PIP2-Effector Protein MPRIP Regulates RNA Polymerase II Condensation and Transcription
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures and Transfections
2.2. Constructs and Antibodies
- Anti-MPRIP antibodies: HPA022901 (Sigma, MO, USA) and sc-515720 (Santa Cruz, TX, USA);
- Anti-RNAPII CTD Phospho S5 antibodies: ab5131 and ab5408 (Abcam, Cambridge, UK);
- Anti-RNAPII CTD Phospho Tyr1 antibodies: 61383 and 91219 (Active Motif, CA, USA);
- Anti-RNAPII CTD Phospho S2 antibody: ab5095 (Abcam, Cambridge, UK);
- Anti-BrdU antibody: ab152095 (Abcam, Cambridge, UK);
- Anti-PP1 antibody: HPA046833 (Sigma, MO, USA);
- Anti-PI(4,5)P2 antibody: Z A045, clone 2C11 (Echelon Biosciences Inc., Salt Lake City, UT, USA);
- Anti-beta-Actin antibody: ab8227 (Abcam, Cambridge, UK);
- Anti-MYO1C antibody, detects all isoforms: A, B (Nuclear Myosin I) and C; HPA001768 (Merck, NJ, USA);
- Anti-GFP antibody: ab6556 (Abcam, Cambridge, UK).
- Goat anti-Mouse IgM (Heavy chain) Cross-Adsorbed, Alexa Fluor 568, A-21043 (Invitrogen, MA, USA);
- Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor 488, A-11029 (Invitrogen, MA, USA);
- Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor 568, A-11031 (Invitrogen, MA, USA);
- Goat anti-Rabbit IgG (H+L) Cross-Adsorbed, Alexa Fluor 568, A-11011 (Invitrogen, MA, USA);
- Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor 488, A-11034 (Invitrogen, MA, USA);
- Goat anti-Rat IgG (H+L) Cross-Adsorbed, Alexa Fluor 488, A-11006 (Invitrogen, MA, USA).
- IRDye 680RD Donkey anti-Mouse IgG, 926-68072 (LI-COR Biosciences, NE, USA);
- IRDye 800CW Donkey anti-Mouse IgG, 926-32212 (LI-COR Biosciences, NE, USA);
- IRDye 800CW Donkey anti-Rabbit IgG, 925-32213 (LICOR Biosciences, NE, USA);
- IRDye 680RD Donkey anti-Rabbit IgG, 926-68073 (LI-COR Biosciences, NE, USA);
- IRDye 800CW Goat anti-Rat IgG, 926-32219 (LI-COR Biosciences, NE, USA).
2.3. Immunofluorescence Labeling
2.4. Confocal and Stimulated Emission Depletion (STED) Microscopy
2.5. Image Analysis
2.6. Pull-Down Assays
- Control beads for PIP2 pull-downs, P-B000 (Echelon Biosciences Inc., UT, USA);
- PI(4,5)P2 covered beads, P-B045A (Echelon Biosciences Inc., UT, USA); and
- Anti-GFP mAb-Magnetic Beads, MAD153-11 (MBL International, MO, USA).
