Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula
Abstract
:1. Introduction
2. Results
2.1. MtrGSTF7 Knockout Prevents Anthocyanin but Not Proanthocyanin Accumulation in M. truncatula Organs
2.2. Expression Analysis
2.3. Restoration of Anthocyanin Transport Deficiency of the Arabidopsis tt19 Mutant
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Quantification of Anthocyanins and PAs
4.3. Identification of the Mutated Gene
4.4. RNA Isolation and cDNA Synthesis
4.5. Gene Expression Analysis
4.5.1. Real-Time PCR
4.5.2. In Silico Expression Analysis
4.6. Phylogenetic Analysis
4.7. Arabidopsis tt19 Complementation
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dixon, R.A.; Pasinetti, G.M. Flavonoids and isoflavonoids: From plant biology to agriculture and neuroscience. Plant Physiol. 2010, 154, 453–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harborne, J.B.; Williams, C.A. Anthocyanins and other flavonoids. Nat. Prod. Rep. 2001, 18, 310–333. [Google Scholar] [CrossRef] [PubMed]
- Veitch, N.C.; Grayer, R.J. Flavonoids and their glycosides, including anthocyanins. Nat. Prod. Rep. 2008, 25, 555–611. [Google Scholar] [CrossRef] [PubMed]
- Iwashina, T. Flavonoid function and activity to plants and other organisms. Biol. Sci. Space 2003, 17, 24–44. [Google Scholar] [CrossRef] [Green Version]
- Antony, U.; Chandra, T.S. Antinutrient Reduction and Enhancement in Protein, Starch, and Mineral Availability in Fermented Flour of Finger Millet (Eleusine coracana). J. Agric. Food Chem. 1998, 46, 2578–2582. [Google Scholar] [CrossRef]
- Zhao, J. Flavonoid transport mechanisms: How to go, and with whom. Trends Plant Sci. 2015, 20, 576–585. [Google Scholar] [CrossRef]
- Zhao, J.; Pang, Y.; Dixon, R.A. The mysteries of proanthocyanidin transport and polymerization. Plant Physiol. 2010, 153, 437–443. [Google Scholar] [CrossRef] [Green Version]
- Blakc-Kalff, M.M.A.; Coleman, J.O.D. Detoxification of xenobiotics by plant cells: Characterisation of vacuolar amphiphilic organic anion transporters. Planta 1996, 200, 426–431. [Google Scholar] [CrossRef]
- Coleman, J.O.D.; Blake-Kalff, M.M.A.; Davies, T.G.E. Detoxification of xenobiotics by plants: Chemical modification and vacuolar compartmentation. Trends Plant Sci. 1997, 2, 144–151. [Google Scholar] [CrossRef] [Green Version]
- Lamoureux, G.L.; Shimabukuro, R.H.; Frear, D.S. Glutathione and glucoside conjugation in herbicide selectivity. In Herbicide Resistance in Weeds and Crops; Elsevier: Amsterdam, The Netherlands, 1991; pp. 227–261. [Google Scholar]
- Dixon, D.P.; Davis, B.G.; Edwards, R. Functional divergence in the glutathione transferase superfamily in plants: Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. J. Biol. Chem. 2002, 277, 30859–30869. [Google Scholar] [CrossRef] [Green Version]
- Edwards, R.; Dixon, D.P. Plant glutathione transferases. Methods Enzymol. 2005, 401, 169–186. [Google Scholar] [CrossRef] [Green Version]
- Han, X.M.; Yang, Z.L.; Liu, Y.J.; Yang, H.L.; Zeng, Q.Y. Genome-wide profiling of expression and biochemical functions of the Medicago glutathione S-transferase gene family. Plant Physiol. Biochem. 2018, 126, 126–133. [Google Scholar] [CrossRef]
- Marrs, K.A.; Alfenito, M.R.; Lloyd, A.M.; Walbot, V. A glutathione S-transferase involved in vacuolar transfer encoded by the maize gene Bronze-2. Nature 1995, 375, 397–400. [Google Scholar] [CrossRef]
