Transcriptional Modulation of the Host Immunity Mediated by Cytokines and Transcriptional Factors in Plasmodium falciparum-Infected Patients of North-East India
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Site and Population
2.2. Study Design
2.3. Sample Collection
2.4. Sample Preparation and cDNA Synthesis
2.5. Primer Designing and Gene Expression Analysis
2.6. Statistical Analyses
3. Results
3.1. Clinical and Demographic Characteristics
3.2. Altered Expression Levels of Cytokines, Transcription Factors, and Other Signaling Molecules Among Different Malaria Sub-Groups
3.3. Differential Categorization of Cytokines and Other Regulatory Factors in Malaria Sub-Groups
3.4. Correlation Analyses of Cytokines, Transcription Factors and Other Signaling Molecules in Diverse Malaria Subgroups
3.5. Role of Innate Immunity Factors in Regulation of TH1 and TH2
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gazzinelli, R.T.; Kalantari, P.; Fitzgerald, K.A.; Golenbock, D.T. Innate sensing of malaria parasites. Nat. Rev. Immunol. 2014, 14, 744–757. [Google Scholar] [CrossRef]
- WHO. World Malaria Report 2018. WHO. Available online: http://www.who.int/malaria/publications/world-malaria-report-2018/en/ (accessed on 15 February 2019).
- Malaria Situation in India 2018. National Vector Borne Disease Control Programme. Directorate General of Health Services, Ministry of Health & Family Welfare, Government of India. Available online: http://www.nvbdcp.gov.in (accessed on 22 January 2019).
- Dev, V.; Adak, T.; Singh, O.; Nanda, N.; Baidya, B. Malaria transmission in Tripura: Disease distribution & determinants. Indian J. Med. Res. 2015, 142, 12. [Google Scholar] [CrossRef]
- Sharma, J. Antimalarial drug resistance malaria parasite: A review in NE states of India. Adv. Appl. Sci. Res. 2015, 6, 254–257. [Google Scholar]
- Shah, N.K.; Dhillon, G.P.; Dash, A.P.; Arora, U.; Meshnick, S.R.; Valecha, N. Antimalarial drug resistance of Plasmodium falciparum in India: Changes over time and space. Lancet Infect. Dis. 2011, 11, 57–64. [Google Scholar] [CrossRef]
- Dhiman, S.; Goswami, D.; Rabha, B.; Gopalakrishnan, R.; Baruah, I.; Singh, L. Malaria epidemiology along Indo-Bangladesh border in Tripura state, India. Southeast Asian J. Trop. Med. Public Health 2010, 41, 1279. [Google Scholar]
- Day, N.P.J.; Hien, T.T.; Schollaardt, T.; Loc, P.P.; Chuong, L.V.; Chau, T.T.H.; Mai, N.T.H.; Phu, N.H.; Sinh, D.X.; White, N.J.; et al. The Prognostic and Pathophysiologic Role of Pro- and Anti-inflammatory Cytokines in Severe Malaria. J. Infect. Dis. 1999, 180, 1288–1297. [Google Scholar] [CrossRef]
- Miller, L.H.; Baruch, D.I.; Marsh, K.; Doumbo, O.K. The pathogenic basis of malaria. Nature 2002, 415, 673–679. [Google Scholar] [CrossRef]
- Spellberg, B.; Edwards, J.E. Type 1/Type 2 Immunity in Infectious Diseases. Clin. Infect. Dis. 2001, 32, 76–102. [Google Scholar] [CrossRef]
- Liberman, A.C.; Refojo, D.; Arzt, E. Cytokine Signaling/Transcription Factor Cross–Talk in T Cell Activation and Th1-Th2 Differentiation. Arch. Immunol. Ther. Exp. 2003, 51, 351–366. [Google Scholar]
- Prakash, D.; Fesel, C.; Jain, R.; Cazenave, P.; Mishra, G.C.; Pied, S. Clusters of Cytokines Determine Malaria Severity in Plasmodium falciparum—Infected Patients from Endemic Areas of Central India. J. Infect. Dis. 2006, 194, 198–207. [Google Scholar] [CrossRef]
- District Profile of Dhalai District. Office of the District Magistrate & Collector. Government of Tripura. Available online: https://dhalai.nic.in/document-category/district-profile/ (accessed on 10 October 2018).
