamont, R.J. Beyond the red complex and into more complexity: The polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol. Oral Microbiol. 2012, 27, 409–419. [Google Scholar] [CrossRef] [Green Version]
- Brodzikowska, A.; Górski, B. Polymorphisms in Genes Involved in Inflammation and Periodontitis: A Narrative Review. Biomolecules 2022, 12, 552. [Google Scholar] [CrossRef]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef] [PubMed]
- Griffen, A.L.; Beall, C.; Campbell, J.H.; Firestone, N.D.; Kumar, P.; Yang, Z.K.; Podar, M.; Leys, E.J. Distinct and complex bacterial profiles in human periodontitis and health revealed by 16S pyrosequencing. ISME J. 2011, 6, 1176–1185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abusleme, L.; Dupuy, A.K.; Dutzan, N.; Silva, N.; Burleson, J.; Strausbaugh, L.D.; Gamonal, J.; Diaz, P.I. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. ISME J. 2013, 7, 1016–1025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haubek, D.; Ennibi, O.-K.; Poulsen, K.; Væth, M.; Poulsen, S.; Kilian, M. Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: A prospective longitudinal cohort study. Lancet 2008, 371, 237–242. [Google Scholar] [CrossRef]
- Chapple, I.L.C.; Bouchard, P.; Cagetti, M.G.; Campus, G.; Carra, M.-C.; Cocco, F.; Nibali, L.; Hujoel, P.; Laine, M.L.; Lingström, P.; et al. Interaction of lifestyle, behaviour or systemic diseases with dental caries and periodontal diseases: Consensus report of group 2 of the joint EFP/ORCA workshop on the boundaries between caries and periodontal diseases. J. Clin. Periodontol. 2017, 44, S39–S51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Batchelor, P. Is periodontal disease a public health problem? Br. Dent. J. 2014, 217, 405–409. [Google Scholar] [CrossRef] [Green Version]
- Santacroce, L.; Sardaro, N.; Topi, S.; Pettini, F.; Bottalico, L.; Cantore, S.; Cascella, G.; Del Prete, R.; Dipalma, G.; Inchingolo, F. The Pivotal Role of Oral Microbiota in Health and Disease. J. Biol. Regul. Homeost. Agents 2020, 34, 733–737. [Google Scholar] [CrossRef]
- De Angelis, P.; Gasparini, G.; Manicone, P.F.; Passarelli, P.C.; Azzolino, D.; Rella, E.; De Rosa, G.; Papi, P.; Pompa, G.; De Angelis, S.; et al. The Effect of an Optimized Diet as an Adjunct to Non-Surgical Periodontal Therapy in Subjects with Periodontitis: A Prospective Study. Healthcare 2022, 10, 583. [Google Scholar] [CrossRef]
- Gardin, C.; Bosco, G.; Ferroni, L.; Quartesan, S.; Rizzato, A.; Tatullo, M.; Zavan, B. Hyperbaric Oxygen Therapy Improves the Osteogenic and Vasculogenic Properties of Mesenchymal Stem Cells in the Presence of Inflammation In Vitro. Int. J. Mol. Sci. 2020, 21, 1452. [Google Scholar] [CrossRef] [Green Version]
- Kapila, Y.L. Oral health’s inextricable connection to systemic health: Special populations bring to bear multimodal relationships and factors connecting periodontal disease to systemic diseases and conditions. Periodontol. 2000 2021, 87, 11–16. [Google Scholar] [CrossRef]