- Kitamura, S.; Shikazono, N.; Tanaka, A. TRANSPARENT TESTA 19 is involved in the accumulation of both anthocyanins and proanthocyanidins in Arabidopsis. Plant J. 2004, 37, 104–114. [Google Scholar] [CrossRef]
- Hu, B.; Zhao, J.; Lai, B.; Qin, Y.; Wang, H.; Hu, G. LcGST4 is an anthocyanin-related glutathione S-transferase gene in Litchi chinensis Sonn. Plant Cell Rep. 2016, 35, 831–843. [Google Scholar] [CrossRef]
- Lai, B.; You, Y.; Zhang, L.; Wang, Q.; Chen, F.; Luo, G.; Du, L.; Wang, H. Identification and functional characterization of RsGST1, an anthocyanin-related glutathione S-transferase gene in radish. J. Plant Physiol. 2021, 263, 153468. [Google Scholar] [CrossRef]
- Pérez-Díaz, R.; Madrid-Espinoza, J.; Salinas-Cornejo, J.; González-Villanueva, E.; Ruiz-Lara, S. Differential Roles for VviGST1, VviGST3, and VviGST4 in Proanthocyanidin and Anthocyanin Transport in Vitis vinífera. Front. Plant Sci. 2016, 7, 1166. [Google Scholar] [CrossRef] [Green Version]
- Jiang, S.; Chen, M.; He, N.; Chen, X.; Wang, N.; Sun, Q.; Zhang, T.; Xu, H.; Fang, H.; Wang, Y.; et al. MdGSTF6, activated by MdMYB1, plays an essential role in anthocyanin accumulation in apple. Hortic. Res. 2019, 6, 40. [Google Scholar] [CrossRef] [Green Version]
- Jonker, A.; Yu, P. The Role of Proanthocyanidins Complex in Structure and Nutrition Interaction in Alfalfa Forage. Int. J. Mol. Sci. 2016, 17, 793. [Google Scholar] [CrossRef] [Green Version]
- McMahon, L.R.; McAllister, T.A.; Berg, B.P.; Majak, W.; Acharya, S.N.; Popp, J.D.; Coulman, B.E.; Wang, Y.; Cheng, K.J. A review of the effects of forage condensed tannins on ruminal fermentation and bloat in grazing cattle. Can. J. Plant Sci. 2000, 80, 469–485. [Google Scholar] [CrossRef] [Green Version]
- Popp, J.D.; McCaughey, W.P.; Cohen, R.D.H.; McAllister, T.A.; Majak, W. Enhancing pasture productivity with alfalfa: A review. Can. J. Plant Sci. 2000, 80, 513–519. [Google Scholar] [CrossRef]
- Porceddu, A.; Panara, F.; Calderini, O.; Molinari, L.; Taviani, P.; Lanfaloni, L.; Scotti, C.; Carelli, M.; Scaramelli, L.; Bruschi, G.; et al. An Italian functional genomic resource for Medicago truncatula. BMC Res. Notes 2008, 1, 129. [Google Scholar] [CrossRef]
- Kaur, P.; Lui, C.; Dudchenko, O.; Nandety, R.S.; Hurgobin, B.; Pham, M.; Aiden, E.L.; Wen, J.; Mysore, K. Delineating the Tnt1 Insertion Landscape of the Model Legume Medicago truncatula cv. R108 at the Hi-C Resolution Using a Chromosome-Length Genome Assembly. Int. J. Mol. Sci. 2021, 22, 4326. [Google Scholar] [CrossRef]
- Benedito, V.A.; Torres-Jerez, I.; Murray, J.D.; Andriankaja, A.; Allen, S.; Kakar, K.; Wandrey, M.; Verdier, J.; Zuber, H.; Ott, T.; et al. A gene expression atlas of the model legume Medicago truncatula. Plant J. 2008, 55, 504–513. [Google Scholar] [CrossRef]
- Peel, G.J.; Pang, Y.; Modolo, L.V.; Dixon, R.A. The LAP1 MYB transcription factor orchestrates anthocyanidin biosynthesis and glycosylation in Medicago. Plant J. 2009, 59, 136–149. [Google Scholar] [CrossRef]
- Dai, X.; Wang, G.; Yang, D.S.; Tang, Y.; Broun, P.; Marks, M.D.; Sumner, L.W.; Dixon, R.A.; Zhao, P.X. TrichOME: A Comparative Omics Database for Plant Trichomes. Plant Physiol. 2010, 152, 44. [Google Scholar] [CrossRef] [Green Version]
- Tanner, G.J.; Francki, K.T.; Abrahams, S.; Watson, J.M.; Larkin, P.J.; Ashton, A.R. Proanthocyanidin biosynthesis in plants. Purification of legume leucoanthocyanidin reductase and molecular cloning of its cDNA. J. Biol. Chem. 2003, 278, 31647–31656. [Google Scholar] [CrossRef] [Green Version]