- Guidelines for Diagnosis and Treatment of Malaria in India. National Institute of Malaria Research and National Vector Borne Disease Control Programme. 2014. Available online: http://nimr.org.in/guidelines_books/ (accessed on 23 October 2018).
- Severe Malaria. Trop. Med. Int. Health 2014, 19, 7–131. [CrossRef]
- Thornton, B.; Basu, C. Real-Time PCR [qPCR] primer design using free online software. Biochem. Mol. Biol. Educ. 2011, 39, 145–154. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-Time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Metsalu, T.; Vilo, J. ClustVis: A web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef]
- Knox, J.J.; Cosma, G.L.; Betts, M.R.; McLane, L.M. Characterization of T-Bet and Eomes in Peripheral Human Immune Cells. Front. Immunol. 2014, 5, 217. [Google Scholar] [CrossRef]
- Yu, R.Y.L. BCL-6 negatively regulates macrophage proliferation by suppressing autocrine IL-6 production. Blood 2005, 105, 1777–1784. [Google Scholar] [CrossRef] [Green Version]
- Xie, M.M.; Koh, B.H.; Hollister, K.; Wu, H.; Sun, J.; Kaplan, M.H.; Dent, A.L. Bcl6 promotes follicular helper T-Cell differentiation and PD-1 expression in a Blimp1-independent manner in mice. Eur. J. Immunol. 2017, 47, 1136–1141. [Google Scholar] [CrossRef]
- Boulakirba, S.; Pfeifer, A.; Mhaidly, R.; Obba, S.; Goulard, M.; Schmitt, T.; Chaintreuil, P.; Calleja, A.; Furstoss, N.; Orange, F.; et al. IL-34 and CSF-1 display an equivalent macrophage differentiation ability but a different polarization potential. Sci. Rep. 2018, 8. [Google Scholar] [CrossRef]
- Oestreich, K.J.; Weinmann, A.S. T-Bet employs diverse regulatory mechanisms to repress transcription. Trends Immunol. 2012, 33, 78–83. [Google Scholar] [CrossRef]
- Mackroth, M.S.; Abel, A.; Steeg, C.; zur Wiesch, J.S.; Jacobs, T. Acute Malaria Induces PD1 + CTLA4 + Effector T Cells with Cell-Extrinsic Suppressor Function. PLoS Pathog. 2016, 12, e1005909. [Google Scholar] [CrossRef]
- Mahanta, A.; Kar, S.K.; Kakati, S.; Baruah, S. Heightened inflammation in severe malaria is associated with decreased IL-10 expression levels and neutrophils. Innate Immun. 2015, 21, 546–552. [Google Scholar] [CrossRef] [PubMed]
- Lyke, K.E.; Burges, R.; Cissoko, Y.; Sangare, L.; Dao, M.; Diarra, I.; Kone, A.; Harley, R.; Plowe, C.V.; Doumbo, O.K.; et al. Serum Levels of the Proinflammatory Cytokines Interleukin-1 Beta [IL-1], IL-6, IL-8, IL-10, Tumor Necrosis Factor Alpha, and IL-12[p70] in Malian Children with Severe Plasmodium falciparum Malaria and Matched Uncomplicated Malaria or Healthy Controls. Infect. Immun. 2004, 72, 5630–5637. [Google Scholar] [CrossRef] [PubMed]
