Characterization of an Arginine Decarboxylase from Streptococcus pneumoniae by Ultrahigh-Performance Liquid Chromatography–Tandem Mass Spectrometry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cloning, Expression, and Purification of SP_0166
2.2. Sample Preparation to Determine Substrate Specificity
2.3. LC–MS/MS Analysis of SP_0166 Enzymatic Activity
2.4. Enzyme Kinetics Analysis
2.5. Enzyme Inhibition Assays
3. Results
3.1. Expression and Purification of SP_0166
3.2. Substrate Specificity of SP_0166
3.3. Optimization of pH and Incubation Time to Enhance the ADC Activity
3.4. Enzyme Kinetics Analysis
3.5. Inhibition of Decarboxylase Activity by DFMA and DFMO
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- André, A.C.; Debande, L.; Marteyn, B.S. The selective advantage of facultative anaerobes relies on their unique ability to cope with changing oxygen levels during infection. Cell. Microbiol. 2021, 23, e13338. [Google Scholar] [CrossRef] [PubMed]
- Troeger, C.; Blacker, B.; Khalil, I.A.; Rao, P.C.; Cao, J.; Zimsen, S.R.; Albertson, S.B.; Deshpande, A.; Farag, T.; Abebe, Z. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of lower respiratory infections in 195 countries, 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 2018, 18, 1191–1210. [Google Scholar] [CrossRef] [PubMed]
- McAllister, D.A.; Liu, L.; Shi, T.; Chu, Y.; Reed, C.; Burrows, J.; Adeloye, D.; Rudan, I.; Black, R.E.; Campbell, H.; et al. Global, regional, and national estimates of pneumonia morbidity and mortality in children younger than 5 years between 2000 and 2015: A systematic analysis. Lancet Glob. Health 2019, 7, e47–e57. [Google Scholar] [CrossRef] [PubMed]
- Ganaie, F.; Saad, J.S.; McGee, L.; van Tonder, A.J.; Bentley, S.D.; Lo, S.W.; Gladstone, R.A.; Turner, P.; Keenan, J.D.; Breiman, R.F.; et al. A New Pneumococcal Capsule Type, 10D, is the 100th Serotype and Has a Large cps Fragment from an Oral Streptococcus. mBio 2020, 11, e00937-20. [Google Scholar] [CrossRef]
- Feldman, C.; Anderson, R. Pneumococcal virulence factors in community-acquired pneumonia. Curr. Opin. Pulm. Med. 2020, 26, 222–231. [Google Scholar] [CrossRef] [PubMed]
- Nanduri, B.; Swiatlo, E. The expansive effects of polyamines on the metabolism and virulence of Streptococcus pneumoniae. Pneumonia 2021, 13, 4. [Google Scholar] [CrossRef] [PubMed]
- Miller-Fleming, L.; Olin-Sandoval, V.; Campbell, K.; Ralser, M. Remaining Mysteries of Molecular Biology: The Role of Polyamines in the Cell. J. Mol. Biol. 2015, 427, 3389–3406. [Google Scholar] [CrossRef] [PubMed]
- Igarashi, K.; Kashiwagi, K. Effects of polyamines on protein synthesis and growth of Escherichia coli. J. Biol. Chem. 2018, 293, 18702–18709. [Google Scholar] [CrossRef] [PubMed]
- Gevrekci, A.O. The roles of polyamines in microorganisms. World J. Microbiol. Biotechnol. 2017, 33, 204. [Google Scholar] [CrossRef]
- Shah, P.; Nanduri, B.; Swiatlo, E.; Ma, Y.; Pendarvis, K. Polyamine biosynthesis and transport mechanisms are crucial for fitness and pathogenesis of Streptococcus pneumoniae. Microbiology 2011, 157, 504–515. [Google Scholar] [CrossRef]
- Nakamya, M.F.; Ayoola, M.B.; Park, S.; Shack, L.A.; Swiatlo, E.; Nanduri, B. The Role of Cadaverine Synthesis on Pneumococcal Capsule and Protein Expression. Med. Sci. 2018, 6, 8. [Google Scholar] [CrossRef] [PubMed]
- Ayoola, M.B.; Shack, L.A.; Nakamya, M.F.; Thornton, J.A.; Swiatlo, E.; Nanduri, B. Polyamine Synthesis Effects Capsule Expression by Reduction of Precursors in Streptococcus pneumoniae. Front. Microbiol. 2019, 10, 476138. [Google Scholar] [CrossRef] [PubMed]