- Scapoli, L.; Carinci, F.; Mucchi, D.; Nota, A.; Caruso, S.; Rossi, D.; Romano, M.; Severino, M. Evaluation of IL6, IL10 and VDR alleles distribution in an Italian large sample of subjects affected by chronic periodontal disease. Int. J. Immunopathol. Pharmacol. 2019, 33, 2058738419840844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ballini, A.; Cantore, S.; Dedola, A.; Santacroce, L.; Laino, L.; Cicciù, M.; Mastrangelo, F. IL-1 haplotype analysis in periodontal disease. J. Biol. Regul. Homeost. Agents 2018, 32, 433–437. [Google Scholar] [PubMed]
- Liu, X.; Li, H. A Systematic Review and Meta-Analysis on Multiple Cytokine Gene Polymorphisms in the Pathogenesis of Periodontitis. Front. Immunol. 2022, 12, 713198. [Google Scholar] [CrossRef]
- Deng, H.; Liu, F.; Pan, Y.; Jin, X.; Wang, H.; Cao, J. BsmI, TaqI, ApaI, and FokI polymorphisms in the vitamin D receptor gene and periodontitis: A meta-analysis of 15 studies including 1338 cases and 1302 controls. J. Clin. Periodontol. 2010, 38, 199–207. [Google Scholar] [CrossRef]
- Ji, X.; Wang, Y.; Cao, C.; Zhong, L. Assessment of the link between Vitamin D receptor TaqI gene polymorphism and periodontitis: A meta-analysis in a Chinese population. Genet. Mol. Res. 2016, 15. [Google Scholar] [CrossRef]
- Nasiri, R.; Mashhadiabbas, F.; Neamatzadeh, H.; Foroughi, E.; Farahnak, S.; Piroozmand, P.; Mazaheri, M.; Zare-Shehneh, M. Association of vitamin D receptor BsmI, TaqI, FokI, and ApaI polymorphisms with susceptibility of chronic periodontitis: A systematic review and meta-analysis based on 38 case–control studies. Dent. Res. J. 2018, 15, 155. [Google Scholar] [CrossRef]
- Yu, X.; Zong, X.; Pan, Y. Associations between vitamin D receptor genetic variants and periodontitis: A meta-analysis. Acta Odontol. Scand. 2019, 77, 484–494. [Google Scholar] [CrossRef]
- Wan, Q.-S.; Li, L.; Yang, S.-K.; Liu, Z.-L.; Song, N. Role of Vitamin D Receptor Gene Polymorphisms on the Susceptibility to Periodontitis: A Meta-Analysis of a Controversial Issue. Genet. Test. Mol. Biomark. 2019, 23, 618–633. [Google Scholar] [CrossRef]
- Usategui-Martín, R.; De Luis-Román, D.A.; Fernández-Gómez, J.M.; Ruiz-Mambrilla, M.; Pérez-Castrillón, J.L. Vitamin D Receptor (VDR) Gene Polymorphisms Modify the Response to Vitamin D Supplementation: A Systematic Review and Meta-Analysis. Nutrients 2022, 14, 360. [Google Scholar] [CrossRef] [PubMed]
- Stucci, L.S.; D’Oronzo, S.; Tucci, M.; Macerollo, A.; Ribero, S.; Spagnolo, F.; Marra, E.; Picasso, V.; Orgiano, L.; Marconcini, R.; et al. Vitamin D in melanoma: Controversies and potential role in combination with immune check-point inhibitors. Cancer Treat. Rev. 2018, 69, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Maxia, C.; Murtas, D.; Corrias, M.; Zucca, I.; Minerba, L.; Piras, F.; Marinelli, C.; Perra, M.T. Vitamin D and vitamin D receptor in patients with ophthalmic pterygium. Eur. J. Histochem. 2017, 61, 2837. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pakpahan, C.; Wungu, C.D.K.; Agustinus, A.; Darmadi, D. Do Vitamin D receptor gene polymorphisms affect bone mass density in men?: A meta-analysis of observational studies. Ageing Res. Rev. 2022, 75, 101571. [Google Scholar] [CrossRef] [PubMed]
- Borges, M.A.T.; De Figueiredo, L.C.; Brito, R.B.D., Jr.; Faveri, M.; Feres, M. Microbiological composition associated with vitamin D receptor gene polymorphism in chronic periodontitis. Braz. Oral Res. 2009, 23, 203–208. [Google Scholar] [CrossRef] [Green Version]
