Profiling Cannabinoid Contents and Expression Levels of Corresponding Biosynthetic Genes in Commercial Cannabis (Cannabis sativa L.) Cultivars
Abstract
:1. Introduction
2. Results
2.1. New Decarboxylation Conditions of Acidic Cannabinoids for Liquid Chromatography (LC) Analysis
2.2. Evaluation of New Decarboxylation Conditions Using Cannabis Plant Extracts
2.3. Analysis of Cannabinoid Composition and Levels in Different Tissues of Cannabis Cultivars
2.4. Expression Profiling of CsCBGAS, CsCBCAS, CsCBDAS, and CsTHCAS in Cannabis Cultivars
3. Discussion
4. Materials and methods
4.1. Plant Materials
4.2. RNA Expression Analyses
4.3. Plasmid Constructions
4.4. Extract Preparation and Decarboxylation Reactions
4.5. Analytical Conditions for HPLC of Cannabinoids
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Karche, T.; Singh, M.R. The application of hemp (Cannabis sativa L.) for a green economy: A review. Turk. J. Bot. 2019, 43, 710–723. [Google Scholar] [CrossRef]
- Hesami, M.; Pepe, M.; Baiton, A.; Salami, S.A.; Jones, A.M.P. New Insight into Ornamental Applications of Cannabis: Perspectives and Challenges. Plants 2022, 11, 2383. [Google Scholar] [CrossRef] [PubMed]
- Patel, R.S.; Kamil, S.; Shah, M.R.; Bhimanadham, N.N.; Imran, S. Pros and Cons of Marijuana in Treatment of Parkinson’s Disease. Cureus 2019, 11, e4813. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schluttenhofer, C.; Yuan, L. Challenges towards Revitalizing Hemp: A Multifaceted Crop. Trends Plant Sci. 2017, 22, 917–929. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giacoppo, S.; Mandolino, G.; Galuppo, M.; Bramanti, P.; Mazzon, E. Cannabinoids: New Promising Agents in the Treatment of Neurological Diseases. Molecules 2014, 19, 18781–18816. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Citti, C.; Pacchetti, B.; Vandelli, M.A.; Forni, F.; Cannazza, G. Analysis of cannabinoids in commercial hemp seed oil and decarboxylation kinetics studies of cannabidiolic acid (CBDA). J. Pharm. Biomed. Anal. 2018, 149, 532–540. [Google Scholar] [CrossRef] [PubMed]
- Mechoulam, R.; Hanus, L. Cannabidiol: An overview of some chemical and pharmacological aspects. Part I: Chemical aspects. Chem. Phys. Lipids 2002, 121, 35–43. [Google Scholar] [CrossRef]
- Volkow, N.D.; Baler, R.D.; Compton, W.M.; Weiss, S.R.B. Adverse Health Effects of Marijuana Use. N. Engl. J. Med. 2014, 370, 2219–2227. [Google Scholar] [CrossRef] [Green Version]
- Hill, K.P. Medical Marijuana for Treatment of Chronic Pain and Other Medical and Psychiatric Problems A Clinical Review. JAMA J. Am. Med. Assoc. 2015, 313, 2474–2483. [Google Scholar] [CrossRef]
- Grotenhermen, F.; Muller-Vahl, K. Medicinal Uses of Marijuana and Cannabinoids. Crit. Rev. Plant Sci. 2016, 35, 378–405. [Google Scholar] [CrossRef]
- Johnson, R. Hemp as an Agricultural Commodity; Congressional Research Service: Washington, DC, USA, 2017. [Google Scholar]
- Kovalchuk, I.; Pellino, M.; Rigault, P.; van Velzen, R.; Ebersbach, J.; Ashnest, J.R.; Mau, M.; Schranz, M.E.; Alcorn, J.; Laprairie, R.B.; et al. The Genomics of Cannabis and Its Close Relatives. Annu. Rev. Plant Biol. 2020, 71, 713–739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hesami, M.; Pepe, M.; Alizadeh, M.; Rakei, A.; Baiton, A.; Jones, A.M.P. Recent advances in cannabis biotechnology. Ind. Crop Prod. 2020, 158, 113026. [Google Scholar] [CrossRef]