- Abel, A.; Steeg, C.; Aminkiah, F.; Addai-Mensah, O.; Addo, M.; Gagliani, N.; Casar, C.; Yar, D.D.; Owusu-Dabo, E.; Jacobs, T.; et al. Differential expression pattern of co-Inhibitory molecules on CD4 + T cells in uncomplicated versus complicated malaria. Sci. Rep. 2018, 8. [Google Scholar] [CrossRef]
- Mahanta, A.; Baruah, S. Lower expression of GATA3 and T-bet correlates with downregulated IL-10 in severe falciparum malaria. Clin. Transl. Immunol. 2015, 4, e49. [Google Scholar] [CrossRef] [PubMed]
- Perkins, D.J.; Weinberg, J.B.; Kremsner, P.G. Reduced interleukin-12 and transforming growth factor—B 1 in severe childhood malaria: Relationship of cytokine balance with disease severity. J. Infect. Dis. 2000, 182, 988–992. [Google Scholar] [CrossRef] [PubMed]
- Luty, A.J.F.; Perkins, D.J.; Lell, B.; Schmidt-Ott, R.; Lehman, L.G.; Luckner, D.; Greve, B.; Matousek, P.; Herbich, K.; Schmid, D.; et al. Low Interleukin-12 Activity in Severe Plasmodium falciparum Malaria. Infect. Immun. 2000, 68, 3909–3915. [Google Scholar] [CrossRef] [PubMed]
- Chaiyaroj, S.C.; Rutta, A.S.M.; Muenthaisong, K.; Watkins, P.; Na Ubol, M.; Looareesuwan, S. Reduced levels of transforming growth factor-β1, interleukin-12 and increased migration inhibitory factor are associated with severe malaria. Acta Trop. 2004, 89, 319–327. [Google Scholar] [CrossRef]
- Luckhart, S.; Lieber, M.J.; Singh, N.; Zamora, R.; Vodovotz, Y. Low levels of mammalian TGF-β1 are protective against malaria parasite infection, a paradox clarified in the mosquito host. Exp. Parasitol. 2008, 118, 290–296. [Google Scholar] [CrossRef]
- Wenisch, C.; Parschalk, B.; Burgmann, H.; Looareesuwan, S.; Graninger, W. Decreased serum levels of TGF-β in patients with acute Plasmodium falciparum malaria. J. Clin. Immunol. 1995, 15, 69–73. [Google Scholar] [CrossRef]
- Omer, F.M.; Kurtzhals, J.A.L.; Riley, E.M. Maintaining the immunological balance in parasitic infections: A role for TGF-β? Parasitol. Today 2000, 16, 18–23. [Google Scholar] [CrossRef]
- Dodoo, D.; Omer, F.M.; Todd, J.; Akanmori, B.D.; Koram, K.A.; Riley, E.M. Absolute Levels and Ratios of Proinflammatory and Anti-inflammatory Cytokine Production In Vitro Predict Clinical Immunity to Plasmodium falciparum Malaria. J. Infect. Dis. 2002, 185, 971–979. [Google Scholar] [CrossRef] [PubMed]
- Malaguarnera, L.; Musumeci, S. The immune response to Plasmodium falciparum malaria. Lancet Infect. Dis. 2002, 2, 472–478. [Google Scholar] [CrossRef]