- Lauritano, D.; Candotto, V.; Bignozzi, C.A.; Pazzi, D.; Carinci, F.; Cura, F.; Tagliabue, A.; Tettamanti, L. Zinc plus octenidine: A new formulation for treating periodontal pathogens. A single blind study. J. Biol. Regul. Homeost. Agents 2018, 32, 231–236. [Google Scholar] [PubMed]
- Inchingolo, F.; Martelli, F.S.; Gargiulo Isacco, C.; Borsani, E.; Cantore, S.; Corcioli, F.; Boddi, A.; Nguyễn, K.C.D.; De Vito, D.; Aityan, S.K.; et al. Chronic Periodontitis and Immunity, Towards the Implementation of a Personalized Medicine: A Translational Research on Gene Single Nucleotide Polymorphisms (SNPs) Linked to Chronic Oral Dysbiosis in 96 Caucasian Patients. Biomedicines 2020, 8, 115. [Google Scholar] [CrossRef]
- Torrungruang, K.; Chantarangsu, S.; Sura, T.; Thienpramuk, L. Interplay between vitamin D receptor Fok I polymorphism and smoking influences Porphyromonas gingivalis proportions in subgingival plaque. J. Clin. Periodontol. 2020, 47, 912–920. [Google Scholar] [CrossRef]
- Sun, J.L.; Meng, H.X.; Cao, C.F.; Tachi, Y.; Shinohara, M.; Ueda, M.; Imai, H.; Ohura, K. Relationship between vitamin D receptor gene polymorphism and periodontitis. J. Periodontal Res. 2002, 37, 263–267. [Google Scholar] [CrossRef]
- Hennig, B.J.; Parkhill, J.M.; Chapple, L.L.; Heasman, P.A.; Taylor, J.J. Association of a Vitamin D Receptor Gene Polymorphism With Localized Early-Onset Periodontal Diseases. J. Periodontol. 1999, 70, 1032–1038. [Google Scholar] [CrossRef]
- Yu, B.; Wang, C. Osteoporosis and periodontal diseases—An update on their association and mechanistic links. Periodontol. 2000 2022, 89, 99–113. [Google Scholar] [CrossRef]
- Liu, K.; Han, B.; Hou, J.; Zhang, J.; Su, J.; Meng, H. Expression of vitamin D 1α-hydroxylase in human gingival fibroblasts in vivo. PeerJ 2021, 9, e10279. [Google Scholar] [CrossRef]
- Menzel, L.P.; Ruddick, W.; Chowdhury, M.H.; Brice, D.C.; Clance, R.; Porcelli, E.; Ryan, L.K.; Lee, J.; Yilmaz, O.; Kirkwood, K.; et al. Activation of vitamin D in the gingival epithelium and its role in gingival inflammation and alveolar bone loss. J. Periodontal Res. 2019, 54, 444–452. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhu, W.; Hou, J.; Meng, H. Vitamin D-binding protein expression in healthy tooth and periodontium: An experimental study both in monkeysin vivoand in humansin vitro. J. Periodontal Res. 2017, 52, 755–760. [Google Scholar] [CrossRef] [PubMed]
- Mombelli, A.; McNabb, H.; Lang, N.P. Black-pigmenting Gram-negative bacteria in periodontal disease. I. Topographic distribution in the human dentition. J. Periodontal Res. 1991, 26, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Palmirotta, R.; Ludovici, G.; De Marchis, M.L.; Savonarola, A.; Leone, B.; Spila, A.; De Angelis, F.; Della Morte, D.; Ferroni, P.; Guadagni, F. Preanalytical Procedures for DNA Studies: The Experience of the Interinstitutional Multidisciplinary BioBank (BioBIM). Biopreserv. Biobank. 2011, 9, 35–45. [Google Scholar] [CrossRef]
- Cole, J.R.; Wang, Q.; Cardenas, E.; Fish, J.; Chai, B.; Farris, R.J.; Kulam-Syed-Mohideen, A.S.; McGarrell, D.M.; Marsh, T.; Garrity, G.M.; et al. The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009, 37, D141–D145. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Green Version]