- Brian, F.; Thomas, M.A.E. The Analytical Chemistry of Cannabis; Elsevier: Amsterdam, The Netherlands, 2016. [Google Scholar]
- Dewick, P.M. Medicinal Natural Products: A Biosynthetic Approach, 3rd ed.; John Wiley & Sons: Chichester, UK, 2009. [Google Scholar]
- Sirikantaramas, S.; Morimoto, S.; Shoyama, Y.; Ishikawa, Y.; Wada, Y.; Shoyama, Y.; Taura, F. The gene controlling marijuana psychoactivity—Molecular cloning and heterologous expression of Delta(1)-tetrahydrocannabinolic acid synthase from Cannabis sativa L. J. Biol. Chem. 2004, 279, 39767–39774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taura, F.; Sirikantaramas, S.; Shoyama, Y.; Yoshikai, K.; Shoyama, Y.; Morimoto, S. Cannabidiolic-acid synthase, the chemotype-determining enzyme in the fiber-type Cannabis sativa. FEBS Lett. 2007, 581, 2929–2934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morimoto, S.; Komatsu, K.; Taura, F.; Shoyama, Y. Enzymological evidence for cannabichromenic acid biosynthesis. J. Nat. Prod. 1997, 60, 854–857. [Google Scholar] [CrossRef]
- Morimoto, S.; Komatsu, K.; Taura, F.; Shoyama, Y. Purification and characterization of cannabichromenic acid synthase from Cannabis sativa. Phytochemistry 1998, 49, 1525–1529. [Google Scholar] [CrossRef]
- Taura, F.; Morimoto, S.; Shoyama, Y. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L. Biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid. J. Biol. Chem. 1996, 271, 17411–17416. [Google Scholar] [CrossRef] [Green Version]
- Shoyama, Y.; Tamada, T.; Kurihara, K.; Takeuchi, A.; Taura, F.; Arai, S.; Blaber, M.; Shoyama, Y.; Morimoto, S.; Kuroki, R. Structure and Function of Delta 1-Tetrahydrocannabinolic Acid (THCA) Synthase, the Enzyme Controlling the Psychoactivity of Cannabis sativa. J. Mol. Biol. 2012, 423, 96–105. [Google Scholar] [CrossRef]
- Laverty, K.U.; Stout, J.M.; Sullivan, M.J.; Shah, H.; Gill, N.; Holbrook, L.; Deikus, G.; Sebra, R.; Hughes, T.R.; Page, J.E.; et al. A physical and genetic map of Cannabis sativa identifies extensive rearrangements at the THC/CBD acid synthase loci. Genome Res. 2019, 29, 146–156. [Google Scholar] [CrossRef] [Green Version]
- Van Velzen, R.; Schranz, M.E. Origin and Evolution of the Cannabinoid Oxidocyclase Gene Family. Genome Biol. Evol. 2021, 13, evab130. [Google Scholar] [CrossRef]
- Tan, Z.G.; Clomburg, J.M.; Gonzalez, R. Synthetic Pathway for the Production of Olivetolic Acid in Escherichia coli. Acs Synth. Biol. 2018, 7, 1886–1896. [Google Scholar] [CrossRef] [PubMed]
- Turner, C.E.; Elsohly, M.A.; Boeren, E.G. Constituents of Cannabis-Sativa L. 17. A Review of the Natural Constituents. J. Nat. Prod. 1980, 43, 169–234. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wang, Y.H.; Avula, B.; Radwan, M.M.; Wanas, A.S.; Mehmedic, Z.; van Antwerp, J.; ElSohly, M.A.; Khan, I.A. Quantitative Determination of Cannabinoids in Cannabis and Cannabis Products Using Ultra-High-Performance Supercritical Fluid Chromatography and Diode Array/Mass Spectrometric Detection. J. Forensic. Sci. 2017, 62, 602–611. [Google Scholar] [CrossRef] [PubMed]