2.7. RNA Isolation Procedure
2.8. Reverse Transcription of RNA
2.9. Real-Time Quantitative PCR
3. Results
3.1. Nuclear MPRIP Localization Correlates with the Phosphorylated Forms of RNAPII
3.2. MPRIP Regulates Transcriptional Output and the Number of the RNAPII Condensates
3.3. MPRIP Affects the Association of RNAPII with PIP2
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eick, D.; Geyer, M. The RNA polymerase II carboxy-terminal domain (CTD) code. Chem. Rev. 2013, 113, 8456–8490. [Google Scholar] [CrossRef]
- Harlen, K.M.; Churchman, L.S. The code and beyond: Transcription regulation by the RNA polymerase II carboxy-terminal domain. Nat. Rev. Mol. Cell Biol. 2017, 18, 263–273. [Google Scholar] [CrossRef]
- Bartman, C.R.; Hamagami, N.; Keller, C.A.; Giardine, B.; Hardison, R.C.; Blobel, G.A.; Raj, A. Transcriptional Burst Initiation and Polymerase Pause Release Are Key Control Points of Transcriptional Regulation. Mol. Cell 2019, 73, 519–532. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Qi, Y.; Wu, Z.; Wang, X.; Li, J.; Zhao, D.; Hou, H.; Li, Y.; Yu, Z.; Liu, W.; et al. Structural insights into preinitiation complex assembly on core promoters. Science 2021, 372, eaba8490. [Google Scholar] [CrossRef]
- Hofmann, W.A.; Stojiljkovic, L.; Fuchsova, B.; Vargas, G.M.; Mavrommatis, E.; Philimonenko, V.; Kysela, K.; Goodrich, J.A.; Lessard, J.L.; Hope, T.J.; et al. Actin is part of pre-initiation complexes and is necessary for transcription by RNA polymerase II. Nat. Cell Biol. 2004, 6, 1094–1101. [Google Scholar] [CrossRef]
- Lu, H.; Yu, D.; Hansen, A.S.; Ganguly, S.; Liu, R.; Heckert, A.; Darzacq, X.; Zhou, Q. Phase-separation mechanism for C-terminal hyperphosphorylation of RNA polymerase II. Nature 2018, 558, 318–323. [Google Scholar] [CrossRef]
- Czudnochowski, N.; Bösken, C.A.; Geyer, M. Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition. Nat. Commun. 2012, 3, 842. [Google Scholar] [CrossRef] [Green Version]
- Gibbs, E.B.; Laremore, T.N.; Usher, G.A.; Portz, B.; Cook, E.C.; Showalter, S.A. Substrate Specificity of the Kinase P-TEFb towards the RNA Polymerase II C-Terminal Domain. Biophys. J. 2017, 113, 1909–1911. [Google Scholar] [CrossRef] [Green Version]
- Mayfield, J.E.; Irani, S.; Escobar, E.E.; Zhang, Z.; Burkholder, N.T.; Robinson, M.R.; Mehaffey, M.R.; Sipe, S.N.; Yang, W.; Prescott, N.A.; et al. Tyr1 phosphorylation promotes phosphorylation of Ser2 on the C-terminal domain of eukaryotic RNA polymerase II by P-TEFb. eLife 2019, 8, e48725. [Google Scholar] [CrossRef]
- Core, L.; Adelman, K. Promoter-proximal pausing of RNA polymerase II: A nexus of gene regulation. Genes Dev. 2019, 33, 960–982. [Google Scholar] [CrossRef] [Green Version]
- Adelman, K.; Lis, J.T. Promoter-proximal pausing of RNA polymerase II: Emerging roles in metazoans. Nat. Rev. Genet. 2012, 13, 720–731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pancholi, A.; Klingberg, T.; Zhang, W.; Prizak, R.; Mamontova, I.; Noa, A.; Sobucki, M.; Kobitski, A.Y.; Nienhaus, G.U.; Zaburdaev, V.; et al. RNA polymerase II clusters form in line with surface condensation on regulatory chromatin. Mol. Syst. Biol. 2021, 17, e10272. