Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Study Groups
2.2. Arthritis Induction
2.3. Treadmill Physical Exercise Intervention
2.4. DNA Microarray and Bioinformatic Analysis
2.5. Histopathological Analysis
2.6. Inflammatory Cytokines RNA Quantification by RT-qPCR
2.7. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Smolen, J.S.; Aletaha, D.; Barton, A.; Burmester, G.R.; Emery, P.; Firestein, G.S.; Kavanaugh, A.; McInnes, I.B.; Solomon, D.H.; Strand, V.; et al. Rheumatoid Arthritis. Nat. Rev. Dis. Primer 2018, 4, 18001. [Google Scholar] [CrossRef] [PubMed]
- Romão, V.C.; Fonseca, J.E. Disease Mechanisms in Preclinical Rheumatoid Arthritis: A Narrative Review. Front. Med. 2022, 9, 689711. [Google Scholar] [CrossRef]
- Romão, V.C.; Fonseca, J.E. Etiology and Risk Factors for Rheumatoid Arthritis: A State-of-the-Art Review. Front. Med. 2021, 8, 689698. [Google Scholar] [CrossRef] [PubMed]
- Holers, V.M.; Kuhn, K.A.; Demoruelle, M.K.; Norris, J.M.; Firestein, G.S.; James, E.A.; Robinson, W.H.; Buckner, J.H.; Deane, K.D. Mechanism-driven Strategies for Prevention of Rheumatoid Arthritis. Rheumatol. Autoimmun. 2022, 2, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Alpizar-Rodriguez, D.; Finckh, A. Is the Prevention of Rheumatoid Arthritis Possible? Clin. Rheumatol. 2020, 39, 1383–1389. [Google Scholar] [CrossRef]
- Deane, K.D.; Holers, V.M. Rheumatoid Arthritis Pathogenesis, Prediction, and Prevention: An Emerging Paradigm Shift. Arthritis Rheumatol. 2021, 73, 181–193. [Google Scholar] [CrossRef] [PubMed]
- Frazzei, G.; Musters, A.; de Vries, N.; Tas, S.W.; van Vollenhoven, R.F. Prevention of Rheumatoid Arthritis: A Systematic Literature Review of Preventive Strategies in at-Risk Individuals. Autoimmun. Rev. 2023, 22, 103217. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Zhu, J.; Ling, Y.; Mi, S.; Li, Y.; Wang, T.; Li, Y. Physical Activity and the Risk of Rheumatoid Arthritis: Evidence from Meta-Analysis and Mendelian Randomization. Int. J. Epidemiol. 2021, 50, 1593–1603. [Google Scholar] [CrossRef]
- Gwinnutt, J.M.; Wieczorek, M.; Cavalli, G.; Balanescu, A.; Bischoff-Ferrari, H.A.; Boonen, A.; de Souza, S.; de Thurah, A.; Dorner, T.E.; Moe, R.H.; et al. Effects of Physical Exercise and Body Weight on Disease-Specific Outcomes of People with Rheumatic and Musculoskeletal Diseases (RMDs): Systematic Reviews and Meta-Analyses Informing the 2021 EULAR Recommendations for Lifestyle Improvements in People with RMDs. RMD Open 2022, 8, e002168. [Google Scholar] [CrossRef]
- Chehade, L.; Jaafar, Z.A.; El Masri, D.; Zmerly, H.; Kreidieh, D.; Tannir, H.; Itani, L.; El Ghoch, M. Lifestyle Modification in Rheumatoid Arthritis: Dietary and Physical Activity Recommendations Based on Evidence. Curr. Rheumatol. Rev. 2019, 15, 209–214. [Google Scholar] [CrossRef]