- Aydingöz, I.E.; Bingül, I.; Dogru-Abbasoglu, S.; Vural, P.; Uysal, M. Analysis of Vitamin D Receptor Gene Polymorphisms in Vitiligo. Dermatology 2012, 224, 361–368. [Google Scholar] [CrossRef]
- Howe, K.L.; Achuthan, P.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Azov, A.G.; Bennett, R.; Bhai, J.; et al. Ensembl 2021. Nucleic Acids Res. 2021, 49, D884–D891. [Google Scholar] [CrossRef]
- The 1000 Genomes Project Consortium. A global reference for human genetic variation. Nature 2015, 526, 68–74. [Google Scholar] [CrossRef] [Green Version]
- Solé, X.; Guinó, E.; Valls, J.; Iniesta, R.; Moreno, V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 2006, 22, 1928–1929. [Google Scholar] [CrossRef] [Green Version]
- Yong, Y.; He, L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res. 2005, 15, 97–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Zhang, Z.; He, Z.; Tang, W.; Li, T.; Zeng, Z.; He, L.; Shi, Y. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis (http://analysis.bio-x.cn). Cell Res. 2009, 19, 519–523. [Google Scholar] [CrossRef] [PubMed]
- Hedges, L.V.; Pigott, T.D. The Power of Statistical Tests for Moderators in Meta-Analysis. Psychol. Methods 2004, 9, 426–445. [Google Scholar] [CrossRef] [Green Version]
- Whirl-Carrillo, M.; Huddart, R.; Gong, L.; Sangkuhl, K.; Thorn, C.F.; Whaley, R.; Klein, T.E. An Evidence-Based Framework for Evaluating Pharmacogenomics Knowledge for Personalized Medicine. Clin. Pharmacol. Ther. 2021, 110, 563–572. [Google Scholar] [CrossRef] [PubMed]
- Van Etten, E.; Verlinden, L.; Giulietti, A.; Ramos-Lopez, E.; Branisteanu, D.D.; Ferreira, G.B.; Overbergh, L.; Verstuyf, A.; Bouillon, R.; Roep, B.O.; et al. The vitamin D receptor geneFokI polymorphism: Functional impact on the immune system. Eur. J. Immunol. 2007, 37, 395–405. [Google Scholar] [CrossRef]
- Yang, X.; Ru, J.; Li, Z.; Jiang, X.; Fan, C. Lower vitamin D levels and VDR FokI variants are associated with susceptibility to sepsis: A hospital-based case-control study. Biomarkers 2022, 27, 188–195. [Google Scholar] [CrossRef]
- Giudice, G.; Cutrignelli, D.; Sportelli, P.; Limongelli, L.; Tempesta, A.; Gioia, G.; Santacroce, L.; Maiorano, E.; Favia, G. Rhinocerebral Mucormycosis with Orosinusal Involvement: Diagnostic and Surgical Treatment Guidelines. Endocr. Metab. Immune Disord.-Drug Targets 2017, 16, 264–269. [Google Scholar] [CrossRef]
- Man, A.; Ciurea, C.N.; Pasaroiu, D.; Savin, A.-I.; Toma, F.; Sular, F.; Santacroce, L.; Mare, A. New perspectives on the nutritional factors influencing growth rate of Candida albicans in diabetics. An in vitro study. Memórias Inst. Oswaldo Cruz 2017, 112, 587–592. [Google Scholar] [CrossRef]
- Paster, B.J.; Boches, S.K.; Galvin, J.L.; Ericson, R.E.; Lau, C.N.; Levanos, V.A.; Sahasrabudhe, A.; Dewhirst, F.E. Bacterial Diversity in Human Subgingival Plaque. J. Bacteriol. 2001, 183, 3770–3783. [Google Scholar] [CrossRef] [Green Version]
- Tanner, A.C.R.; Izard, J. Etiology of Oral Disease in View of Microbial Complexity. Oral Biosci. Med. 2005, 2, 209–213. [Google Scholar]
- Mager, D.L.; Ximenez-Fyvie, L.A.; Haffajee, A.D.; Socransky, S.S. Distribution of selected bacterial species on intraoral surfaces. J. Clin. Periodontol. 2003, 30, 644–654. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bjørndal, L.; Larsen, T. Changes in the Cultivable Flora in Deep Carious Lesions following a Stepwise Excavation Procedure. Caries Res. 2000, 34, 502–508. [Google Scholar] [CrossRef] [PubMed]