- Chua, C.L.L.; Brown, G.; Hamilton, J.A.; Rogerson, S.; Boeuf, P. Monocytes and macrophages in malaria: Protection or pathology? Trends Parasitol. 2013, 29, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Loughland, J.R.; Woodberry, T.; Boyle, M.J.; Tipping, P.E.; Piera, K.A.; Amante, F.H.; Kenangalem, E.; Price, R.N.; Engwerda, C.R.; Anstey, N.M. Plasmodium falciparum Activates CD16+ Dendritic Cells to Produce Tumor Necrosis Factor and Interleukin-10 in Subpatent Malaria. J. Infect. Dis. 2018, 219, 660–671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glimcher, L.H.; Townsend, M.J.; Sullivan, B.M.; Lord, G.M. Recent developments in the transcriptional regulation of cytolytic effector cells. Nat. Rev. Immunol. 2004, 4, 900–911. [Google Scholar] [CrossRef]
- Kurachi, M.; Barnitz, R.A.; Yosef, N.; Odorizzi, P.M.; DiIorio, M.A.; Lemieux, M.E.; Yates, K.; Godec, J.; Klatt, M.G.; Regev, A.; et al. The transcription factor BATF operates as an essential differentiation checkpoint in early effector CD8+ T cells. Nat. Immunol. 2014, 15, 373–383. [Google Scholar] [CrossRef] [PubMed]
- Quigley, M.; Pereyra, F.; Nilsson., B.; Porichis, F.; Fonseca, C.; Eichbaum, Q.; Julg, B.; Jesneck, J.L.; Brosnahan, K.; Imam, S.; et al. Transcriptional analysis of HIV-Specific CD8+ T cells shows that PD-1 inhibits T cell function by upregulating BATF. Nat. Med. 2010, 16, 1147–1151. [Google Scholar] [CrossRef]
- Wei, F.; Zhong, S.; Ma, Z.; Kong, H.; Medvec, A.; Ahmed, R.; Freeman, G.J.; Krogsgaard, M.; Riley, J.L. Strength of PD-1 signaling differentially affects T-cell effector functions. Proc. Natl. Acad. Sci. USA 2013, 110, E2480–E2489. [Google Scholar] [CrossRef] [Green Version]
- Horne-Debets, J.M.; Faleiro, R.; Karunarathne, D.S.; Liu, X.Q.; Lineburg, K.E.; Poh, C.M.; Grotenbreg, G.M.; Hill, G.R.; MacDonald, K.P.A.; Good, M.F.; et al. PD-1 Dependent Exhaustion of CD8+ T Cells Drives Chronic Malaria. Cell Rep. 2013, 5, 1204–1213. [Google Scholar] [CrossRef] [Green Version]
- Poholek, A.C.; Hansen, K.; Hernandez, S.G.; Eto, D.; Chandele, A.; Weinstein, J.S.; Dong, X.; Odegard, J.M.; Kaech, S.M.; Dent, A.L. In vivo regulation of Bcl6 and T follicular helper cell development. J. Immunol. 2010, 185, 313–326. [Google Scholar] [CrossRef]
- Obeng-Adjei, N.; Portugal, S.; Tran, T.M.; Yazew, T.B.; Skinner, J.; Li, S.; Jain, A.; Felgner, P.L.; Doumbo, O.K.; Kayentao, K.; et al. Circulating Th1-Cell-type Tfh Cells that Exhibit Impaired B Cell Help Are Preferentially Activated during Acute Malaria in Children. Cell Rep. 2015, 13, 425–439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trapani, J.A.; Smyth, M.J. Functional significance of the perforin/granzyme cell death pathway. Nat. Rev. Immunol. 2002, 2, 735–747. [Google Scholar] [CrossRef] [PubMed]