- Rausch Osthoff, A.-K.; Niedermann, K.; Braun, J.; Adams, J.; Brodin, N.; Dagfinrud, H.; Duruoz, T.; Esbensen, B.A.; Günther, K.-P.; Hurkmans, E.; et al. 2018 EULAR Recommendations for Physical Activity in People with Inflammatory Arthritis and Osteoarthritis. Ann. Rheum. Dis. 2018, 77, 1251–1260. [Google Scholar] [CrossRef] [PubMed]
- Zaccardelli, A.; Sparks, J.A. Challenges and Opportunities of Targeted Behavioral Interventions for Groups at Risk for Developing Rheumatoid Arthritis. Healthcare 2021, 9, 641. [Google Scholar] [CrossRef] [PubMed]
- Hughes-Austin, J.M.; Ix, J.H.; Ward, S.R.; Weisman, M.H.; ODell, J.R.; Mikuls, T.R.; Buckner, J.H.; Gregersen, P.K.; Keating, R.M.; Demoruelle, M.K.; et al. Evaluating Associations of Joint Swelling, Joint Stiffness and Joint Pain with Physical Activity in First-Degree Relatives of Patients with Rheumatoid Arthritis: Studies of the Aetiology of Rheumatoid Arthritis (SERA), a Prospective Cohort Study. BMJ Open 2021, 11, e050883. [Google Scholar] [CrossRef]
- Metsios, G.S.; Brodin, N.; Vlieland, T.P.M.V.; Van den Ende, C.H.M.; Stavropoulos-Kalinoglou, A.; Fatouros, I.; van der Esch, M.; Fenton, S.A.M.; Tzika, K.; Moe, R.H.; et al. Position Statement on Exercise Dosage in Rheumatic and Musculoskeletal Diseases: The Role of the IMPACT-RMD Toolkit. Mediterr. J. Rheumatol. 2021, 32, 378–385. [Google Scholar] [CrossRef]
- González-Chávez, S.A.; Pacheco-Tena, C. Exercise-Driven Exacerbation of Inflammation: Contribution of Animal Models of Rheumatoid Arthritis and Spondyloarthritis. Connect. Tissue Res. 2022, 63, 425–442. [Google Scholar] [CrossRef]
- González-Chávez, S.A.; Pacheco-Tena, C.; Quiñonez-Flores, C.M.; Espino-Solis, G.P.; Burrola-De Anda, J.I.; Muñoz-Morales, P.M. Positive Transcriptional Response on Inflammation and Joint Remodelling Influenced by Physical Exercise in Proteoglycan-Induced Arthritis: An Animal Study. Bone Jt. Res. 2020, 9, 36–48. [Google Scholar] [CrossRef] [PubMed]
- González-Chávez, S.A.; Quiñonez-Flores, C.M.; Espino-Solís, G.P.; Vázquez-Contreras, J.Á.; Pacheco-Tena, C. Exercise Exacerbates the Transcriptional Profile of Hypoxia, Oxidative Stress and Inflammation in Rats with Adjuvant-Induced Arthritis. Cells 2019, 8, 1493. [Google Scholar] [CrossRef]
- Brand, D.D.; Latham, K.A.; Rosloniec, E.F. Collagen-Induced Arthritis. Nat. Protoc. 2007, 2, 1269–1275. [Google Scholar] [CrossRef]
- Ramírez Salcedo, J.; Chávez González, L.; Santillán Torres, J.L.; Guzmán León, S. Microarreglos de ADN: Fabricación, Proceso y Análisis. In Herramientas Moleculares Aplicadas en Ecología: Aspectos Teóricos y Prácticos; Secretaría de Medio Ambiente y Recursos Naturales: Tlalpan, Mexico; Instituto Nacional de Ecología y Cambio Climático (INECC-SEMARNAT): Coyoacan, Mexico, 2014; pp. 203–229. ISBN 978-607-8246-72-4. [Google Scholar]