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.E.; Manteiga, J.C.; Henninger, J.E.; Sabari, B.R.; Dall’Agnese, A.; Hannett, N.M.; Spille, J.-H.; Afeyan, L.K.; Zamudio, A.V.; Shrinivas, K.; et al. Pol II phosphorylation regulates a switch between transcriptional and splicing condensates. Nature 2019, 572, 543–548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collin, P.; Jeronimo, C.; Poitras, C.; Robert, F. RNA Polymerase II CTD Tyrosine 1 Is Required for Efficient Termination by the Nrd1-Nab3-Sen1 Pathway. Mol. Cell 2019, 73, 655–669.e7. [Google Scholar] [CrossRef] [Green Version]
- Shah, N.; Maqbool, M.A.; Yahia, Y.; El Aabidine, A.Z.; Esnault, C.; Forné, I.; Decker, T.-M.; Martin, D.; Schüller, R.; Krebs, S.; et al. Tyrosine-1 of RNA Polymerase II CTD Controls Global Termination of Gene Transcription in Mammals. Mol. Cell 2018, 69, 48–61.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herzel, L.; Ottoz, D.S.M.; Alpert, T.; Neugebauer, K.M. Splicing and transcription touch base: Co-transcriptional spliceosome assembly and function. Nat. Rev. Mol. Cell Biol. 2017, 18, 637–650. [Google Scholar] [CrossRef]
- Castano, E.; Yildirim, S.; Fáberová, V.; Krausová, A.; Uličná, L.; Paprčková, D.; Sztacho, M.; Hozák, P. Nuclear Phosphoinositides—Versatile Regulators of Genome Functions. Cells 2019, 8, 649. [Google Scholar] [CrossRef] [Green Version]
- Hoboth, P.; Šebesta, O.; Hozák, P. How Single-Molecule Localization Microscopy Expanded Our Mechanistic Understanding of RNA Polymerase II Transcription. Int. J. Mol. Sci 2021, 22, 6694. [Google Scholar] [CrossRef]
- Hoboth, P.; Šebesta, O.; Sztacho, M.; Castano, E.; Hozák, P. Dual-color dSTORM imaging and ThunderSTORM image reconstruction and analysis to study the spatial organization of the nuclear phosphatidylinositol phosphates. MethodsX 2021, 8, 101372. [Google Scholar] [CrossRef]
- Hoboth, P.; Sztacho, M.; Šebesta, O.; Schätz, M.; Castano, E.; Hozák, P. Nanoscale mapping of nuclear phosphatidylinositol phosphate landscape by dual-color dSTORM. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2021, 1866, 158890. [Google Scholar] [CrossRef]
- Sobol, M.; Krausová, A.; Yildirim, S.; Kalasová, I.; Fáberová, V.; Vrkoslav, V.; Philimonenko, V.; Marášek, P.; Pastorek, L.; Čapek, M.; et al. Nuclear phosphatidylinositol 4,5-bisphosphate islets contribute to efficient RNA polymerase II-dependent transcription. J. Cell Sci. 2018, 131, jcs211094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sobol, M.; Yildirim, S.; Philimonenko, V.V.; Marášek, P.; Castaño, E.; Hozák, P. UBF complexes with phosphatidylinositol 4,5-bisphosphate in nucleolar organizer regions regardless of ongoing RNA polymerase I activity. Nucleus 2013, 4, 478–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tabellini, G.; Bortul, R.; Santi, S.; Riccio, M.; Baldini, G.; Cappellini, A.; Billi, A.M.; Berezney, R.; Ruggeri, A.; Cocco, L.; et al. Diacylglycerol kinase-θ is localized in the speckle domains of the nucleus. Exp. Cell Res. 2003, 287, 143–154. [Google Scholar] [CrossRef] [PubMed]
- Osborne, S.L.; Thomas, C.L.; Gschmeissner, S.; Schiavo, G. Nuclear PtdIns(4,5)P2 assembles in a mitotically regulated particle involved in pre-mRNA splicing. J. Cell Sci. 2001, 114 Pt 13, 2501–2511. [Google Scholar] [CrossRef]