- Froelich, C.J.; Orth, K.; Turbov, J.; Seth, P.; Gottlieb, R.; Babior, B.; Shah, G.M.; Bleackley, R.C.; Dixit, V.M.; Hanna, W. New Paradigm for Lymphocyte Granule-Mediated Cytotoxicity: Target cells bind and internalize granzyme b, but an endosomolytic agent is necessary for cytosolic delivery and subsequent apoptosis. J. Biol. Chem. 1996, 271, 29073–29079. [Google Scholar] [CrossRef] [PubMed]
- De Bruijn, M.; Dzierzak, E. Runx transcription factors in the development and function of the definitive hematopoietic system. Blood 2017, 129, 2061–2069. [Google Scholar] [CrossRef] [PubMed]
- Wong, W.F.; Kohu, K.; Chiba, T.; Sato, T.; Satake, M. Interplay of transcription factors in T-Cell differentiation and function: The role of Runx: Runx transcription factor and T lymphocytes. Immunology 2011, 132, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Djuretic, I.M.; Levanon, D.; Negreanu, V.; Groner, Y.; Rao, A.; Ansel, K.M. Transcription factors T-Bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat. Immunol. 2007, 8, 145. [Google Scholar] [CrossRef] [PubMed]
- Yagi, R.; Junttila, I.S.; Wei, G.; Urban, J.F., Jr.; Zhao, K.; Paul, W.E.; Zhu, J. The transcription factor GATA3 actively represses RUNX3 protein-Regulated production of interferon-γ. Immunity 2010, 32, 507–517. [Google Scholar] [CrossRef] [PubMed]
- Griffith, J.W.; Sokol, C.L.; Luster, A.D. Chemokines and Chemokine Receptors: Positioning Cells for Host Defense and Immunity. Annu. Rev. Immunol. 2014, 32, 659–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ioannidis, L.J.; Nie, C.Q.; Hansen, D.S. The role of chemokines in severe malaria: More than meets the eye. Parasitology 2014, 141, 602–613. [Google Scholar] [CrossRef] [PubMed]
- Hansen, D.S.; Bernard, N.J.; Nie, C.Q.; Schofield, L. NK Cells Stimulate Recruitment of CXCR3+ T Cells to the Brain during Plasmodium berghei-Mediated Cerebral Malaria. J. Immunol. 2007, 178, 5779–5788. [Google Scholar] [CrossRef] [PubMed]
- Campanella, G.S.V.; Tager, A.M.; El Khoury, J.K.; Thomas, S.Y.; Abrazinski, T.A.; Manice, L.A.; Colvin, R.A.; Luster, A.D. Chemokine receptor CXCR3 and its ligands CXCL9 and CXCL10 are required for the development of murine cerebral malaria. Proc. Natl. Acad. Sci. USA 2008, 105, 4814–4819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ochiel, D.O.; Awandare, G.A.; Keller, C.C.; Hittner, J.B.; Kremsner, P.G.; Weinberg, J.B.; Perkins, D.J. Differential Regulation of —Chemokines in Children with Plasmodium falciparum Malaria. Infect. Immun. 2005, 73, 4190–4197. [Google Scholar] [CrossRef] [PubMed]
- Were, T.; Hittner, J.B.; Ouma, C.; Otieno, R.O.; Orago, A.S.; Ong’echa, J.M.; Vulule, J.M.; Keller, C.C.; Perkins, D.J. Suppression of RANTES in children with Plasmodium falciparum malaria. Haematologica 2006, 91, 1396–1399. [Google Scholar] [PubMed]