- Huang, D.W.; Sherman, B.T.; Tan, Q.; Kir, J.; Liu, D.; Bryant, D.; Guo, Y.; Stephens, R.; Baseler, M.W.; Lane, H.C.; et al. DAVID Bioinformatics Resources: Expanded Annotation Database and Novel Algorithms to Better Extract Biology from Large Gene Lists. Nucleic Acids Res. 2007, 35, W169–W175. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; Santos, A.; Doncheva, N.T.; Roth, A.; Bork, P.; et al. The STRING Database in 2017: Quality-Controlled Protein–Protein Association Networks, Made Broadly Accessible. Nucleic Acids Res. 2017, 45, D362–D368. [Google Scholar] [CrossRef]
- Isserlin, R.; Merico, D.; Voisin, V.; Bader, G.D. Enrichment Map—A Cytoscape App to Visualize and Explore OMICs Pathway Enrichment Results. F1000Research 2014, 3, 141. [Google Scholar] [CrossRef]
- Bader, G.D.; Hogue, C.W.V. An Automated Method for Finding Molecular Complexes in Large Protein Interaction Networks. BMC Bioinform. 2003, 4, 2. [Google Scholar] [CrossRef] [PubMed]
- Quiñonez-Flores, C.M.; López-Loeza, S.M.; Pacheco-Tena, C.; Muñoz-Morales, P.M.; Acosta-Jiménez, S.; González-Chávez, S.A. Stability of Housekeeping Genes in Inflamed Joints of Spontaneous and Collagen-Induced Arthritis in DBA/1 Mice. Inflamm. Res. 2021, 70, 619–632. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING Database in 2021: Customizable Protein–Protein Networks, and Functional Characterization of User-Uploaded Gene/Measurement Sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Li, Y.; Atakan, M.M.; Kuang, J.; Hu, Y.; Bishop, D.J.; Yan, X. The Molecular Adaptive Responses of Skeletal Muscle to High-Intensity Exercise/Training and Hypoxia. Antioxidants 2020, 9, 656. [Google Scholar] [CrossRef] [PubMed]
- Solsona, R.; Pavlin, L.; Bernardi, H.; Sanchez, A.M. Molecular Regulation of Skeletal Muscle Growth and Organelle Biosynthesis: Practical Recommendations for Exercise Training. Int. J. Mol. Sci. 2021, 22, 2741. [Google Scholar] [CrossRef]
- Woods, J.A.; Vieira, V.J.; Keylock, K.T. Exercise, Inflammation, and Innate Immunity. Immunol. Allergy Clin. N. Am. 2009, 29, 381–393. [Google Scholar] [CrossRef]
- Domin, R.; Dadej, D.; Pytka, M.; Zybek-Kocik, A.; Ruchała, M.; Guzik, P. Effect of Various Exercise Regimens on Selected Exercise-Induced Cytokines in Healthy People. Int. J. Environ. Res. Public Health 2021, 18, 1261. [Google Scholar] [CrossRef]
- Damasceno de Lima, R.; Pedersen, M.; Costa do Bomfim, F.R.; Chiarotto, G.B.; Canciglieri, P.H.; Pauli, J.R.; Felonato, M. Effects of Different Physical Training Protocols on Inflammatory Markers in Zymosan-induced Rheumatoid Arthritis in Wistar Rats. Cell Biochem. Funct. 2022, 40, 321–332. [Google Scholar] [CrossRef]
- Cambré, I.; Gaublomme, D.; Schryvers, N.; Lambrecht, S.; Lories, R.; Venken, K.; Elewaut, D. Running Promotes Chronicity of Arthritis by Local Modulation of Complement Activators and Impairing T Regulatory Feedback Loops. Ann. Rheum. Dis. 2019, 78, 787–795. [Google Scholar] [CrossRef]