- Guillen-Chable, F.; Bayona, A.; Rodríguez-Zapata, L.C.; Castano, E. Phase Separation of Intrinsically Disordered Nucleolar Proteins Relate to Localization and Function. Int. J. Mol. Sci. 2021, 22, 13095. [Google Scholar] [CrossRef]
- Yildirim, S.; Castano, E.; Sobol, M.; Philimonenko, V.V.; Dzijak, R.; Venit, T.; Hozák, P. Involvement of phosphatidylinositol 4,5-bisphosphate in RNA polymerase I transcription. J. Cell Sci. 2013, 126 Pt 12, 2730–2739. [Google Scholar] [CrossRef] [Green Version]
- Sztacho, M.; Šalovská, B.; Červenka, J.; Balaban, C.; Hoboth, P.; Hozák, P. Limited Proteolysis-Coupled Mass Spectrometry Identifies Phosphatidylinositol 4,5-Bisphosphate Effectors in Human Nuclear Proteome. Cells 2021, 10, E68. [Google Scholar] [CrossRef]
- Balaban, C.; Sztacho, M.; Blažíková, M.; Hozák, P. The F-Actin-Binding MPRIP Forms Phase-Separated Condensates and Associates with PI(4,5)P2 and Active RNA Polymerase II in the Cell Nucleus. Cells 2021, 10, 848. [Google Scholar] [CrossRef]
- Hu, P.; Wu, S.; Hernandez, N. A role for β-actin in RNA polymerase III transcription. Genes Dev. 2004, 18, 3010–3015. [Google Scholar] [CrossRef] [Green Version]
- Kukalev, A.; Nord, Y.; Palmberg, C.; Bergman, T.; Percipalle, P. Actin and hnRNP U cooperate for productive transcription by RNA polymerase II. Nat. Struct. Mol. Biol. 2005, 12, 238–244. [Google Scholar] [CrossRef]
- Obrdlik, A.; Kukalev, A.; Louvet, E.; Farrants, A.K.; Caputo, L.; Percipalle, P. The histone acetyltransferase PCAF associates with actin and hnRNP U for RNA polymerase II transcription. Mol. Cell Biol. 2008, 28, 6342–6357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Percipalle, P.; Fomproix, N.; Kylberg, K.; Miralles, F.; Bjorkroth, B.; Daneholt, B.; Visa, N. An actin-ribonucleoprotein interaction is involved in transcription by RNA polymerase II. Proc. Natl. Acad. Sci. USA 2003, 100, 6475–6480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Percipalle, P.; Jonsson, A.; Nashchekin, D.; Karlsson, C.; Bergman, T.; Guialis, A.; Daneholt, B. Nuclear actin is associated with a specific subset of hnRNP A/B-type proteins. Nucleic Acids Res. 2002, 30, 1725–1734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Percipalle, P.; Zhao, J.; Pope, B.; Weeds, A.; Lindberg, U.; Daneholt, B. Actin Bound to the Heterogeneous Nuclear Ribonucleoprotein Hrp36 Is Associated with Balbiani Ring mRNA from the Gene to Polysomes. J. Cell Biol. 2001, 153, 229–236. [Google Scholar] [CrossRef] [Green Version]
- Viita, T.; Kyheröinen, S.; Prajapati, B.; Virtanen, J.; Frilander, M.J.; Varjosalo, M.; Vartiainen, M.K. Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. J. Cell Sci. 2019, 132, jcs226852. [Google Scholar] [CrossRef] [Green Version]
- Serebryannyy, L.A.; Parilla, M.; Annibale, P.; Cruz, C.M.; Laster, K.; Gratton, E.; Kudryashov, D.; Kosak, S.T.; Gottardi, C.J.; de Lanerolle, P. Persistent nuclear actin filaments inhibit transcription by RNA polymerase II. J. Cell Sci. 2016, 129, 3412–3425. [Google Scholar] [CrossRef] [Green Version]
- Cho, W.-K.; Jayanth, N.; English, B.P.; Inoue, T.; Andrews, J.O.; Conway, W.; Grimm, J.B.; Spille, J.-H.; Lavis, L.D.; Lionnet, T.; et al. RNA Polymerase II cluster dynamics predict mRNA output in living cells. eLife 2016, 5, e13617. [Google Scholar] [CrossRef] [Green Version]