- Paolocci, F.; Robbins, M.P.; Madeo, L.; Arcioni, S.; Martens, S.; Damiani, F. Ectopic Expression of a Basic Helix-Loop-Helix Gene Transactivates Parallel Pathways of Proanthocyanidin Biosynthesis. Structure, Expression Analysis, and Genetic Control of Leucoanthocyanidin 4-Reductase and Anthocyanidin Reductase Genes in Lotus corn. Plant Physiol. 2007, 143, 504. [Google Scholar] [CrossRef] [Green Version]
- Liu, C.; Wang, X.; Shulaev, V.; Dixon, R.A. A role for leucoanthocyanidin reductase in the extension of proanthocyanidins. Nat. Plants 2016, 2, 1–7. [Google Scholar] [CrossRef]
- Pang, Y.; Peel, G.J.; Sharma, S.B.; Tang, Y.; Dixon, R.A. A transcript profiling approach reveals an epicatechin-specific glucosyltransferase expressed in the seed coat of Medicago truncatula. Proc. Natl. Acad. Sci. USA 2008, 105, 14210–14215. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.; Feng, Y.; Yu, S.; Fan, Z.; Li, X.; Li, J.; Yin, H. The flavonoid biosynthesis network in plants. Int. J. Mol. Sci. 2021, 22, 2824. [Google Scholar] [CrossRef] [PubMed]
- Naing, A.H.; Kim, C.K. Abiotic stress-induced anthocyanins in plants: Their role in tolerance to abiotic stresses. Physiol. Plant. 2021, 172, 1711–1723. [Google Scholar] [CrossRef] [PubMed]
- Cappellini, F.; Marinelli, A.; Toccaceli, M.; Tonelli, C.; Petroni, K. Anthocyanins: From Mechanisms of Regulation in Plants to Health Benefits in Foods. Front. Plant Sci. 2021, 12. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Sharma, N.; Kapoor, P.; Chunduri, V.; Pandey, A.K.; Garg, M. Spotlight on the overlapping routes and partners for anthocyanin transport in plants. Physiol. Plant. 2021, 171, 868–881. [Google Scholar] [CrossRef]
- Larsen, E.S.; Alfenito, M.R.; Briggs, W.R.; Walbot, V. A carnation anthocyanin mutant is complemented by the glutathione S-transferases encoded by maize Bz2 and petunia An9. Plant Cell Rep. 2003, 21, 900–904. [Google Scholar] [CrossRef]
- Yamazaki, M.; Shibata, M.; Nishiyama, Y.; Springob, K.; Kitayama, M.; Shimada, N.; Aoki, T.; Ayabe, S.I.; Saito, K. Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes. FEBS J. 2008, 275, 3494–3502. [Google Scholar] [CrossRef]
- Conn, S.; Curtin, C.; Bézier, A.; Franco, C.; Zhang, W. Purification, molecular cloning, and characterization of glutathione S-transferases (GSTs) from pigmented Vitis vinifera L. cell suspension cultures as putative anthocyanin transport proteins. J. Exp. Bot. 2008, 59, 3621–3634. [Google Scholar] [CrossRef] [Green Version]
- Kitamura, S.; Akita, Y.; Ishizaka, H.; Narumi, I.; Tanaka, A. Molecular characterization of an anthocyanin-related glutathione S-transferase gene in cyclamen. J. Plant Physiol. 2012, 169, 636–642. [Google Scholar] [CrossRef]
- Wang, Y.; Tang, Y.; Zhang, M.; Cai, F.; Qin, J.; Wang, Q.; Liu, C.; Wang, G.; Xu, L.; Yang, L.; et al. Molecular cloning and functional characterization of a glutathione S-transferase involved in both anthocyanin and proanthocyanidin accumulation in Camelina sativa (Brassicaceae). Genet. Mol. Res. 2012, 11, 4711–4719. [Google Scholar] [CrossRef]
- Cheng, J.; Liao, L.; Zhou, H.; Gu, C.; Wang, L.; Han, Y. A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers. J. Exp. Bot. 2015, 66, 7227–7239. [Google Scholar] [CrossRef] [Green Version]
- Luo, H.; Dai, C.; Li, Y.; Feng, J.; Liu, Z.; Kang, C. Reduced Anthocyanins in Petioles codes for a GST anthocyanin transporter that is essential for the foliage and fruit coloration in strawberry. J. Exp. Bot. 2018, 69, 2595–2608. [Google Scholar] [CrossRef] [Green Version]