- Shimomura, S.; Inoue, H.; Arai, Y.; Nakagawa, S.; Fujii, Y.; Kishida, T.; Ichimaru, S.; Tsuchida, S.; Shirai, T.; Ikoma, K.; et al. Treadmill Running Ameliorates Destruction of Articular Cartilage and Subchondral Bone, Not Only Synovitis, in a Rheumatoid Arthritis Rat Model. Int. J. Mol. Sci. 2018, 19, 1653. [Google Scholar] [CrossRef] [PubMed]
- Kito, T.; Teranishi, T.; Nishii, K.; Sakai, K.; Matsubara, M.; Yamada, K. Effectiveness of Exercise-Induced Cytokines in Alleviating Arthritis Symptoms in Arthritis Model Mice. Okajimas Folia Anat. Jpn. 2016, 93, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Fujii, Y.; Inoue, H.; Arai, Y.; Shimomura, S.; Nakagawa, S.; Kishida, T.; Tsuchida, S.; Kamada, Y.; Kaihara, K.; Shirai, T.; et al. Treadmill Running in Established Phase Arthritis Inhibits Joint Destruction in Rat Rheumatoid Arthritis Models. Int. J. Mol. Sci. 2019, 20, 5100. [Google Scholar] [CrossRef] [PubMed]
- Cambré, I.; Gaublomme, D.; Burssens, A.; Jacques, P.; Schryvers, N.; De Muynck, A.; Meuris, L.; Lambrecht, S.; Carter, S.; de Bleser, P.; et al. Mechanical Strain Determines the Site-Specific Localization of Inflammation and Tissue Damage in Arthritis. Nat. Commun. 2018, 9, 4613. [Google Scholar] [CrossRef]
- Jang, D.; Lee, A.-H.; Shin, H.-Y.; Song, H.-R.; Park, J.-H.; Kang, T.-B.; Lee, S.-R.; Yang, S.-H. The Role of Tumor Necrosis Factor Alpha (TNF-α) in Autoimmune Disease and Current TNF-α Inhibitors in Therapeutics. Int. J. Mol. Sci. 2021, 22, 2719. [Google Scholar] [CrossRef]
- Hu, L.; Liu, R.; Zhang, L. Advance in Bone Destruction Participated by JAK/STAT in Rheumatoid Arthritis and Therapeutic Effect of JAK/STAT Inhibitors. Int. Immunopharmacol. 2022, 111, 109095. [Google Scholar] [CrossRef]
- O’Neil, L.J.; Meng, X.; Mcfadyen, C.; Fritzler, M.J.; El-Gabalawy, H.S. Serum Proteomic Networks Associate with Pre-Clinical Rheumatoid Arthritis Autoantibodies and Longitudinal Outcomes. Front. Immunol. 2022, 13, 958145. [Google Scholar] [CrossRef]
- Asadullah, K.; Sterry, W.; Stephanek, K.; Jasulaitis, D.; Leupold, M.; Audring, H.; Volk, H.D.; Döcke, W.D. IL-10 Is a Key Cytokine in Psoriasis. Proof of Principle by IL-10 Therapy: A New Therapeutic Approach. J. Clin. Investig. 1998, 101, 783–794. [Google Scholar] [CrossRef]
- Pestka, S.; Krause, C.D.; Sarkar, D.; Walter, M.R.; Shi, Y.; Fisher, P.B. Interleukin-10 and Related Cytokines and Receptors. Annu. Rev. Immunol. 2004, 22, 929–979. [Google Scholar] [CrossRef]
- Saraiva, M.; O’Garra, A. The Regulation of IL-10 Production by Immune Cells. Nat. Rev. Immunol. 2010, 10, 170–181. [Google Scholar] [CrossRef]
- Rasquinha, M.T.; Sur, M.; Lasrado, N.; Reddy, J. IL-10 as a Th2 Cytokine: Differences Between Mice and Humans. J. Immunol. 2021, 207, 2205–2215. [Google Scholar] [CrossRef]
- Lu, Q.; Zhu, Z.; Tan, C.; Zhou, H.; Hu, Y.; Shen, G.; Zhu, P.; Yang, G.; Xie, X. Changes of Serum IL-10, IL-1β, IL-6, MCP-1, TNF-α, IP-10 and IL-4 in COVID-19 Patients. Int. J. Clin. Pract. 2021, 75, e14462. [Google Scholar] [CrossRef]