- Ayoola, M.B.; Nakamya, M.F.; Shack, L.A.; Park, S.; Lim, J.; Lee, J.H.; Ross, M.K.; Eoh, H.; Nanduri, B. SP_0916 Is an Arginine Decarboxylase That Catalyzes the Synthesis of Agmatine, Which Is Critical for Capsule Biosynthesis in Streptococcus pneumoniae. Front. Microbiol. 2020, 11, 578533. [Google Scholar] [CrossRef] [PubMed]
- Michael, A.J. Biosynthesis of polyamines and polyamine-containing molecules. Biochem. J. 2016, 473, 2315–2329. [Google Scholar] [CrossRef] [PubMed]
- Park, M.G.; Kim, S.Y.; Lee, C.J. DMSO-tolerant ornithine decarboxylase (ODC) tandem assay optimised for high-throughput screening. J. Enzym. Inhib. Med. Chem. 2023, 38, 309–318. [Google Scholar] [CrossRef] [PubMed]
- Ayoola, M.B.; Shack, L.A.; Lee, J.H.; Lim, J.; Eoh, H.; Swiatlo, E.; Phanstiel, O.; Nanduri, B. Difluoromethylornithine (DFMO) and AMXT 1501 inhibit capsule biosynthesis in pneumococci. Sci. Rep. 2022, 12, 11804. [Google Scholar] [CrossRef] [PubMed]
- Silva, T.M.; Cirenajwis, H.; Wallace, H.M.; Oredsson, S.; Persson, L. A role for antizyme inhibitor in cell proliferation. Amino Acids 2015, 47, 1341–1352. [Google Scholar] [CrossRef]
- Pegg, A.E.; McGovern, K.A.; Wiest, L. Decarboxylation of alpha-difluoromethylornithine by ornithine decarboxylase. Biochem. J. 1987, 241, 305–307. [Google Scholar] [CrossRef]
- Meyskens, F.L., Jr.; Gerner, E.W. Development of difluoromethylornithine (DFMO) as a chemoprevention agent. Clin. Cancer Res. 1999, 5, 945–951. [Google Scholar]
- Madka, V.; Patlolla, J.M.R.; Venkatachalam, K.; Zhang, Y.; Pathuri, G.; Stratton, N.; Lightfoot, S.; Janakiram, N.B.; Mohammed, A.; Rao, C.V. Chemoprevention of Colon Cancer by DFMO, Sulindac, and NO-Sulindac Administered Individually or in Combinations in F344 Rats. Cancers 2023, 15, 4001. [Google Scholar] [CrossRef]
- Somani, R.R.; Rai, P.R.; Kandpile, P.S. Ornithine Decarboxylase Inhibition: A Strategy to Combat Various Diseases. Mini Rev. Med. Chem. 2018, 18, 1008–1021. [Google Scholar] [CrossRef] [PubMed]
- Tassoni, A.; Awad, N.; Griffiths, G. Effect of ornithine decarboxylase and norspermidine in modulating cell division in the green alga Chlamydomonas reinhardtii. Plant Physiol. Biochem. 2018, 123, 125–131. [Google Scholar] [CrossRef]
- Hyvönen, M.T.; Keinänen, T.A.; Nuraeva, G.K.; Yanvarev, D.V.; Khomutov, M.; Khurs, E.N.; Kochetkov, S.N.; Vepsäläinen, J.; Zhgun, A.A.; Khomutov, A.R. Hydroxylamine Analogue of Agmatine: Magic Bullet for Arginine Decarboxylase. Biomolecules 2020, 10, 406. [Google Scholar] [CrossRef] [PubMed]
- Rollins-Smith, L.A.; Ruzzini, A.C.; Fites, J.S.; Reinert, L.K.; Hall, E.M.; Joosse, B.A.; Ravikumar, V.I.; Huebner, M.I.; Aka, A.; Kehs, M.H.; et al. Metabolites Involved in Immune Evasion by Batrachochytrium dendrobatidis Include the Polyamine Spermidine. Infect. Immun. 2019, 87. [Google Scholar] [CrossRef] [PubMed]
- Tailor, A.; Bhatla, S.C. Polyamine homeostasis modulates plasma membrane- and tonoplast-associated aquaporin expression in etiolated salt-stressed sunflower (Helianthus annuus L.) seedlings. Protoplasma 2021, 258, 661–672. [Google Scholar] [CrossRef] [PubMed]
- Yarlett, N.; Waters, W.R.; Harp, J.A.; Wannemuehler, M.J.; Morada, M.; Bellcastro, J.; Upton, S.J.; Marton, L.J.; Frydman, B.J. Activities of DL-alpha-difluoromethylarginine and polyamine analogues against Cryptosporidium parvum infection in a T-cell receptor alpha-deficient mouse model. Antimicrob. Agents Chemother. 2007, 51, 1234–1239. [Google Scholar] [CrossRef]
- The UniProt Consortium. UniProt: The universal protein knowledgebase. Nucleic Acids Res. 2018, 46, 2699. [Google Scholar] [CrossRef]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef]
- Paley, S.; Karp, P.D. The BioCyc metabolic network explorer. BMC Bioinform. 2021, 22, 208. [Google Scholar] [CrossRef]