- Vitt, A.; Babenka, A.; Boström, E.; Gustafsson, A.; Junior, R.L.; Slizen, V.; Sorsa, T.; Tervahartiala, T.; Buhlin, K. Adjunctive Antiseptic Irrigation of Periodontal Pockets: Effects on Microbial and Cytokine Profiles. Dent. J. 2020, 8, 124. [Google Scholar] [CrossRef] [PubMed]
- Kin, L.X.; Butler, C.A.; Slakeski, N.; Hoffmann, B.; Dashper, S.G.; Reynolds, E.C. Metabolic cooperativity between Porphyromonas gingivalis and Treponema denticola. J. Oral Microbiol. 2020, 12, 1808750. [Google Scholar] [CrossRef] [PubMed]
- Ninomiya, M.; Hashimoto, M.; Yamanouchi, K.; Fukumura, Y.; Nagata, T.; Naruishi, K. Relationship of oral conditions to the incidence of infective endocarditis in periodontitis patients with valvular heart disease: A cross-sectional study. Clin. Oral Investig. 2019, 24, 833–840. [Google Scholar] [CrossRef]
- Zeng, H.; Chan, Y.; Gao, W.; Leung, W.K.; Watt, R.M. Diversity of Treponema denticola and Other Oral Treponeme Lineages in Subjects with Periodontitis and Gingivitis. Microbiol. Spectr. 2021, 9, e00701-21. [Google Scholar] [CrossRef]
- Teughels, W.; Van Eldere, J.; Van Steenberghe, D.; Cassiman, J.-J.; Fives-Taylor, P.; Quirynen, M. Influence of Nicotine and Cotinine on Epithelial Colonization by Periodontopathogens. J. Periodontol. 2005, 76, 1315–1322. [Google Scholar] [CrossRef]
- Cogo, K.; Calvi, B.M.; Mariano, F.S.; Franco, G.C.N.; Gonçalves, R.B.; Groppo, F.C. The effects of nicotine and cotinine on Porphyromonas gingivalis colonisation of epithelial cells. Arch. Oral Biol. 2009, 54, 1061–1067. [Google Scholar] [CrossRef]
- Kanmaz, B.; Lamont, G.; Danacı, G.; Gogeneni, H.; Buduneli, N.; Scott, D.A. Microbiological and biochemical findings in relation with clinical periodontal status in active smokers, non-smokers and passive smokers. Tob. Induc. Dis. 2019, 17, 20. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, Y.; Zhang, J.; Cao, P.; Su, W.; Deng, Y.; Zhan, N.; Fu, X.; Huang, Y.; Dong, W. Fusobacterium nucleatum Promotes Metastasis in Colorectal Cancer by Activating Autophagy Signaling via the Upregulation of CARD3 Expression. Theranostics 2020, 10, 323–339. [Google Scholar] [CrossRef]
- Zhang, S.; Li, C.; Liu, J.; Geng, F.; Shi, X.; Li, Q.; Lu, Z.; Pan, Y. Fusobacterium nucleatum promotes epithelial-mesenchymal transiton through regulation of the lncRNA MIR4435-2HG/miR-296-5p/Akt2/SNAI1 signaling pathway. FEBS J. 2020, 287, 4032–4047. [Google Scholar] [CrossRef] [PubMed]
- Inchingolo, F.; Santacroce, L.; Ballini, A.; Topi, S.; DiPalma, G.; Haxhirexha, K.; Bottalico, L.; Charitos, I.A. Oral Cancer: A Historical Review. Int. J. Environ. Res. Public Health 2020, 17, 3168. [Google Scholar] [CrossRef] [PubMed]
- Moraes, S.R.; Siqueira, J.F., Jr.; Rôças, I.N.; Ferreira, M.C.S.; Domingues, R.M.C.P. Clonality of Fusobacterium nucleatum in root canal infections. Oral Microbiol. Immunol. 2002, 17, 394–396. [Google Scholar] [CrossRef] [PubMed]
- Stokowa-Sołtys, K.; Wojtkowiak, K.; Jagiełło, K. Fusobacterium nucleatum—Friend or foe? J. Inorg. Biochem. 2021, 224, 111586. [Google Scholar] [CrossRef]