- Dissanayake, K.; Jayasinghe, C.; Wanigasekara, P.; Sominanda, A. Potential Applicability of Cytokines as Biomarkers of Disease Activity in Rheumatoid Arthritis: Enzyme-Linked Immunosorbent Spot Assay-Based Evaluation of TNF-α, IL-1β, IL-10 and IL-17A. PLoS ONE 2021, 16, e0246111. [Google Scholar] [CrossRef]
- Lau, S.Y.; Guild, S.-J.; Barrett, C.J.; Chen, Q.; McCowan, L.; Jordan, V.; Chamley, L.W. Tumor Necrosis Factor-Alpha, Interleukin-6, and Interleukin-10 Levels Are Altered in Preeclampsia: A Systematic Review and Meta-Analysis. Am. J. Reprod. Immunol. 2013, 70, 412–427. [Google Scholar] [CrossRef] [PubMed]
- Petersen, A.M.W.; Pedersen, B.K. The Anti-Inflammatory Effect of Exercise. J. Appl. Physiol. 2005, 98, 1154–1162. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Kader, S.M.; Al-Jiffri, O.H. Aerobic Exercise Modulates Cytokine Profile and Sleep Quality in Elderly. Afr. Health Sci. 2019, 19, 2198–2207. [Google Scholar] [CrossRef]
- Shaw, D.M.; Merien, F.; Braakhuis, A.; Dulson, D. T-Cells and Their Cytokine Production: The Anti-Inflammatory and Immunosuppressive Effects of Strenuous Exercise. Cytokine 2018, 104, 136–142. [Google Scholar] [CrossRef]
- Islam, H.; Neudorf, H.; Mui, A.L.; Little, J.P. Interpreting “anti-Inflammatory” Cytokine Responses to Exercise: Focus on Interleukin-10. J. Physiol. 2021, 599, 5163–5177. [Google Scholar] [CrossRef] [PubMed]
- Bartlett, D.B.; Willis, L.H.; Slentz, C.A.; Hoselton, A.; Kelly, L.; Huebner, J.L.; Kraus, V.B.; Moss, J.; Muehlbauer, M.J.; Spielmann, G.; et al. Ten Weeks of High-Intensity Interval Walk Training Is Associated with Reduced Disease Activity and Improved Innate Immune Function in Older Adults with Rheumatoid Arthritis: A Pilot Study. Arthritis Res. Ther. 2018, 20, 127. [Google Scholar] [CrossRef]
- Monteiro, M.R.P.; Aragão-Santos, J.C.; Vasconcelos, A.B.S.; Resende-Neto, A.G.D.; Chaves, L.M.d.S.; Cardoso, A.P.; Nogueira, A.C.; Carnero-Diaz, A.; Marcos-Pardo, P.J.; Corrêa, C.B.; et al. Bodyweight and Combined Training Reduce Chronic Low-Grade Inflammation and Improve Functional Fitness of Postmenopausal Women. Sports 2022, 10, 143. [Google Scholar] [CrossRef]
- Zhou, Y.; Jia, N.; Ding, M.; Yuan, K. Effects of Exercise on Inflammatory Factors and IGF System in Breast Cancer Survivors: A Meta-Analysis. BMC Women’s Health 2022, 22, 507. [Google Scholar] [CrossRef]
- Balogh, L.; Szabó, K.; Pucsok, J.M.; Jámbor, I.; Gyetvai, Á.; Mile, M.; Barna, L.; Szodoray, P.; Tarr, T.; Csiki, Z.; et al. The Effect of Aerobic Exercise and Low-Impact Pilates Workout on the Adaptive Immune System. J. Clin. Med. 2022, 11, 6814. [Google Scholar] [CrossRef]