- Blethen, S.L.; Boeker, E.A.; Snell, E. Arginine Decarboxylase from Escherichia coli: I. Purification and Specificity for Substrates and Coenzyme. J. Biol. Chem. 1968, 243, 1671–1677. [Google Scholar] [CrossRef]
- Hong, E.Y.; Lee, S.-G.; Yun, H.; Kim, B.-G. Improving the Stability and Activity of Arginine Decarboxylase at Alkaline pH for the Production of Agmatine. Front. Catal. 2021, 1, 774512. [Google Scholar] [CrossRef]
- Fried, R.; Carlton, R.M.; Fried, D.A. Starving Cancer Cells: Evidence-Based Strategies to Slow Cancer Progression: A Selection of Readings for Health Services Providers; Academic Press: Cambridge, MA, USA, 2021. [Google Scholar]
- Ross, M.K.; Pluta, K.; Bittles, V.; Borazjani, A.; Allen Crow, J. Interaction of the serine hydrolase KIAA1363 with organophosphorus agents: Evaluation of potency and kinetics. Arch. Biochem. Biophys. 2016, 590, 72–81. [Google Scholar] [CrossRef] [PubMed]
- Regunathan, S.; Reis, D.J. Characterization of arginine decarboxylase in rat brain and liver: Distinction from ornithine decarboxylase. J. Neurochem. 2000, 74, 2201–2208. [Google Scholar] [CrossRef] [PubMed]
- Nakada, Y.; Itoh, Y. Identification of the putrescine biosynthetic genes in Pseudomonas aeruginosa and characterization of agmatine deiminase and N-carbamoylputrescine amidohydrolase of the arginine decarboxylase pathway. Microbiology 2003, 149, 707–714. [Google Scholar] [CrossRef]
- Rath, M.; Müller, I.; Kropf, P.; Closs, E.I.; Munder, M. Metabolism via arginase or nitric oxide synthase: Two competing arginine pathways in macrophages. Front. Immunol. 2014, 5, 532. [Google Scholar] [CrossRef] [PubMed]
- Maurelli, A.T.; Fernandez, R.E.; Bloch, C.A.; Rode, C.K.; Fasano, A. “Black holes” and bacterial pathogenicity: A large genomic deletion that enhances the virulence of Shigella spp. and enteroinvasive Escherichia coli. Proc. Natl. Acad. Sci. USA 1998, 95, 3943–3948. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, I.M.; Silva, M.; Schuch, R.; Walker, W.A.; Siber, A.M.; Maurelli, A.T.; McCormick, B.A. Cadaverine prevents the escape of Shigella flexneri from the phagolysosome: A connection between bacterial dissemination and neutrophil transepithelial signaling. J. Infect. Dis. 2001, 184, 743–753. [Google Scholar] [CrossRef] [PubMed]
- Patel, C.N.; Wortham, B.W.; Lines, J.L.; Fetherston, J.D.; Perry, R.D.; Oliveira, M.A. Polyamines are essential for the formation of plague biofilm. J. Bacteriol. 2006, 188, 2355–2363. [Google Scholar] [CrossRef] [PubMed]
- Karatan, E.; Duncan, T.R.; Watnick, P.I. NspS, a predicted polyamine sensor, mediates activation of Vibrio cholerae biofilm formation by norspermidine. J. Bacteriol. 2005, 187, 7434–7443. [Google Scholar] [CrossRef]
- Liu, Z.; Hossain, S.S.; Morales Moreira, Z.; Haney, C.H. Putrescine and Its Metabolic Precursor Arginine Promote Biofilm and c-di-GMP Synthesis in Pseudomonas aeruginosa. J. Bacteriol. 2022, 204, e0029721. [Google Scholar] [CrossRef]
- McNamara, K.M.; Gobert, A.P.; Wilson, K.T. The role of polyamines in gastric cancer. Oncogene 2021, 40, 4399–4412. [Google Scholar] [CrossRef]
- Guerra, P.R.; Liu, G.; Lemire, S.; Nawrocki, A.; Kudirkiene, E.; Møller-Jensen, J.; Olsen, J.E.; Jelsbak, L. Polyamine depletion has global effects on stress and virulence gene expression and affects HilA translation in Salmonella enterica serovar typhimurium. Res. Microbiol. 2020, 171, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Potter, A.J.; Paton, J.C. Spermidine biosynthesis and transport modulate pneumococcal autolysis. J. Bacteriol. 2014, 196, 3556–3561. [Google Scholar] [CrossRef] [PubMed]