- Liu, S.; da Cunha, A.P.; Rezende, R.M.; Cialic, R.; Wei, Z.; Bry, L.; Comstock, L.E.; Gandhi, R.; Weiner, H.L. The Host Shapes the Gut Microbiota via Fecal MicroRNA. Cell Host Microbe 2016, 19, 32–43. [Google Scholar] [CrossRef] [Green Version]
Bacterial Species | Primers and Probes | |
---|---|---|
Internal Control Universal Bacterial | Forward | TGGAGCATGTGGTTTAATTCGA |
Reverse | TGCGGGACTTAACCCAACA | |
Probe | CACGAGCTGACGACA(AG)CCATGCA | |
Aggregatibacter actinomycetemcomitans | Forward | CAAGTGTGATTAGGTAGTTGGTGGG |
Reverse | CCTTCCTCATCACCGAAAGAA | |
Probe | ATCGCTAGCTGGTCTGAGAGGATGGCC | |
Porphyromonas gingivalis | Forward | TGCAACTTGCCTTACAGAGGG |
Reverse | ACTCGTATCGCCCGTTATTC | |
Probe | AGCTGTAAGATAGGCATGCGTCCCATTAGCTA | |
Porphyromonas endodontalis | Forward | TCCTACGGGAGGCAGCAGT |
Reverse | GGACTACCAGGGTATCTAATCCTGTT | |
Probe | CGTATTACCGCGGCTGCTGGCAC | |
Treponema denticola | Forward | GGTCTTCTTATGGGTGCTGGGA |
Reverse | CTTCATATTCGCCCGTTGT | |
Probe | GGTCTTCTTATGGGTGCTGTTA | |
Tannerella forsythia | Forward | GACAACCGGATCAGCGAAAT |
Reverse | TCATTGACTTGGCGGATCG | |
Probe | TCAAATTGACACCGGCAACTACGTATAACTCGT | |
Prevotella intermedia | Forward | CCACATATGGCATCTGACGTG |
Reverse | TCAATCTGCACGCTACTTGG | |
Probe | ACCAAAGATTCATCGGTGGAGGATGGG | |
Fusobacterium nucleatum | Forward | CAACCAT TACT T TAACTCTACCATGTTCA |
Reverse | GTTGACTTTACAGAAGGAGATTA TGTAAAAATC | |
Probe | GTTGACTTTACAGA AGGAGATTATGTAAAAATC |
SNPs | Alleles | 1000 Genomes Project Phase 3 | GnomAD Genomes r3.0 | Total 91 Subjects % | p Value * | ||
---|---|---|---|---|---|---|---|
Global | European | Global | European | ||||
VDR FokI rs2228570 | C (F) | 67.2 | 62.2 | 66.4 | 61.7 | 58.8 | 0.24; 0.66; 0.30; 0.66 |
T (f) | 32.8 | 37.8 | 33.6 | 38.3 | 41.2 | ||
VDR BsmI rs1544410 | A (B) | 29.6 | 40.4 | 35.1 | 40.2 | 20.3 | 0.13; 0.001; 0.017; 0.001 |
G (b) | 70.4 | 59.6 | 64.9 | 59.8 | 79.7 | ||
VDR ApaI rs7975232 | A (A) | 51.5 | 55.5 | 55.3 | 52.7 | 43.4 | 0.22; 0.07; 0.08; 0.15 |
C (a) | 48.5 | 44.5 | 44.7 | 47.3 | 56.6 | ||
VDR TaqI rs731236 | T (T) | 72.3 | 60.0 | 66.1 | 60.4 | 80.2 | 0.18; 0.002; 0.002; 0.002 |
C (t) | 27.7 | 40.0 | 33.9 | 39.6 | 19.8 |
Health Controls (n = 41) | Periodontitis pts (n = 50) | p Value | |||
---|---|---|---|---|---|
VDR FokI rs2228570 Exon2 c.2T > C (f > F) * p.Met1Thr | Genotypes (%) | C/C (F/F) | 17 (41) | 14 (28) | 0.19 |
C/T (F/f) | 20 (49) | 25 (50) | |||
T/T (f/f) | 4 (10) | 11 (22) | |||
Alleles (%) | C (F) | 54 (66) | 53 (53) | 0.079 | |
T (f) | 28 (34) | 47 (47) | |||
HW (p) | 0.74 | 1 | |||
VDR BsmI rs1544410 Intron 8 c.1024 + 283G > A(b > B) * | Genotypes (%) | A/A (B/B) | 3 (7) | 1 (2) | |
A/G (B/b) | 21 (51) | 8 (16) | 0.0001 | ||
G/G (b/b) | 17 (41) | 41 (82) | |||
Alleles (%) | A (B) | 27 (33) | 10 (10) | 0.0003 | |
G (b) | 55 (67) | 90 (90) | |||
HW (p) | 0.48 | 0.39 | |||
VDR ApaI rs7975232 Intron 8 c.1025−49A > C(A > c) * | Genotypes (%) | A/A (A/A) | 10 (24) | 5 (10) | |
A/C (A/a) | 23 (56) | 26 (52) | 0.064 | ||
C/C (a/a) | 8 (20) | 19 (38) | |||
Alleles (%) | A (A) | 43 (52) | 36 (36) | 0.026 | |
C (a) | 39 (48) | 64 (64) | |||
HW (p) | 0.54 | 0.54 | |||
VDR TaqI rs731236 Exon 9 c.1056T > C (T > t) p.Ile352= | Genotypes (%) | T/T (T/T) | 15 (37) | 45 (90) | |
T/C (T/t) | 21 (51) | 5 (10) | <0.00001 | ||