- Guo, Y.-T.; Peng, Y.-C.; Yen, H.-Y.; Wu, J.-C.; Hou, W.-H. Effects of Probiotic Supplementation on Immune and Inflammatory Markers in Athletes: A Meta-Analysis of Randomized Clinical Trials. Medicina 2022, 58, 1188. [Google Scholar] [CrossRef] [PubMed]
- Kjølhede, T.; Dalgas, U.; Gade, A.B.; Bjerre, M.; Stenager, E.; Petersen, T.; Vissing, K. Acute and Chronic Cytokine Responses to Resistance Exercise and Training in People with Multiple Sclerosis. Scand. J. Med. Sci. Sport. 2016, 26, 824–834. [Google Scholar] [CrossRef]
- Kim, S.-D.; Yeun, Y.-R. Effects of Resistance Training on C-Reactive Protein and Inflammatory Cytokines in Elderly Adults: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Int. J. Environ. Res. Public Health 2022, 19, 3434. [Google Scholar] [CrossRef]
- Takahashi, H.; Alves, C.R.R.; Stanford, K.I.; Middelbeek, R.J.W.; Nigro, P.; Ryan, R.E.; Xue, R.; Sakaguchi, M.; Lynes, M.D.; So, K.; et al. TGF-Β2 Is an Exercise-Induced Adipokine That Regulates Glucose and Fatty Acid Metabolism. Nat. Metab. 2019, 1, 291–303. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.J.; Feng, W.L.; Hou, N.; Li, N.; Jiang, W.L. Effects of aerobic exercise and resveratrol on the expressions of JAK2 and TGF-β1 in renal tissue of type 2 diabetes rats. Chin. J. Appl. Physiol. 2020, 36, 202–206. [Google Scholar] [CrossRef]
- Heinemeier, K.; Langberg, H.; Olesen, J.L.; Kjaer, M. Role of TGF-Beta1 in Relation to Exercise-Induced Type I Collagen Synthesis in Human Tendinous Tissue. J. Appl. Physiol. 2003, 95, 2390–2397. [Google Scholar] [CrossRef]
- Ma, Y.; Kuang, Y.; Bo, W.; Liang, Q.; Zhu, W.; Cai, M.; Tian, Z. Exercise Training Alleviates Cardiac Fibrosis through Increasing Fibroblast Growth Factor 21 and Regulating TGF-Β1-Smad2/3-MMP2/9 Signaling in Mice with Myocardial Infarction. Int. J. Mol. Sci. 2021, 22, 12341. [Google Scholar] [CrossRef]
- Eka Widiastuti, I.A.; Arsyad, A.; Idris, I.; Patellongi, I.; Kadriyan, H.; Buanayuda, G.W.; Sari, D.P.; Rosyidi, R.M. Exercise Adaptations and TGF-Β1 Levels in Recreational Cyclists. Ann. Med. Surg. 2021, 70, 102872. [Google Scholar] [CrossRef]
- Silva, V.R.R.; Lenhare, L.; Katashima, C.K.; Morari, J.; M-Assis, A.; Gaspar, R.S.; da Silva, A.S.R.; Moura, L.P.; Pauli, J.R.; Cintra, D.E.; et al. TGF-Β1 Downregulation in the Hypothalamus of Obese Mice through Acute Exercise. J. Cell. Biochem. 2019, 120, 18186–18192. [Google Scholar] [CrossRef]
- Toti, L.; Bartalucci, A.; Ferrucci, M.; Fulceri, F.; Lazzeri, G.; Lenzi, P.; Soldani, P.; Gobbi, P.; La Torre, A.; Gesi, M. High-Intensity Exercise Training Induces Morphological and Biochemical Changes in Skeletal Muscles. Biol. Sport 2013, 30, 301–309. [Google Scholar] [CrossRef]
- Bartalucci, A.; Ferrucci, M.; Fulceri, F.; Lazzeri, G.; Lenzi, P.; Toti, L.; Serpiello, F.R.; La Torre, A.; Gesi, M. High-Intensity Exercise Training Produces Morphological and Biochemical Changes in Adrenal Gland of Mice. Histol. Histopathol. 2012, 27, 753–769. [Google Scholar] [CrossRef]