- Kou, M.; Liu, Y.J.; Li, Z.Y.; Zhang, Y.G.; Tang, W.; Yan, H.; Wang, X.; Chen, X.G.; Su, Z.X.; Arisha, M.H.; et al. A novel glutathione S-transferase gene from sweetpotato, IbGSTF4, is involved in anthocyanin sequestration. Plant Physiol. Biochem. 2019, 135, 395–403. [Google Scholar] [CrossRef]
- Liu, Y.; Qi, Y.; Zhang, A.; Wu, H.; Liu, Z.; Ren, X. Molecular cloning and functional characterization of AcGST1, an anthocyanin-related glutathione S-transferase gene in kiwifruit (Actinidia chinensis). Plant Mol. Biol. 2019, 100, 451–465. [Google Scholar] [CrossRef]
- Roy, S.; Liu, W.; Nandety, R.S.; Crook, A.; Mysore, K.S.; Pislariu, C.I.; Frugoli, J.; Dickstein, R.; Udvardi, M.K. Celebrating 20 Years of Genetic Discoveries in Legume Nodulation and Symbiotic Nitrogen Fixation. Plant Cell 2020, 32, 15–41. [Google Scholar] [CrossRef] [Green Version]
- Liu, C.; Ha, C.M.; Dixon, R.A. Functional genomics in the study of metabolic pathways in Medicago truncatula: An overview. Methods Mol. Biol. 2018, 1822, 315–337. [Google Scholar] [CrossRef]
- Zhao, J.; Huhman, D.; Shadle, G.; He, X.Z.; Sumner, L.W.; Tang, Y.; Dixon, R.A. MATE2 Mediates Vacuolar Sequestration of Flavonoid Glycosides and Glycoside Malonates in Medicago truncatula. Plant Cell 2011, 23, 1536–1555. [Google Scholar] [CrossRef] [Green Version]
- Mueller, L.A.; Goodman, C.D.; Silady, R.A.; Walbot, V. AN9, a petunia glutathione S-transferase required for anthocyanin sequestration, is a flavonoid-binding protein. Plant Physiol. 2000, 123, 1561–1570. [Google Scholar] [CrossRef] [Green Version]
- Vilperte, V.; Boehm, R.; Debener, T. A highly mutable GST is essential for bract colouration in Euphorbia pulcherrima Willd. Ex Klotsch. BMC Genom. 2021, 22. [Google Scholar] [CrossRef]
- Cui, Y.; Fan, J.; Lu, C.; Ren, J.; Qi, F.; Huang, H.; Dai, S. ScGST3 and multiple R2R3-MYB transcription factors function in anthocyanin accumulation in Senecio cruentus. Plant Sci. 2021, 313, 111094. [Google Scholar] [CrossRef]
- Shao, D.; Li, Y.; Zhu, Q.; Zhang, X.; Liu, F.; Xue, F.; Sun, J. GhGSTF12, a glutathione S-transferase gene, is essential for anthocyanin accumulation in cotton (Gossypium hirsutum L.). Plant Sci. 2021, 305, 110827. [Google Scholar] [CrossRef]
- Cao, Y.; Xu, L.; Xu, H.; Yang, P.; He, G.; Tang, Y.; Qi, X.; Song, M.; Ming, J. LhGST is an anthocyanin-related glutathione S-transferase gene in Asiatic hybrid lilies (Lilium spp.). Plant Cell Rep. 2021, 40, 85–95. [Google Scholar] [CrossRef]
- Trinh, T.H.; Ratet, P.; Kondorosi, E.; Durand, P.; Kamaté, K.; Bauer, P.; Kondorosi, A. Rapid and efficient transformation of diploid Medicago truncatula and Medicago sativa ssp. falcata lines improved in somatic embryogenesis. Plant Cell Rep. 1998, 17, 345–355. [Google Scholar] [CrossRef]
- Li, Y.G.; Tanner, G.; Larkin, P. The DMACA-HCl protocol and the threshold proanthocyanidin content for bloat safety in forage legumes. J. Sci. Food Agric. 1996, 70, 89–101. [Google Scholar] [CrossRef]
- Dong, X.; Braun, E.L.; Grotewold, E. Functional Conservation of Plant Secondary Metabolic Enzymes Revealed by Complementation of Arabidopsis Flavonoid Mutants with Maize Genes. Plant Physiol. 2001, 127, 46. [Google Scholar] [CrossRef] [Green Version]
- Medicago truncatula Handbook; Samuel Roberts Noble Foundation: Ardmore, OK, USA, 2006.