- Burgmann, H.; Hollenstein, U.; Wenisch, C.; Thalhammer, F.; Looareesuwan, S.; Graninger, W. Serum concentrations of MIP-1 α and interleukin-8 in patients suffering from acute Plasmodium falciparum malaria. Clin. Immunol. Immunopathol. 1995, 76, 32–36. [Google Scholar] [CrossRef] [PubMed]
- Lopera-Mesa, T.M.; Mita-Mendoza, N.K.; van de Hoef, D.L.; Doumbia, S.; Konaté, D.; Doumbouya, M.; Gu, W.; Traoré, K.; Diakité, S.A.S.; Remaley, A.T.; et al. Plasma Uric Acid Levels Correlate with Inflammation and Disease Severity in Malian Children with Plasmodium falciparum Malaria. PLoS ONE 2012, 7, e46424. [Google Scholar] [CrossRef] [PubMed]
UC1 (n = 05) | UC2 (n = 12) | SM (n = 05) | EC (n = 06) | NEC (n = 03) | |
---|---|---|---|---|---|
Age | 16.8 ± 4.96 * | 26.58 ± 10.70 | 22.8 ± 11.78 | 30 ± 8.32 * | 34 ± 5.29 |
Gender F [%] | 4 (80) | 2 (16.7) | 1(20) | 3 (50) | 1(33.3) |
BMI | 17.92 ± 1.44 * | 18.54 ± 2.53 ** | 19.18 ± 2.24 & | 22.80 ± 3.60 *, **, & | 24.96 ± 2.38 |
Parasite/μL | 9104 ± 3242.42 | 90184.75 ± 28871.36 | 289859.6 ± 98092.5 | NA | NA |
Systolic B.P | 116.2 ± 10.92 | 108.16 ± 18.38 ** | 100.6 ± 14.10 & | 133.33 ± 8.62 **, & | 116 ± 8.89 |
Diastolic B.P | 79.4 ± 9.42 # | 70.33 ± 9.54 ** | 68.2 ± 4.87 #, & | 86.66 ± 4.13 **, & | 76.33 ± 5.69 |
Pulse | 110 ± 16.19 * | 92.41 ± 18.48 | 97 ± 18.17 | 82.5 ± 11.15 * | 84 ± 2.0 |
RR | 22.6 ± 1.52 #, $ | 25.83 ± 2.48 **, ##, $ | 36.4 ± 1.14 #, ##, & | 20.83 ± 1.83 **, & | 19 ± 1.0 |
Hb [g/dL] | 12.34 ± 1.05 | 13.09 ± 0.86 ## | 11.2 ± 3.17 ## | 12.60 ± 1.69 | 14.53 ± 0.32 |
HCT [%] | 37.6 ± 3.21 | 39.08 ± 3.45 | 34.8 ± 10.99 | 39.83 ± 5.34 | 43.33 ± 1.53 |
S.N | Genes (Homo Sapiens) | HGNC Gene ID | Forward Primer | Reverse Primer | Product Size (bp) | Tm | DDBJ Accession Numbers | NCBI Chromosome Location |
---|---|---|---|---|---|---|---|---|
1 | IFN-γ (IFNG) | HGNC:5438 | GCAGCCAACCTAAGCAAGAT | CAAACCGGCAGTAACTGGAT | 103 | 60 | LC461674 | 12q15 |
2 | TNF-α (TNF-alpha) | HGNC:11892 | GCCCGACTATCTCGACTTTG | GGTTGAGGGTGTCTGAAGGA | 141 | 60 | LC461675 | 6p21.33 |
3 | TGF-β1 (TGFB1) | HGNC:11766 | CCCTGGACACCAACTATTGC | CAGAAGTTGGCATGGTAGCC | 130 | 60 | LC461676 | 19q13.2 |
4 | β-ACTIN (ACTB) | HGNC:132 | TCGTGCGTGACATTAAGGAG | GTCAGGCAGCTCGTAGCTCT | 110 | 60 | LC461677 | 7p22.1 |
5 | IL-1β (IL1B) | HGNC:5992 | GGCGGCCAGGATATAACT | CCCTAGGGATTGAGTCCACA | 100 | 60 | LC461678 | 2q14.1 |
6 | IL-4 | HGNC:6014 | GGCTTGAATTCCTGTCCTGT | ATGATCGTCTTTAGCCTTTC | 77 | 60 | LC461679 | 5q31.1 |
7 | IL-5 | HGNC:6016 | AGGGCCAAGAAAGAGTCAGG | TGCCTGGAGGAAAATACTTC | 153 | 60 | LC461680 | 5q31.1 |
8 | IL-7 | HGNC:6023 | TTCCTCTGGTCCTCATCCAG | ATCCGCCAGCAGTGTACTTT | 140 | 60 | LC461681 | 8q21.13 |
9 | IL-8 (CXCL8) | HGNC:6025 | CTAGGACAAGAGCCAGGAAGAA | AACTGCACCTTCACACAGAGC | 128 | 60 | LC461682 | 4q13.3 |