- Plessner, M.; Melak, M.; Chinchilla, P.; Baarlink, C.; Grosse, R. Nuclear F-actin Formation and Reorganization upon Cell Spreading*♦. J. Biol. Chem. 2015, 290, 11209–11216. [Google Scholar] [CrossRef] [Green Version]
- Wei, M.; Fan, X.; Ding, M.; Li, R.; Shao, S.; Hou, Y.; Meng, S.; Tang, F.; Li, C.; Sun, Y. Nuclear actin regulates inducible transcription by enhancing RNA polymerase II clustering. Sci. Adv. 2020, 6, eaay6515. [Google Scholar] [CrossRef] [Green Version]
- Ulferts, S.; Prajapati, B.; Grosse, R.; Vartiainen, M.K. Emerging Properties and Functions of Actin and Actin Filaments Inside the Nucleus. Cold Spring Harb. Perspect. Biol. 2021, 13, a040121. [Google Scholar] [CrossRef]
- Dunn, K.W.; Kamocka, M.M.; McDonald, J.H. A practical guide to evaluating colocalization in biological microscopy. Am. J. Physiol. Cell Physiol. 2011, 300, C723–C742. [Google Scholar] [CrossRef] [Green Version]
- Descostes, N.; Heidemann, M.; Spinelli, L.; Schüller, R.; Maqbool, M.A.; Fenouil, R.; Koch, F.; Innocenti, C.; Gut, M.; Gut, I.; et al. Tyrosine phosphorylation of RNA polymerase II CTD is associated with antisense promoter transcription and active enhancers in mammalian cells. eLife 2014, 3, e02105. [Google Scholar] [CrossRef] [PubMed]
- Gressel, S.; Schwalb, B.; Decker, T.M.; Qin, W.; Leonhardt, H.; Eick, D.; Cramer, P. CDK9-dependent RNA polymerase II pausing controls transcription initiation. eLife 2017, 6, e29736. [Google Scholar] [CrossRef] [PubMed]
- Jao, C.Y.; Salic, A. Exploring RNA transcription and turnover in vivo by using click chemistry. Proc. Natl. Acad. Sci. USA 2008, 105, 15779–15784. [Google Scholar] [CrossRef] [Green Version]
- van’t Sant, L.J.; White, J.J.; Hoeijmakers, J.H.J.; Vermeij, W.P.; Jaarsma, D. In vivo 5-ethynyluridine (EU) labelling detects reduced transcription in Purkinje cell degeneration mouse mutants, but can itself induce neurodegeneration. Acta Neuropathol. Commun. 2021, 9, 94. [Google Scholar] [CrossRef]
- Galganski, L.; Urbanek, M.O.; Krzyzosiak, W.J. Nuclear speckles: Molecular organization, biological function and role in disease. Nucleic Acids Res. 2017, 45, 10350–10368. [Google Scholar] [CrossRef] [Green Version]
- Hilbert, L.; Sato, Y.; Kuznetsova, K.; Bianucci, T.; Kimura, H.; Jülicher, F.; Honigmann, A.; Zaburdaev, V.; Vastenhouw, N.L. Transcription organizes euchromatin via microphase separation. Nat. Commun. 2021, 12, 1360. [Google Scholar] [CrossRef] [PubMed]
- Gressel, S.; Schwalb, B.; Cramer, P. The pause-initiation limit restricts transcription activation in human cells. Nat. Commun. 2019, 10, 3603. [Google Scholar] [CrossRef] [Green Version]
- Shao, W.; Zeitlinger, J. Paused RNA polymerase II inhibits new transcriptional initiation. Nat. Genet. 2017, 49, 1045–1051. [Google Scholar] [CrossRef]
- Steurer, B.; Janssens, R.C.; Geverts, B.; Geijer, M.E.; Wienholz, F.; Theil, A.F.; Chang, J.; Dealy, S.; Pothof, J.; van Cappellen, W.A.; et al. Live-cell analysis of endogenous GFP-RPB1 uncovers rapid turnover of initiating and promoter-paused RNA Polymerase II. Proc. Natl. Acad. Sci. USA 2018, 115, E4368–E4376. [Google Scholar] [CrossRef] [Green Version]