C/C (t/tT) | 5 (12) | 0 (0) | |||
Alleles (%) | T (T) | 51 (62) | 95 (95) | <0.00001 | |
C (t) | 31 (38) | 5 (5) | |||
HW (p) | 0.74 | 1 |
Haplotypes | Frequency | χ2 | p Value | Odds Ratio [95% CI] | |||||
---|---|---|---|---|---|---|---|---|---|
FokI | BsmI | ApaI | TaqI | Total | Health Controls | Patients | |||
C (F) | G (b) | C (a) | T (T) | 0.2179 | 0.172 | 0.260 | 2.189 | 0.139059 | 1.728 [0.833–3.583] |
T (f) | G (b) | C (a) | T (T) | 0.182 | 0.0 | 0.288 | 28.586 | 0.0000000936 | - |
C (F) | G (b) | A (A) | T (T) | 0.158 | 0.163 | 0.200 | 0.469 | 0.493583 | 1.306 [0.607–2.811] |
C (F) | A(B) | C (a) | T (T) | 0.0995 | 0.111 | 0.050 | 2.277 | 0.131400 | 0.425 [0.136–1.326] |
T (f) | G (b) | A (A) | T (T) | 0.0964 | 0.057 | 0.112 | 1.814 | 0.178070 | 2.131 [0.694–6.543] |
C (F) | G (b) | A (A) | C (t) | 0.0806 | 0.109 | 0.0 | 10.351 | 0.001302 | 0.000 [0.000–0.002] |
T (f) | A (B) | A (A) | C (t) | 0.0425 | 0.100 | 0.0 | 10.304 | 0.001335 | - |
T (f) | A (B) | A (A) | T (T) | 0.0334 | 0.049 | 0.0 | 4.921 | 0.026577 | - |
C (F) | G (b) | C (a) | C (t) | 0.0319 | 0.104 | 0.0 | 10.749 | 0.001051 | - |
T (f) | G (b) | A(A) | C(t) | 0.0233 | 0.047 | 0.027 | 0.475 | 0.490768 | 0.578 [0.119–2.798] |
T (f) | A (B) | C (a) | T (T) | 0.0151 | 0.070 | 0.030 | 1.534 | 0.215636 | 0.415 [0.099–1.736] |
| |||
D’ | VDR BsmI rs1544410 | VDR ApaI rs7975232 | VDR TaqI rs731236 |
VDR FokI rs2228570 | 0.033 | 0.058 | 0.013 |
VDR BsmI rs1544410 | - | 0.009 | 0.150 |
VDR ApaI rs7975232 | - | - | 0.545 |
Aggregatibacter Actinomycetemcomitans | Porphyromonas Gingivalis | Porphyromonas Endodontalis | Treponema Denticola | Tannerella Forsythia | Prevotella Intermedia | Fusobacter Nucleatum | |
---|---|---|---|---|---|---|---|
Health controls (n = 41) | |||||||
Media * | 25 | 243 | 859 | 245 | 305 | 165 | 17,047 |
SD | 17 | 168 | 394 | 202 | 210 | 134 | 13,540 |
Range * | 0–76 | 32–744 | 321–1940 | 87–1200 | 87–980 | 34–543 | 1340–45,570 |
Periodontitis pts (N = 50) | |||||||
Media * | 264,331 | 3,963,445 | 3,962,550 | 373,472 | 363,527 | 1,466,116 | 936,526 |
SD | 775,494 | 14,409,905 | 12,856,465 | 1,251,967 | 1,024,361 | 8,374 | 141,000 |
Range * | 0–4,950,000 | 256–78,100,000 | 351–83,500,000 | 0–6,300,000 | 0–6.200.000 | 542–31,800,000 | 0–14,000,000 |
Cut off used to divide patients into 2 groups | 100,000 | 100,000 | 15,000 | 10,000 | 100,000 | 100,000 | 100,000 |
Patients < cut off (Low) | 36 | 28 | 26 | 22 | 33 | 27 | 21 |
Patients > cut off (High) | 14 | 22 | 24 | 28 | 17 | 23 | 29 |
Bacteria | SNP | Genotype | Low (%) | High (%) | p Value | Model | Genotype | OR (95% CI) | p Value |
---|---|---|---|---|---|---|---|---|---|
Aggregatibacter Actinomycetemcomitans Patients LOW N = 36 Patients HIGH N = 14 | FokI rs2228570 | C/C (F/F) | 13 (36) | 1 (7) | 0.034708 | Codominant | C/T | 0.10 (0.01–0.87) | 0.025 |
C/T (F/f) | 14 (39) | 11 (79) | Dominant | C/T-T/T | 0.14 (0.02–1.16) | 0.025 | |||
T/T (f/f) | 9 (25) | 2 (14) | Overdominant | C/T | 0.17 (0.004–0.73) | 0.0099 | |||
Porphyromonas Gingivalis Patients LOW N = 28 Patients HIGH N = 22 | FokI rs2228570 | C/C (F/F) | 12 (43) | 2 (9) | 0.022173 | Codominant | C/T | 0.11 (0.02–0.61) | 0.016 |
C/T (F/f) | 10 (36) | 15 (68) | Dominant | C/T-T/T | 0.13 (0.03–0.68) | 0.0057 | |||