10 | IL-10 | HGNC:5962 | TTGGGGCTTCCTAACTGCTAC | AGTGGTTGGGGAATGAGGTTAG | 118 | 62 | LC461683 | 1q32.1 |
11 | IL-12B | HGNC:5970 | ATTGTGCCACTGCATACCAG | AGGACTGCCATGGAAGCTAA | 101 | 62 | LC461684 | 5q33.3 |
12 | IL-12Rβ2 | HGNC:5972 | ACTGGAGCCTCAGCACATCT | AGCCTCACCACTCAGAGCAT | 138 | 60 | LC461685 | 1p31.3 |
13 | IL-13 | HGNC:5973 | GCCAAGGGTTCAGAGACTCA | GACCCCAGTGAGGTAGCAGA | 102 | 60 | LC461686 | 5q31.1 |
14 | RUNX1 | HGNC:10471 | GGGAACTGTCAAGCTGGTGT | CTGTGTACCGTGGACTGTGGA | 126 | 58 | LC461687 | 21q22.12 |
15 | RUNX3 | HGNC:10473 | TGAGAGGTGGGGAGTACTGG | GGCAAGACTTCACCTCGGAA | 102 | 60 | LC461688 | 1p36.11 |
16 | IRF1 | HGNC:6116 | GAAGAACATGGATGCCACCT | TCTCTGCACCATATCCACCA | 156 | 60 | LC461689 | 5q31.1 |
17 | T-BET (TBX21) | HGNC:11599 | GGAAACGGATGAAGGACTGA | ATCCTTCTTGAGCCCCACTT | 89 | 58 | LC461690 | 17q21.32 |
18 | GATA3 | HGNC:4172 | GAGGGTAGCAGTGTATGAGCT | CACTAACACAGAACACGACAGG | 112 | 58 | LC461691 | 10p14 |
19 | STAT1 | HGNC:11362 | ACAAAGTCATGGCTGCTGAG | AAGTTCCATTGGCTCTGGTG | 128 | 60 | LC461692 | 2q32.2 |
20 | STAT4 | HGNC:11365 | CAACCAACGATTCCCAGAAC | TCTGCCAGCATATGGAGTTG | 142 | 58 | LC461693 | 2q32.2-q32.3 |
21 | STAT6 | HGNC:11368 | AACATCCAGCCATTCTCTGC | TTGGGCTTCTTGGGATAGAG | 101 | 58 | LC461694 | 12q13.3 |
22 | NF-KB1 (NFKB1) | HGNC:7794 | CTGGAAGCACGAATGACAGA | TGAGGTCCATCTCCTTGGTC | 172 | 60 | LC461695 | 4q24 |
23 | EOMES | HGNC:3372 | CCACTGCCCACTACAATGTG | CTCATCCAGTGGGAACCAGT | 166 | 60 | LC461696 | 3p24.1 |
24 | GrB (GZMB) | HGNC:4709 | CCAGGGCATTGTCTCCTATG | ATTACAGCGGGGGCTTAGTT | 138 | 60 | LC461697 | 14q12 |
25 | PERFORIN (PRF1) | HGNC:9360 | CATGTAACCAGGGCCAAAGT | GGCTTAGGAGTCACGTCCAG | 104 | 60 | LC461698 | 10q22.1 |
26 | CSF1 | HGNC:2432 | TAAGAGACCCTGCCCTACCTG | CAAGTTCACTGCCCTTCCCTA | 127 | 58 | LC461699 | 1p13.3 |
27 | LT-ALPHA (LTA) | HGNC:6709 | CCTGATGTCTGTCTGGCTGA | TGCTCTTCCTCTGTGTGTGG | 113 | 60 | LC461700 | 6p21.33 |
28 | CXCR3 | HGNC:4540 | AGCTTTGACCGCTACCTGAA | GCCGACAGGAAGATGAAGTC | 140 | 60 | LC461701 | Xq13.1 |
29 | CCR8 | HGNC:1609 | CCCTGTGATGCGGAACTTAT | CAGACCACAAGGACCAGGAT | 119 | 60 | LC461702 | 3p22.1 |
30 | cMAF | HGNC:6776 | CTTTGCTCTCTGCCTCGTCT | CGCTCTCTACCTCTGTGCAA | 141 | 60 | LC461703 | 16q23.2 |
31 | NFAT1 (NFATC2) | HGNC:7776 | CTGGAGGTGGGTTTCTACCA | AGGGGCAGAAGGGATCTTTA | 134 | 60 | LC461704 | 20q13.2 |
32 | cJUN(AP1) | HGNC:6204 | CACGTGAAGTGACGGACTGT | CAGGGTCATGCTCTGTTTCA | 143 | 60 | LC461705 | 1p32.1 |
33 | p38 MAPK (MAPK14) | HGNC:6876 | TGCACATGCCTACTTTGCTC | AGGTCAGGCTTTTCCACTCA | 116 | 60 | LC461706 | 6p21.31 |
34 | SOCS1 | HGNC:19383 | AGACCCCTTCTCACCTCTTGA | TAGGAGGTGCGAGTTCAGGT | 117 | 60 | LC461707 | 16p13.13 |