- Dopie, J.; Skarp, K.-P.; Rajakylä, E.K.; Tanhuanpää, K.; Vartiainen, M.K. Active maintenance of nuclear actin by importin 9 supports transcription. Proc. Natl. Acad. Sci. USA 2012, 109, E544–E552. [Google Scholar] [CrossRef] [Green Version]
- Hyrskyluoto, A.; Vartiainen, M.K. Regulation of nuclear actin dynamics in development and disease. Curr. Opin. Cell Biol. 2020, 64, 18–24. [Google Scholar] [CrossRef] [PubMed]
- Boehning, M.; Dugast-Darzacq, C.; Rankovic, M.; Hansen, A.S.; Yu, T.; Marie-Nelly, H.; Mcswiggen, D.T.; Kokic, G.; Dailey, G.M.; Cramer, P.; et al. RNA polymerase II clustering through carboxy-terminal domain phase separation. Nat. Struct. Mol. Biol. 2018, 25, 833–840. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Venkata, N.C.; Hernandez Gonzalez, G.A.; Khanna, N.; Belmont, A.S. Gene expression amplification by nuclear speckle association. J. Cell Biol. 2020, 219, e201904046. [Google Scholar] [CrossRef]
- Ilik, I.A.; Aktas, T. Nuclear speckles: Dynamic hubs of gene expression regulation. FEBS J. 2022, 289, 7234–7245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, Y.; Chen, Y.; Gholamalamdari, O.; Wang, Y.; Ma, J.; Belmont, A.S. TSA-seq reveals a largely conserved genome organization relative to nuclear speckles with small position changes tightly correlated with gene expression changes. Genome Res. 2020, 31, 251–264. [Google Scholar] [CrossRef] [PubMed]
- Forero-Quintero, L.S.; Raymond, W.; Handa, T.; Saxton, M.N.; Morisaki, T.; Kimura, H.; Bertrand, E.; Munsky, B.; Stasevich, T.J. Live-cell imaging reveals the spatiotemporal organization of endogenous RNA polymerase II phosphorylation at a single gene. Nat. Commun. 2021, 12, 3158. [Google Scholar] [CrossRef]
- Lu, X.; Zhu, X.; Li, Y.; Liu, M.; Yu, B.; Wang, Y.; Rao, M.; Yang, H.; Zhou, K.; Wang, Y.; et al. Multiple P-TEFbs cooperatively regulate the release of promoter-proximally paused RNA polymerase II. Nucleic Acids Res. 2016, 44, 6853–6867. [Google Scholar] [CrossRef]
- Rawat, P.; Boehning, M.; Hummel, B.; Aprile-Garcia, F.; Pandit, A.S.; Eisenhardt, N.; Khavaran, A.; Niskanen, E.; Vos, S.M.; Palvimo, J.J.; et al. Stress-induced nuclear condensation of NELF drives transcriptional downregulation. Mol. Cell 2021, 81, 1013–1026. [Google Scholar] [CrossRef]
- Vos, S.M.; Farnung, L.; Boehning, M.; Wigge, C.; Linden, A.; Urlaub, H.; Cramer, P. Structure of activated transcription complex Pol II–DSIF–PAF–SPT6. Nature 2018, 560, 607–612. [Google Scholar] [CrossRef] [Green Version]
- Yu, M.; Yang, W.; Ni, T.; Tang, Z.; Nakadai, T.; Zhu, J.; Roeder, R.G. RNA Polymerase II-associated factor 1 regulates the release and phosphorylation of paused RNA Polymerase II. Science 2015, 350, 1383–1386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pestic-Dragovich, L.; Stojiljkovic, L.; Philimonenko, A.A.; Nowak, G.; Ke, Y.; Settlage, R.E.; Shabanowitz, J.; Hunt, D.F.; Hozak, P.; de Lanerolle, P. A myosin I isoform in the nucleus. Science 2000, 290, 337–341. [Google Scholar] [CrossRef] [PubMed]
- Sarshad, A.A.; Percipalle, P. New insight into role of myosin motors for activation of RNA polymerases. Int. Rev. Cell Mol. Biol. 2014, 311, 183–230. [Google Scholar] [CrossRef] [PubMed]