- Paolocci, F.; Bovone, T.; Tosti, N.; Arcioni, S.; Damiani, F. Light and an exogenous transcription factor qualitatively and quantitatively affect the biosynthetic pathway of condensed tannins in Lotus corniculatus leaves. J. Exp. Bot. 2005, 56, 1093–1103. [Google Scholar] [CrossRef] [Green Version]
- Escaray, F.J.; Passeri, V.; Perea-García, A.; Antonelli, C.J.; Damiani, F.; Ruiz, O.A.; Paolocci, F. The R2R3-MYB TT2b and the bHLH TT8 genes are the major regulators of proanthocyanidin biosynthesis in the leaves of Lotus species. Planta 2017, 246, 243–261. [Google Scholar] [CrossRef]
- Bizzarri, M.; Delledonne, M.; Ferrarini, A.; Tononi, P.; Zago, E.; Vittori, D.; Damiani, F.; Paolocci, F. Whole-Transcriptome Analysis Unveils the Synchronized Activities of Genes for Fructans in Developing Tubers of the Jerusalem Artichoke. Front. Plant Sci. 2020, 11, 101. [Google Scholar] [CrossRef]
- He, J.; Benedito, V.A.; Wang, M.; Murray, J.D.; Zhao, P.X.; Tang, Y.; Udvardi, M.K. The Medicago truncatula gene expression atlas web server. BMC Bioinform. 2009, 10, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Carrere, S.; Verdier, J.; Gamas, P. MtExpress, a Comprehensive and Curated RNAseq-based Gene Expression Atlas for the Model Legume Medicago truncatula. Plant Cell Physiol. 2021, 62, 1494–1500. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | N° Accession |
---|---|---|---|
Actin | TCAATGTGCCTGCCATGTATGT | ACTCACACCGTCACCAGAATCC | JQ028731.1 |
4CL | AGGAGGCAACCAGATCGACCAT | CAAACGATCGACGACAAATAAGAATCC | XM_013610757.3 |
C4H | CGATATCCCAGCCGAGAGCAA | AAGAACCGTTCGGGCCTGAAT | HM627322.1 |
CHS | GGTTCAGACCCATTACCACAAGTTGA | TGTAAGCCCGACTTCACGAAGGT | XM_003601599.4 |
CHI | GTAGCCATTTGGAAGTCTCTTGGGA | ATAGAGGAGCCTGGTGGAAATGTTT | XM_003592720.4 |
F3’H | GTCTTGGTCTTAGGATGGTTCAACTTCTTA | CTCTGTAAGGTGAGCCCATATGCTTCA | XM_013602525.3 |
DFR1 | GGCTATGTGTCTTTATGTGTGTTTCTGTG | AGTTTGGGCTTCAACAGGATTGC | AY389346.1 |
ANS | AAGAAGCTGGTGGAATGGAAGAG | GGTTGAGGGCAAATTGGGTAG | EF544389.1 |
ANR | GTCGGGCTCATATTTTTGTGGC | GAAACTTTGCAAGCTCGGGAACACTG | AY184243.1 |
UGT72L1 | CACTGGCTTGGAGCTTCTATTTG | CAGCCCGGTACTTTGATAGGC | EU434684.1 |
GSTF7 | CAGTTGTAGAGGATGGTGATTTCAGA | ACCACGGTCTGCATACTTTGTT | MtrunR108HiC_012760 |
LAR | GAGGTTTTTGCCTTCAGAATTTGG | GGGTGGAGGAAGCTGTGATGG | BN000703.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Panara, F.; Passeri, V.; Lopez, L.; Porceddu, A.; Calderini, O.; Paolocci, F. Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula. Plants 2022, 11, 1318. https://doi.org/10.3390/plants11101318
Panara F, Passeri V, Lopez L, Porceddu A, Calderini O, Paolocci F. Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula. Plants. 2022; 11(10):1318. https://doi.org/10.3390/plants11101318
Chicago/Turabian StylePanara, Francesco, Valentina Passeri, Loredana Lopez, Andrea Porceddu, Ornella Calderini, and Francesco Paolocci. 2022. "Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula" Plants 11, no. 10: 1318. https://doi.org/10.3390/plants11101318