35 | SOCS3 | HGNC:19391 | GAGACGGGACATCTTTCACCT | CAGGCTGAGTATGTGGCTTTC | 152 | 60 | LC461708 | 17q25.3 |
36 | BATF | HGNC:958 | GGAGTGAACACGGGAACTGT | CCATGGGACTTGAGCATCTT | 148 | 60 | LC461709 | 14q24.3 |
37 | BCL6 | HGNC:1001 | CAGCCACAAGACCGTCCATAC | CGAGTGTGGGTTTTCAGGTTG | 96 | 60 | LC461710 | 3q27.3 |
38 | ETS1 | HGNC:3488 | TGGTCTAGCTGGGTGAAACC | CCAGAATGGAGAAGGGAACA | 102 | 60 | LC461711 | 11q24.3 |
39 | PD-1 (PDCD1) | HGNC:8760 | CCTGCAGGCCTAGAGAAGTTT | GGGCATGTGTAAAGGTGGAG | 91 | 60 | LC461712 | 2q37.3 |
40 | RANTES (CCL5) | HGNC:10632 | TCTGTGACCAGGAAGGAAGTC | GTTTGCCAGTAAGCTCCTGTG | 108 | 60 | LC461713 | 17q12 |
Cluster 1 | Cluster 2 | Cluster 3 | ||
---|---|---|---|---|
IFNγ | Runx3 | TNFα | p38 | NFκB |
TGF-β | Stat4 | IL10 | BATF | |
IL12 | Stat6 | IL1β | BCL6 | |
GATA3 | IL12Rβ2 | Granzyme B | IRF1 | |
Tbet | CXCR3 | Stat1 | PD-1 | |
Eomes | CCR8 | IL7 | ||
IL4 | LTα | cMAF | ||
IL5 | NFAT | cJUN | ||
IL13 | ETS1 | Socs1 | ||
CSF1 | IL8 | Socs3 | ||
Perforin | Rantes | |||
Runx1 |
Factors (All Malaria Cases) | TBET ** | Factors (All Malaria Cases) | GATA3 *** | ||
---|---|---|---|---|---|
Standardized Coefficient (Beta) | p-Value * | Standardized Coefficient (Beta) | p-Value * | ||
IL-1β | −0.645 | 0.001 | IL-1β | −0.619 | 0.002 |
EOMES | 0.909 | 0.000 | PERFORIN | 0.639 | 0.001 |
PERFORIN | 0.882 | 0.000 | GRANZY-B | 0.418 | 0.053 |
GRANZ-B | 0.639 | 0.001 | LT alpha | 0.740 | 0.000 |
LT alpha | 0.610 | 0.003 | CXCR3 | 0.769 | 0.000 |
CXCR3 | 0.864 | 0.000 | CCR8 | 0.474 | 0.026 |
CCR8 | 0.435 | 0.043 | ETS1 | 0.859 | 0.000 |
ETS1 | 0.810 | 0.000 | IRF1 | −0.503 | 0.017 |
IRF1 | −0.555 | 0.007 | RANTES | 0.747 | 0.000 |
RANTES | 0.868 | 0.000 | BCL6 | −0.549 | 0.008 |
BCL6 | −0.738 | 0.000 | PD-1 | 0.696 | 0.000 |
PD-1 | 0.869 | 0.000 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmed, M.Z.; Bhardwaj, N.; Sharma, S.; Pande, V.; Anvikar, A.R. Transcriptional Modulation of the Host Immunity Mediated by Cytokines and Transcriptional Factors in Plasmodium falciparum-Infected Patients of North-East India. Biomolecules 2019, 9, 600. https://doi.org/10.3390/biom9100600
Ahmed MZ, Bhardwaj N, Sharma S, Pande V, Anvikar AR. Transcriptional Modulation of the Host Immunity Mediated by Cytokines and Transcriptional Factors in Plasmodium falciparum-Infected Patients of North-East India. Biomolecules. 2019; 9(10):600. https://doi.org/10.3390/biom9100600
Chicago/Turabian StyleAhmed, Md Zohaib, Nitin Bhardwaj, Supriya Sharma, Veena Pande, and Anupkumar R Anvikar. 2019. "Transcriptional Modulation of the Host Immunity Mediated by Cytokines and Transcriptional Factors in Plasmodium falciparum-Infected Patients of North-East India" Biomolecules 9, no. 10: 600. https://doi.org/10.3390/biom9100600