- Richins, R.D.; Rodriguez-Uribe, L.; Lowe, K.; Ferral, R.; O’Connell, M.A. Accumulation of bioactive metabolites in cultivated medical Cannabis. PLoS ONE 2018, 13, e0201119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zivovinovic, S.; Alder, R.; Allenspach, M.D.; Steuer, C. Determination of cannabinoids in Cannabis sativa L. samples for recreational, medical, and forensic purposes by reversed-phase liquid chromatography-ultraviolet detection. J. Anal. Sci. Technol. 2018, 9, 27. [Google Scholar] [CrossRef] [Green Version]
- United Nations Office on Drugs and Crime. Recommended Methods for the Identification and Analysis of Cannabis and Cannabis Products; United Nations Office on Drugs and Crime: Vienna, Austria, 2022. [Google Scholar]
- Dussy, F.E.; Hamberg, C.; Luginbuhl, M.; Schwerzmann, T.; Briellmann, T.A. Isolation of Delta(9)-THCA-A from hemp and analytical aspects concerning the determination of Delta(9)-THC in cannabis products. Forensic. Sci. Int. 2005, 149, 3–10. [Google Scholar] [CrossRef]
- Wang, M.; Wang, Y.H.; Avula, B.; Radwan, M.M.; Wanas, A.S.; van Antwerp, J.; Parcher, J.F.; ElSohly, M.A.; Khan, I.A. Decarboxylation Study of Acidic Cannabinoids: A Novel Approach Using Ultra-High-Performance Supercritical Fluid Chromatography/Photodiode Array-Mass Spectrometry. Cannabis Cannabinoid Res. 2016, 1, 262–271. [Google Scholar] [CrossRef] [Green Version]
- Kim, P.G.; Kim, E.S. Accumulation of Cannabinoids in Glandular Trichomes of Cannabis (Cannabaceae). J. Ind. Hemp 2004, 9, 15–36. [Google Scholar] [CrossRef]
- Sirikantaramas, S.; Taura, F.; Tanaka, Y.; Ishikawa, Y.; Morimoto, S.; Shoyama, Y. Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana psychoactivity, is secreted into the storage cavity of the glandular trichomes. Plant Cell Physiol. 2005, 46, 1578–1582. [Google Scholar] [CrossRef]
- Flores-Sanchez, I.J.; Verpoorte, R. Secondary metabolism in cannabis. Phytochem. Rev. 2008, 7, 615–639. [Google Scholar] [CrossRef]
- Happyana, N.; Agnolet, S.; Muntendam, R.; Van Dam, A.; Schneider, B.; Kayser, O. Analysis of cannabinoids in laser-microdissected trichomes of medicinal Cannabis sativa using LCMS and cryogenic NMR. Phytochemistry 2013, 87, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Small, E. Evolution and Classification of Cannabis sativa (Marijuana, Hemp) in Relation to Human Utilization. Bot. Rev. 2015, 81, 189–294. [Google Scholar] [CrossRef]
- Spitzer-Rimon, B.; Duchin, S.; Bernstein, N.; Kamenetsky, R. Architecture and Florogenesis in Female Cannabis sativa Plants. Front. Plant Sci. 2019, 10, 350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hurgobin, B.; Tamiru-Oli, M.; Welling, M.T.; Doblin, M.S.; Bacic, A.; Whelan, J.; Lewsey, M.G. Recent advances in Cannabis sativa genomics research. New Phytol. 2021, 230, 73–89. [Google Scholar] [CrossRef] [PubMed]
- ElSohly, M.A.; Slade, D. Chemical constituents of marijuana: The complex mixture of natural cannabinoids. Life Sci. 2005, 78, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Hewavitharana, A.K.; Golding, G.; Tempany, G.; King, G.; Holling, N. Quantitative GGMS analysis of Delta(9)-tetrahydrocannabinol in fiber hemp varieties. J. Anal. Toxicol. 2005, 29, 258–261. [Google Scholar] [CrossRef] [Green Version]
- Teh, S.S.; Birch, E.J. Effect of ultrasonic treatment on the polyphenol content and antioxidant capacity of extract from defatted hemp, flax and canola seed cakes. Ultrason. Sonochem. 2014, 21, 346–353. [Google Scholar] [CrossRef]