- Tong, Y.; Ishikawa, K.; Sasaki, R.; Takeshita, I.; Sakamoto, J.; Okita, M. The Effects of Wheel-Running Using the Upper Limbs Following Immobilization after Inducing Arthritis in the Knees of Rats. Physiol. Res. 2021, 70, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Dos Santos, S.A.; Dos Santos Vieira, M.A.; Simões, M.C.B.; Serra, A.J.; Leal-Junior, E.C.; de Carvalho, P. de T.C. Photobiomodulation Therapy Associated with Treadmill Training in the Oxidative Stress in a Collagen-Induced Arthritis Model. Lasers Med. Sci. 2017, 32, 1071–1079. [Google Scholar] [CrossRef] [PubMed]
- Ni, G.-X.; Liu, S.-Y.; Lei, L.; Li, Z.; Zhou, Y.-Z.; Zhan, L.-Q. Intensity-Dependent Effect of Treadmill Running on Knee Articular Cartilage in a Rat Model. BioMed Res. Int. 2013, 2013, 172392. [Google Scholar] [CrossRef]
- Ni, G.-X.; Lei, L.; Zhou, Y.-Z. Intensity-Dependent Effect of Treadmill Running on Lubricin Metabolism of Rat Articular Cartilage. Arthritis Res. Ther. 2012, 14, R256. [Google Scholar] [CrossRef]





| Gene | Forward (Sequence 5′–3′) | Reverse (Sequence 5′–3′) |
|---|---|---|
| Tnf | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
| Il2 | TGAGCAGGATGGAGAATTACAGG | GTCCAAGTTCATCTTCTAGGCAC |
| Il6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| Il10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| Il12a | CTGTGCCTTGGTAGCATCTATG | GCAGAGTCTCGCCATTATGATTC |
| Il23a | ATGCTGGATTGCAGAGCAGTA | ACGGGGCACATTATTTTTAGTCT |
| Tgfb1 | CTCCCGTGGCTTCTAGTGC | GCCTTAGTTTGGACAGGATCTG |
| Jak3 | CCATCACGTTAGACTTTGCCA | GGCGGAGAATATAGGTGCCTG |
| Rpl13a | AGCCTACCAGAAAGTTTGCTTAC | GCTTCTTCTTCCGATAGTGCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
González-Chávez, S.A.; López-Loeza, S.M.; Acosta-Jiménez, S.; Cuevas-Martínez, R.; Pacheco-Silva, C.; Chaparro-Barrera, E.; Pacheco-Tena, C. Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model. Biomolecules 2023, 13, 488. https://doi.org/10.3390/biom13030488
González-Chávez SA, López-Loeza SM, Acosta-Jiménez S, Cuevas-Martínez R, Pacheco-Silva C, Chaparro-Barrera E, Pacheco-Tena C. Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model. Biomolecules. 2023; 13(3):488. https://doi.org/10.3390/biom13030488
Chicago/Turabian StyleGonzález-Chávez, Susana Aideé, Salma Marcela López-Loeza, Samara Acosta-Jiménez, Rubén Cuevas-Martínez, César Pacheco-Silva, Eduardo Chaparro-Barrera, and César Pacheco-Tena. 2023. "Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model" Biomolecules 13, no. 3: 488. https://doi.org/10.3390/biom13030488
APA StyleGonzález-Chávez, S. A., López-Loeza, S. M., Acosta-Jiménez, S., Cuevas-Martínez, R., Pacheco-Silva, C., Chaparro-Barrera, E., & Pacheco-Tena, C. (2023). Low-Intensity Physical Exercise Decreases Inflammation and Joint Damage in the Preclinical Phase of a Rheumatoid Arthritis Murine Model. Biomolecules, 13(3), 488. https://doi.org/10.3390/biom13030488