T/T (f/f) | 6 (21) | 5 (23) | Overdominant | C/T | 0.26 (0.08–0.85) | 0.021 | |||
Porphyromonas endodontalis Patients LOW N = 26 Patients HIGH N = 24 | FokI rs2228570 | C/C (F/F) | 12 (46) | 2 (8) | 0.010462 | Codominant | C/T | 0.09 (0.02–0.52) | 0.007 |
C/T (F/f) | 9 (35) | 16 (67) | T/T | 0.14 (0.02–0.94) | |||||
T/T (f/f) | 5 (19) | 6 (25) | Dominant | C/T-T/T | 0.11 (0.02–0.55) | 0.0019 | |||
Overdominant | C/T | 0.26 (0.08–0.85) | 0.022 | ||||||
Treponema Denticola Patients LOW N = 22 Patients HIGH N = 28 | FokI rs2228570 | C/C (F/F) | 10 (45) | 4 (14) | 0.045747 | Codominat | C/T | 0.23 (0.05–0.77) | 0.043 |
C/T (F/f) | 9 (41) | 16 (57) | T/T | 0.15 (0.03–0.87) | |||||
T/T (f/f) | 3 (14) | 8 (29) | Dominant | C/T-T/T | 0.20 (0.05–0.77) | 0.014 | |||
Tannerella Forsythia Patients LOW N = 33 Patients HIGH N = 17 | FokI rs2228570 | C/C (F/F) | 13 (39) | 1 (6) | 0.034969 | Codominat | C/T | 0.08 (0.01–0.74) | 0.02 |
C/T (F/f) | 13 (39) | 12 (71) | Dominant | C/T-T/T | 0.10 (0.01–0.82) | 0.0064 | |||
T/T (f/f) | 7 (21) | 4 (24) | Overdominant | C/T | 0.27 (0.08–0.95) | 0.035 | |||
Prevotella Intermedia Patients LOW N = 27 Patients HIGH N = 23 | FokI rs2228570 | C/C (F/F) | 13 (48) | 1 (4) | 0.002382 | Codominat | C/T T/T | 0.04 (0.00–0.39) 0.06 (0.01–0.42) | 0.0009 |
C/T (F/f) | 9 (33) | 16 (70) | Dominant | C/T-T/T | 0.05 (0.01–0.42) | 0.0002 | |||
T/T (f/f) | 5 (19) | 6 (26) | Overdominant | C/T | 0.22 (0.07–0.72) | 0.0098 | |||
Fusobacter Nucleatum Patients LOW N = 21 Patients HIGH N = 29 | BsmI rs1544410 | A/A (B/B) | 1 (5) | 0 (0) | 0.049991 | Codominat | A/G | 5.79 (1.03–32.49) | 0.041 |
A/G (B/b) | 6 (29) | 2 (7) | Dominant | A/G-A/A | 6.75 (1.23–36.91) | 0.016 | |||
G/G (b/b) | 14 (67) | 27 (93) | Overdominant | A/G | 5.40 (0.97–30.17) | 0.038 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cafiero, C.; Grippaudo, C.; Dell’Aquila, M.; Cimmino, P.; D’Addona, A.; De Angelis, P.; Ottaiano, M.P.; Costagliola, D.; Benincasa, G.; Micera, A.; et al. Association between Vitamin D Receptor Gene Polymorphisms and Periodontal Bacteria: A Clinical Pilot Study. Biomolecules 2022, 12, 833. https://doi.org/10.3390/biom12060833
Cafiero C, Grippaudo C, Dell’Aquila M, Cimmino P, D’Addona A, De Angelis P, Ottaiano MP, Costagliola D, Benincasa G, Micera A, et al. Association between Vitamin D Receptor Gene Polymorphisms and Periodontal Bacteria: A Clinical Pilot Study. Biomolecules. 2022; 12(6):833. https://doi.org/10.3390/biom12060833
Chicago/Turabian StyleCafiero, Concetta, Cristina Grippaudo, Marco Dell’Aquila, Pasquale Cimmino, Antonio D’Addona, Paolo De Angelis, Maria Pia Ottaiano, Domenico Costagliola, Giulio Benincasa, Alessandra Micera, and et al. 2022. "Association between Vitamin D Receptor Gene Polymorphisms and Periodontal Bacteria: A Clinical Pilot Study" Biomolecules 12, no. 6: 833. https://doi.org/10.3390/biom12060833
APA StyleCafiero, C., Grippaudo, C., Dell’Aquila, M., Cimmino, P., D’Addona, A., De Angelis, P., Ottaiano, M. P., Costagliola, D., Benincasa, G., Micera, A., Santacroce, L., & Palmirotta, R. (2022). Association between Vitamin D Receptor Gene Polymorphisms and Periodontal Bacteria: A Clinical Pilot Study. Biomolecules, 12(6), 833. https://doi.org/10.3390/biom12060833