- Brusotti, G.; Cesari, I.; Dentamaro, A.; Caccialanza, G.; Massolini, G. Isolation and characterization of bioactive compounds from plant resources: The role of analysis in the ethnopharmacological approach. J. Pharmaceut. Biomed. 2014, 87, 218–228. [Google Scholar] [CrossRef]
- Pacifico, D.; Miselli, F.; Carboni, A.; Moschella, A.; Mandolino, G. Time course of cannabinoid accumulation and chemotype development during the growth of Cannabis sativa L. Euphytica 2008, 160, 231–240. [Google Scholar] [CrossRef]
- Massuela, D.C.; Hartung, J.; Munz, S.; Erpenbach, F.; Graeff-Honninger, S. Impact of Harvest Time and Pruning Technique on Total CBD Concentration and Yield of Medicinal Cannabis. Plants 2022, 11, 140. [Google Scholar] [CrossRef]
- Fulvio, F.; Paris, R.; Montanari, M.; Citti, C.; Cilento, V.; Bassolino, L.; Moschella, A.; Alberti, I.; Pecchioni, N.; Cannazza, G.; et al. Analysis of Sequence Variability and Transcriptional Profile of Cannabinoid synthase Genes in Cannabis sativa L. Chemotypes with a Focus on Cannabichromenic acid synthase. Plants 2021, 10, 1857. [Google Scholar] [CrossRef]
- Guo, R.; Guo, H.Y.; Zhang, Q.Y.; Guo, M.B.; Xu, Y.P.; Zeng, M.; Lv, P.; Chen, X.; Yang, M. Evaluation of reference genes for RT-qPCR analysis in wild and cultivated Cannabis. Biosci. Biotech. Bioch. 2018, 82, 1902–1910. [Google Scholar] [CrossRef] [PubMed]
Gene Name (ID) | Purpose | Sequence (5′ to 3′) | Direction |
---|---|---|---|
CsCBCAS (KJ469378) | Gene cloning | ATGAATTGCTCAACATTCTCCTTTTGG | F |
TTAATGATGATGCGGTGGAAGAGG | R | ||
RT-qPCR | TAACAATCCAGCAAATCCAAAATTCA | F | |
GGAGCAGAGAATACTGGCC | R | ||
CsCBDAS (KP970860) | Gene cloning | ATGAAGTGCTCAACATTCTCCTTTTG | F |
TTAATGACGATGCCGTGGAAG | R | ||
RT-qPCR | AAGTGAAAACCCTGGTTGATCC | F | |
GAGCATACACAGTACATCCGG | R | ||
CsTHCAS (KJ469378) | Gene cloning | ATGAATTGCTCAGCATTTTCCTTTTGG | F |
TTAATGATGATGCGGTGGAAGAGG | R | ||
RT-qPCR | TTAGGAAAAACTAATCATGCG | F | |
CAATAAATGTATGTATGGTATAATGATTA | R | ||
CsCBGAS (BK010648) | Gene cloning | ATGGAGGTCTCATCAGTTTGC | F |
TTATATAAATACATATACAAAG | R | ||
RT-qPCR | CCATATCGAGTCATTTGGGCTT | F | |
GGCAAAAGCAATAGTCATACCC | R | ||
CsEF1a (JP452083) | RT-qPCR | GCTTTGATACCCCTCCACAA | F |
AGTATCCGCGAGCTTGACAT | R |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, A.L.; Yun, Y.J.; Choi, H.W.; Hong, C.-H.; Shim, H.J.; Lee, J.H.; Kim, Y.-C. Profiling Cannabinoid Contents and Expression Levels of Corresponding Biosynthetic Genes in Commercial Cannabis (Cannabis sativa L.) Cultivars. Plants 2022, 11, 3088. https://doi.org/10.3390/plants11223088
Kim AL, Yun YJ, Choi HW, Hong C-H, Shim HJ, Lee JH, Kim Y-C. Profiling Cannabinoid Contents and Expression Levels of Corresponding Biosynthetic Genes in Commercial Cannabis (Cannabis sativa L.) Cultivars. Plants. 2022; 11(22):3088. https://doi.org/10.3390/plants11223088
Chicago/Turabian StyleKim, Ae Lim, Young Jae Yun, Hyong Woo Choi, Chang-Hee Hong, Hyun Joo Shim, Jeong Hwan Lee, and Young-Cheon Kim. 2022. "Profiling Cannabinoid Contents and Expression Levels of Corresponding Biosynthetic Genes in Commercial Cannabis (Cannabis sativa L.) Cultivars" Plants 11, no. 22: 3088. https://doi.org/10.3390/plants11223088