- Singh, N.; Reyes-Ordoñez, A.; Compagnone, M.A.; Moreno, J.F.; Leslie, B.J.; Ha, T.; Chen, J. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins. Nat. Commun. 2021, 12, 4339. [Google Scholar] [CrossRef]
- Surks, H.K.; Richards, C.T.; Mendelsohn, M.E. Myosin phosphatase-Rho interacting protein. A new member of the myosin phosphatase complex that directly binds RhoA. J. Biol. Chem. 2003, 278, 51484–51493. [Google Scholar] [CrossRef] [Green Version]
- Huet, G.; Skarp, K.-P.; Vartiainen, M.K. Nuclear actin levels as an important transcriptional switch. Transcription 2012, 3, 226–230. [Google Scholar] [CrossRef] [Green Version]
- Baarlink, C.; Wang, H.; Grosse, R. Nuclear Actin Network Assembly by Formins Regulates the SRF Coactivator MAL. Science 2013, 340, 864–867. [Google Scholar] [CrossRef]
- Plessner, M.; Grosse, R. Dynamizing nuclear actin filaments. Curr. Opin. Cell Biol. 2019, 56, 1–6. [Google Scholar] [CrossRef]
- Yamazaki, S.; Gerhold, C.; Yamamoto, K.; Ueno, Y.; Grosse, R.; Miyamoto, K.; Harata, M. The Actin-Family Protein Arp4 Is a Novel Suppressor for the Formation and Functions of Nuclear F-Actin. Cells 2020, 9, 758. [Google Scholar] [CrossRef] [Green Version]
Name | Sequence |
---|---|
>NM_000194.3 Homo sapiens hypoxanthine phosphoribosyl transferase 1 (HPRT) | Fwd: 5′ TGACCTTGATTTATTTTGCATACC 3′ Rev: 5′ CGAGCAAGACGTTCAGTCCT 3′ |
>NM_004048.4 Homo sapiens beta-2-microglobulin (ß2-MG) | Fwd: 5′ GTATGCCTGCCGTGTGAACCATG 3′ Rev: 5′ CAAATGCGGCATCTTCAAACCTCC 3′ |
>NM_000688.6 Homo sapiens 5’ -aminolevulinate synthase 1 (ALAS) | Fwd: 5′ CCACTGGAAGAGCTGTGTGATGTG 3′ Rev: 5′ GCGATGTACCCTCCAACACAACC 3′ |
>NR_001445.2 Homo sapiens RNA component of 7SK nuclear ribonucleoprotein (7SK) | Fwd: 5′ ATTGATCGCCACxxXGTTGATT 3′ Rev: 5′ CGGGGAAGGTCGTCCTCTTC 3′ |
>NM_001256799 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | Fwd: 5′ GTCGGAGTCAACGGATTTGG 3′ Rev: 5′ AAAAGCAGCCCTGGTGACC 3′ |
>NM_001101 Homo sapiens actin beta (ACTB) | Fwd: 5′ AGGCACCAGGGCGTGAT 3′ Rev: 5′ TCGCCCACATAGGAATCCTT 3′ |
>NM_014000.3 Homo sapiens vinculin (VCL) | Fwd: 5′ GATGAAGCTCGCAAATGGTC 3′ Rev: 5′ TCTGCCTCAGCTACAACACCT 3′ |
>NM_031488.5 Homo sapiens histone methyl-lysine binding protein 2 (L3MBT) | Fwd: 5′ AGGCACCAGGGCGTGAT 3′ Rev: 5′ TCGCCCACATAGGAATCCTT 3′ |
>NM_017706.5 Homo sapiens WD repeat domain 55 (WDR55) | Fwd: 5′ GGAAGACATCGTGCTGGAAG 3′ Rev: 5′ TGGCAAGAGTAGGAAAAGACG 3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Balaban, C.; Sztacho, M.; Antiga, L.; Miladinović, A.; Harata, M.; Hozák, P. PIP2-Effector Protein MPRIP Regulates RNA Polymerase II Condensation and Transcription. Biomolecules 2023, 13, 426. https://doi.org/10.3390/biom13030426
Balaban C, Sztacho M, Antiga L, Miladinović A, Harata M, Hozák P. PIP2-Effector Protein MPRIP Regulates RNA Polymerase II Condensation and Transcription. Biomolecules. 2023; 13(3):426. https://doi.org/10.3390/biom13030426
Chicago/Turabian StyleBalaban, Can, Martin Sztacho, Ludovica Antiga, Ana Miladinović, Masahiko Harata, and Pavel Hozák. 2023. "PIP2-Effector Protein MPRIP Regulates RNA Polymerase II Condensation and Transcription" Biomolecules 13, no. 3: 426. https://doi.org/10.3390/biom13030426