- Rai, A.N.; Thornton, J.A.; Stokes, J.; Sunesara, I.; Swiatlo, E.; Nanduri, B. Polyamine transporter in Streptococcus pneumoniae is essential for evading early innate immune responses in pneumococcal pneumonia. Sci. Rep. 2016, 6, 26964. [Google Scholar] [CrossRef] [PubMed]
- Hanfrey, C.C.; Pearson, B.M.; Hazeldine, S.; Lee, J.; Gaskin, D.J.; Woster, P.M.; Phillips, M.A.; Michael, A.J. Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J. Biol. Chem. 2011, 286, 43301–43312. [Google Scholar] [CrossRef] [PubMed]
- Johnson, L.; Mulcahy, H.; Kanevets, U.; Shi, Y.; Lewenza, S. Surface-localized spermidine protects the Pseudomonas aeruginosa outer membrane from antibiotic treatment and oxidative stress. J. Bacteriol. 2012, 194, 813–826. [Google Scholar] [CrossRef] [PubMed]
- Giles, T.N.; Graham, D.E. Crenarchaeal arginine decarboxylase evolved from an S-adenosylmethionine decarboxylase enzyme. J. Biol. Chem. 2008, 283, 25829–25838. [Google Scholar] [CrossRef]
- Pei, X.D.; Lu, L.H.; Yue, S.Y.; Li, Y.; Liu, X.L.; Li, F.; Wu, K.J.; Wang, C.H. Characterization of a Novel Shewanella algae Arginine Decarboxylase Expressed in Escherichia coli. Mol. Biotechnol. 2022, 64, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Liang, J.; Hanfrey, C.C.; Phillips, M.A.; Michael, A.J. Discovery of ancestral L-ornithine and L-lysine decarboxylases reveals parallel, pseudoconvergent evolution of polyamine biosynthesis. J. Biol. Chem. 2021, 297, 101219. [Google Scholar] [CrossRef]
- Li, B.; Liang, J.; Baniasadi, H.R.; Phillips, M.A.; Michael, A.J. Functional polyamine metabolic enzymes and pathways encoded by the virosphere. Proc. Natl. Acad. Sci. USA 2023, 120, e2214165120. [Google Scholar] [CrossRef]
- Li, B.; Liang, J.; Phillips, M.A.; Michael, A.J. Neofunctionalization of S-adenosylmethionine decarboxylase into pyruvoyl-dependent L-ornithine and L-arginine decarboxylases is widespread in bacteria and archaea. J. Biol. Chem. 2023, 299, 105005. [Google Scholar] [CrossRef] [PubMed]
- Armalytė, J.; Čepauskas, A.; Šakalytė, G.; Martinkus, J.; Skerniškytė, J.; Martens, C.; Sužiedėlienė, E.; Garcia-Pino, A.; Jurėnas, D. A polyamine acetyltransferase regulates the motility and biofilm formation of Acinetobacter baumannii. Nat. Commun. 2023, 14, 3531. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence |
---|---|
SP_0166-F BamHI | AATTGGATCCATTAATAAAAAAATACAACAAGTTGTTTTGGAATCATTACAG |
SP_0166-R XhoI | AATTCTCGAGATATGTCAAGTTTTTTGTCCACAAATATACCTCCC |
Substrate | Polyamine | DFMO IC50 (mM) | DFMA IC50 (µM) |
---|---|---|---|
Arginine | Agmatine | 27.0 +/− 4.5 | 21.6 +/− 10.4 |
N-carbamoyl putrescine | 23.3 +/− 4.8 | 35.7 +/− 12.3 | |
Lysine | Cadaverine | 15.4 +/− 3.8 | 42.3 +/− 13.2 |
Ornithine | Putrescine | 11.5 +/− 4.4 | 30.9 +/− 14.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.H.; Ayoola, M.B.; Shack, L.A.; Swiatlo, E.; Nanduri, B. Characterization of an Arginine Decarboxylase from Streptococcus pneumoniae by Ultrahigh-Performance Liquid Chromatography–Tandem Mass Spectrometry. Biomolecules 2024, 14, 463. https://doi.org/10.3390/biom14040463
Lee JH, Ayoola MB, Shack LA, Swiatlo E, Nanduri B. Characterization of an Arginine Decarboxylase from Streptococcus pneumoniae by Ultrahigh-Performance Liquid Chromatography–Tandem Mass Spectrometry. Biomolecules. 2024; 14(4):463. https://doi.org/10.3390/biom14040463
Chicago/Turabian StyleLee, Jung Hwa, Moses B. Ayoola, Leslie A. Shack, Edwin Swiatlo, and Bindu Nanduri. 2024. "Characterization of an Arginine Decarboxylase from Streptococcus pneumoniae by Ultrahigh-Performance Liquid Chromatography–Tandem Mass Spectrometry" Biomolecules 14, no. 4: 463. https://doi.org/10.3390/biom14040463